An engineered bacterium with high astaxanthin production, and its construction method and application

Abstract

The present invention relates to the field of bioengineering, and in particular to an engineering bacterium with high yield of astaxanthin and its construction method and application. The present invention starts with wild-type Yarrowia lipolytica, introduces four genes of carB, carRP, crtZ and crBKT through a non-homologous recombination strategy, further overexpresses the key enzyme encoding gene in the mevalonate pathway (MVA) pathway to increase the yield of astaxanthin, and realizes the efficient production of the natural product astaxanthin. At the same time, the recombinant Yarrowia lipolytica provided by the present invention uses copper ion induction expression promoter MT-2 to control the expression of β-carotene ketolase crBKT gene, so that it keeps spatiotemporal differential expression with β-carotene hydroxylase gene crtZ, and when high concentration of intracellular zeaxanthin accumulates, copper ions are added to induce the expression of β-carotene ketolase crBKT gene, reduce the production of intermediate metabolic byproducts, and promote the efficient production of astaxanthin.

Description

Technical Field

[0001] The invention relates to the field of bioengineering, and in particular to an engineering bacterium with high astaxanthin production, a construction method and application thereof. Background Art

[0002] Astaxanthin (Astaxanthin, 3,3'-dihydroxy-β,β-carotene-4,4'-dione, molecular formula C 40 H 52 Astaxanthin (O4) is a fat-soluble ketocarotenoid with 13 conjugated double bonds. Astaxanthin has a variety of biological activities, including antioxidant, anti-inflammatory, prevention of cardiovascular disease, treatment of diabetes, photoprotection, anti-tumor, liver protection, immunity enhancement, anti-aging, etc., so it is widely used in beauty and cosmetics, health care, agricultural feed, food industry and other fields.

[0003] At present, the production methods of astaxanthin mainly include chemical synthesis, extraction and microbial biosynthesis. The most common and widely used strategy is to extract it from shrimp shells, crab shells and other crustacean wastes, but its content is still very low, the extraction process is complicated and easy to cause pollution. The chemical synthesis of astaxanthin is a relatively mature process, but the astaxanthin synthesized by chemical synthesis has low antioxidant activity and high pollution in the synthesis process. At present, both chemical synthesis and plant extraction of astaxanthin have the disadvantages of high energy consumption, unfriendly environment and many by-products.

[0004] Compared with extraction and chemical synthesis methods, biological synthesis of astaxanthin is not only highly efficient and environmentally friendly, but also has high purity and basically no toxic side effects. It is considered to be the most attractive method. As an oil yeast, Yarrowia lipolytica can provide necessary precursor metabolites and storage space for carotenoids. This strain has a wide range of substrate utilization capabilities and is also recognized as a safe strain. However, to date, there are limited reports on the production of astaxanthin using Yarrowia lipolytica, and the yield is generally low. Therefore, it is urgent to develop genetically engineered Yarrowia lipolytica bacteria that can produce large amounts of astaxanthin. Summary of the invention

[0005] The purpose of the present invention is to provide an engineered bacterium with high astaxanthin production and a construction method and application thereof, so as to solve the problems existing in the above-mentioned prior art. The engineered bacterium provided by the present invention can produce high astaxanthin, with a shake flask fermentation yield of about 400 mg / L and a fermentation tank yield of about 4.1 g / L, which is fully capable of commercial production and has good industrial application prospects.

[0006] To achieve the above object, the present invention provides the following solutions:

[0007] The present invention provides an engineering bacterium for high-yield astaxanthin, comprising the following steps:

[0008] The initial strain of the engineered bacteria is Yarrowia lipolytica, and the expression cassettes of the phytoene dehydrogenase gene carB, the phytoene synthase / lycopene cyclase gene carRP, the β-carotene ketolase gene crBKT and the β-carotene hydroxylase gene crtZ are introduced, and the HMG-CoA reductase encoding gene HMG1 and the GGPP synthase encoding gene GGS1 are overexpressed at the same time to obtain the engineered bacteria.

[0009] The nucleotide sequence of the phytoene dehydrogenase gene carB is shown in SEQ ID NO.1;

[0010] The nucleotide sequence of the phytoene synthase / lycopene cyclase gene carRP is shown in SEQ ID NO.2;

[0011] The nucleotide sequence of the β-carotene ketolase gene crBKT is shown in SEQ ID NO.3;

[0012] The nucleotide sequence of the β-carotene hydroxylase gene crtZ is shown in SEQ ID NO.4.

[0013] Preferably, the GenBank number of the HMG-CoA reductase encoding gene HMG1 is NP_732900.1; the GenBank number of the GGPP synthase encoding gene GGS1 is XP_045941587.1.

[0014] Preferably, the Yarrowia lipolytica is Yarrowia lipolytica MYA2613.

[0015] Preferably, the promoter of the expression cassette includes hp4d promoter or copper ion inducible promoter MT-2, and the terminator is CYC1 terminator; the nucleotide sequence of the copper ion inducible promoter MT-2 is shown in SEQ ID NO.5.

[0016] The present invention provides a method for constructing the above-mentioned engineering bacteria, comprising the following steps:

[0017] The expression cassettes of the phytoene dehydrogenase gene carB, the phytoene synthase / lycopene cyclase gene carRP, the β-carotene ketolase gene crBKT, and the β-carotene hydroxylase gene crtZ were introduced into the initial strain in the form of plasmids to obtain the recombinant strain 1;

[0018] The HMG-CoA reductase encoding gene HMG1 and the GGPP synthase encoding gene GGS1 are overexpressed in the recombinant bacteria 1 to obtain the engineered bacteria.

[0019] Preferably, the GenBank number of the HMG-CoA reductase encoding gene HMG1 is NP_732900.1; the GenBank number of the GGPP synthase encoding gene GGS1 is XP_045941587.1.

[0020] Preferably, the Yarrowia lipolytica is Yarrowia lipolytica MYA2613;

[0021] The promoter of the expression cassette includes hp4d promoter or copper ion inducible promoter MT-2, and the terminator is CYC1 terminator; the nucleotide sequence of the copper ion inducible promoter MT-2 is shown in SEQ ID NO.5.

[0022] The present invention provides the use of the above-mentioned engineering bacteria in producing astaxanthin.

[0023] The invention provides a method for producing astaxanthin, comprising the step of producing astaxanthin by fermentation using the above-mentioned engineering bacteria.

[0024] Preferably, the culture medium used for the fermentation comprises components in the following concentrations: 30 g / L corn steep liquor dry powder, 20 g / L soy peptone, 20 g / L glucose, 2 g / L soybean oil, 4 g / L pyruvic acid and 250 μmol / L copper sulfate.

[0025] The present invention discloses the following technical effects:

[0026] The present invention starts with wild-type Yarrowia lipolytica, and introduces four genes, carB, carRP, crtZ and crBKT, through a non-homologous recombination (NHEJ) strategy. The strain can successfully produce and measure astaxanthin, and further overexpresses key enzyme encoding genes (HMG-CoA reductase encoding gene HMG1, GGPP synthase encoding gene GGS1) in the mevalonate pathway (MVA) pathway to increase the yield of astaxanthin. The recombinant Yarrowia lipolytica provided by the present invention overexpresses the HMG-CoA reductase encoding gene HMG1 and the GGPP synthase encoding gene GGS1, achieving efficient production of the natural product astaxanthin. At the same time, the recombinant Yarrowia lipolytica provided by the present invention uses the copper ion induction expression promoter MT-2 to control the expression of the β-carotene ketolase crBKT gene, so that it maintains temporal and spatial differential expression with the β-carotene hydroxylase gene crtZ. When the intracellular zeaxanthin accumulates at a high concentration, copper ions are added to induce the expression of the β-carotene ketolase crBKT gene, reduce the production of intermediate metabolic byproducts, and promote the efficient production of astaxanthin. The engineered bacteria of the present invention have an astaxanthin shake flask fermentation yield of about 400 mg / L, and a fermentation tank yield of about 4.1 g / L, which is fully capable of commercial production and has good industrial application prospects.

[0027] The present invention also provides a genetically engineered Yarrowia lipolytica bacterium, which has a simple construction method, low production cost, is suitable for large-scale production, and has great application prospects in the field of astaxanthin biosynthesis.

[0028] The present invention also provides a method for producing astaxanthin by fermentation using the engineered bacteria. During the fermentation process, a batch feed fermentation strategy is used to further increase the yield of astaxanthin. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0030] Figure 1 Comparison of HPLC chromatograms of astaxanthin extracted from engineered strains FSQ01 (A) and FSQ03 (B). DETAILED DESCRIPTION

[0031] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but should be understood as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0032] It should be understood that the terms described in the present invention are only for describing a particular embodiment and are not intended to limit the present invention. In addition, for the numerical range in the present invention, it should be understood that each intermediate value between the upper and lower limits of the scope is also specifically disclosed. The intermediate value in any stated value or stated range, and each smaller range between any other stated value or intermediate value in the described range is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded in the scope.

[0033] Unless otherwise indicated, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art. Although the present invention describes only preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of a conflict with any incorporated document, the content of this specification shall prevail.

[0034] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments of the present invention description without departing from the scope or spirit of the present invention. Other embodiments derived from the present invention description will be apparent to those skilled in the art. The present invention description and examples are exemplary only.

[0035] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0036] Unless otherwise specified, the methods used in the embodiments are all well known to those skilled in the art.

[0037] Example 1

[0038] Plasmid pUC19-rDNA-HisG, disclosed in the Chinese patent "A genetically engineered Yarrowia lipolytica strain producing α-pinene and its application";

[0039] The astaxanthin synthesis-related genes are preferably based on the phytoene synthase / lycopene cyclase gene crtRP and the phytoene dehydrogenase gene crtB from Mucor circinelloides, the β-carotene hydroxylase encoding gene crtZ from Pantoea agglomerans, and the β-carotene ketolase encoding gene crBKT from Chlamydomonas reinhardtii, wherein the GenBank number of the phytoene dehydrogenase gene crtB is AJ238028.1, and the GenBank number of the phytoene synthase / lycopene cyclase gene crtRP is AJ250827.1. , the GenBank number of the β-carotene ketolase encoding gene crBKT is MG976837, and the GenBank number of the β-carotene hydroxylase encoding gene crtZ is: HQ003247.1; then codon optimization is performed according to the codon preference of Yarrowia lipolytica, and the sequences of the codon-optimized phytoene synthase / lycopene cyclase gene crtRP, phytoene dehydrogenase gene crtB, β-carotene hydroxylase encoding gene crtZ and β-carotene ketolase encoding gene crBKT are preferably as shown in SEQ Sequences shown in ID NO.1-4; genes related to astaxanthin synthesis are derived from the phytoene synthase / lycopene cyclase gene crtRP and the phytoene dehydrogenase gene crtB of Mucor circinelloides, and from the β-carotene hydroxylase encoding gene crtZ, which are respectively regulated by the hp4d promoter, and from the β-carotene ketolase encoding gene, which is regulated by the endogenous copper ion inducible promoter MT-2;

[0040] The nucleotide sequence of the hp4d promoter is disclosed in Madzak C, Tréton B and Roland SB. Strong hybrid promoters and integrative expression / secretion vectors for quasi-constitutive expression of heterologous proteins in the yeast Yarrowialipolytica. J Mol Microbiol Biotechnol. (2000) 2(2): 207-216;

[0041] The nucleotide sequence of the CYC1 terminator is disclosed in Kathleen A. Curran, Nicholas J. Morse, Kelly A. Markham, Allison M. Wagman, Akash Gupta, and Hal S. Alper. Short Synthetic Terminators for Improved Heterologous Gene Expression in Yeast. ACS Synth Biol. (2015) 4(7): 824-832;

[0042]

[0043]

[0044]

[0045] The codon-optimized β-carotene hydroxylase gene crtZ sequence is shown in SEQ ID NO.4, specifically:

[0046] A Yarrowia lipolytica strain capable of producing astaxanthin was constructed. The specific construction method is as follows:

[0047] Using Yarrowia lipolytica MYA2613 as the starting bacterium, the codon-optimized phytoene dehydrogenase gene carB, the codon-optimized phytoene synthase / lycopene cyclase gene carRP, the codon-optimized β-carotene ketolase gene crBKT and the codon-optimized β-carotene hydroxylase gene crtZ were integrated into the genome of Yarrowia lipolytica using a non-homologous recombination strategy. The specific steps were to construct a gene expression cassette controlled by the hp4d promoter and the CYC1 terminator, that is, an expression cassette in which the hp4d promoter, the target gene and the CYC1 terminator were sequentially connected, and were denoted as P hp4d -carB gene-T CYC1 Expression cassette, P hp4d -carRP gene-T CYC1 Expression cassette, P hp4d -crtZ gene-TCYC1 Expression cassette and P hp4d -crBKT-T CYC1 Gene expression cassette.

[0048] Afterwards, each expression cassette obtained was ligated to the plasmid pUC19-rDNA-HisG through the restriction site EcoR I to obtain the plasmid pUC19-rDNA-HisG-carB-carRP-crtZ-crBKT;

[0049] The obtained plasmid was linearized using Avrll enzyme and transformed into Yarrowia lipolytica strain using homologous recombination to obtain the engineered strain FSQ01 expressing carB, carRP, crtZ, and crBKT genes.

[0050] Example 2

[0051] The HMG-CoA reductase encoding gene HMG1 and the GGPP synthase encoding gene GGS1 are key genes in the mevalonate pathway, preferably the HMG-CoA reductase encoding gene HMG1 and the GGPP synthase encoding gene GGS1 derived from Yarrowia lipolytica yeast itself, the GGPP synthase encoding gene GGS1 is expressed by the TEFin promoter, the HMG-CoA reductase encoding gene HMG1 is expressed by the TEF promoter, the GenBank number of the HMG-CoA reductase encoding gene HMG1 is NP_732900.1, and the GenBank number of the GGPP synthase encoding gene GGS1 is XP_045941587.1.

[0052] The nucleotide sequence of the TEFin promoter is disclosed in Kathleen A. Curran, Nicholas J. Morse, Kelly A. Markham, Allison M. Wagman, Akash Gupta, and Hal S. Alper. Short Synthetic Terminators for Improved Heterologous Gene Expression in Yeast. ACS Synth Biol. (2015) 4(7): 824-832;

[0053] The nucleotide sequence of the TEF promoter is disclosed in Kathleen A. Curran, Nicholas J. Morse, Kelly A. Markham, Allison M. Wagman, Akash Gupta, and Hal S. Alper. Short Synthetic Terminators for Improved Heterologous Gene Expression in Yeast. ACS Synth Biol. (2015) 4(7): 824-832.

[0054] Overexpression of HMG1 and GGS1 resulted in increased astaxanthin production. The specific construction method is as follows:

[0055] First, construct plasmids pINA1269HMG1 and pINA1269HMG1GGS2 containing key genes of the MVA pathway. The specific steps are as follows: the HMG-CoA reductase encoding gene HMG1 (accession number: NP_732900.1, the gene is preferably derived from Yarrowia lipolytica) carrying a TEFin promoter and the GGPP synthase encoding gene GGS1 (accession number: XP_045941587.1, the gene is preferably derived from Yarrowia lipolytica) carrying a TEF promoter are respectively connected to the plasmid pINA1269 through the restriction site Pml I to obtain plasmids pINA1269 HMG1 and pINA1269 GGS2, and then the expression cassette of the GGS2 gene (pINA1269 GGS2) is connected to the plasmid pINA1269 HMG1 through the restriction site Spe I to obtain the plasmid pINA1269HMG1GGS2. Finally, the plasmid pINA1269HMG1GGS2 was linearized using NdeΙ and then transferred into the strain FSQ01 to obtain the strain FSQ02 with greatly improved astaxanthin production capacity.

[0056] Example 3

[0057] The copper ion-inducible promoter MT-2 was obtained by PCR amplification using the genome of Yarrowia lipolytica as a template using primers MT2_fwd and MT2_rev.

[0058] The sequence of the copper ion-induced promoter MT-2 is shown in SEQ ID NO.5, specifically: TATGTGTGTGTGTGTGTGTGTGTGTGTGTGAGTGTGTGACAACCGAATTGCGGATCTCGTCTCCTATTTATATCTGCTGCTGCTGTTGCGAAGAGCACATATTGCAATCTGGTAATTTTTCACTTTTTTACTAATTATTTCAGCCGCAGCGATAATCTCGCATCTCGCATACAAGCGAAACCTTAGCAGCATAAACCCCTCGAATGCTCCAGTAATGCGCGGTAAAATACCACTGAAACGGGGCTAAATTCGGCCAAACGGCATTAATAATGAAATATCTCACAATAATAGCCCCTCCTAGTGTTTCGGAGTCCGAATGTCTAGCATCATGTGGACTTGTGCGTTTTCGGAGTCCTATTGGAATATACACTTCGGAACTTTGACGAGAGATCTACAATATGTACGATGCACCTGACACAGACGTTGGAAGAATGGAGAAGGATAGAGACTTGAGTGGCACGCTTATAATGACATTAGTTCGAGTTGAATGTTAAAAGTAGGTGAATCGAATCCACATAGTCCAGGTTGAGTTGCTTCTCGTACACCCTTGTACAATTACTATCCTTCACACCTTTACACATTTCCATTCTCTTTCAGACCCTTCTAGCAAGTTCTACAAAGACATTGTTTACTTTAGCGCCACCTAAATCTTAGTCAATCATTGGAGATATGAGAAGTTTGTGCCACGGCTGTGCCTTTTTTCTTTGTCTAACCGCATTCTTTGCGACATTAGTGCTACTGCCGATGCAGATGCGTACTTTGCGCTGCGGCTGAATACAACTGTATTTTGAAGATCTAGGAACGGGAAAATCTATAAATACGGCCAGATGTCCCTCCTTTTCTCACTGCACAGACATCTTTTCATTCACCACTCTCAACACTACTTCCAAACTCACTATCTCA;

[0059] The primers for amplifying the copper ion-induced promoter MT-2 are specifically:

[0060] The sequence of MT2_fwd is shown in SEQ ID NO.6, specifically: TATGTGTGTGTGTGTGT;

[0061] The MT2_rev sequence is shown in SEQ ID NO.7, specifically: CATTGAGATAGTGAGTT.

[0062] The promoter hp4d of the crBKT gene in Example 1 was replaced with the copper ion-inducible promoter MT-2 to obtain the copper ion-inducible promoter MT-2-crBKT gene-T CYC1 expression cassette;

[0063] P hp4d -carB gene-T CYC1 Expression cassette, P hp4d -carRP gene-T CYC1 Expression cassette, P hp4d -crtZ gene-T CYC1 Expression cassette and P MT -2-crBKT gene-T CYC1 The expression cassette was ligated to the plasmid pUC19-rDNA-HisG through the restriction site EcoR I to obtain the plasmid pUC19-rDNA-HisG-carB-carRP-crtZ-crBKT;

[0064] The plasmid pUC19-rDNA-HisG-carB-carRP-crtZ-crBKT was introduced into Yarrowia lipolytica MYA2613 together with the plasmid pINA1269HMG1GGS2 in Example 2 to obtain the FSQ3 strain with reduced by-product production and further improved astaxanthin production.

[0065] Example 4 Comparison of HPLC spectra of astaxanthin extracted from engineered strains FSQ01 and FSQ03

[0066] The HPLC spectra of astaxanthin extracted from the engineered strains FSQ01 and FSQ03 were compared, wherein the HPLC liquid phase conditions were: using C 18 Reverse phase chromatography column, mobile phase is acetonitrile: water: isopropanol: methanol (9:1:4:6), flow rate is set at 1.5mL / min, detection wavelength is 450nm, column temperature is 40℃; the results are as follows Figure 1 As shown in the liquid phase spectrum of the fermentation extract of the production strain FSQ01, there are by-products with similar structures such as lycopene ( Figure 1 A), the new production strain FSQ03 obtained after the corresponding gene construction optimization can effectively inhibit the accumulation of by-products and only synthesize astaxanthin ( Figure 1 B).

[0067] Example 5 Shake flask fermentation verifies the effect of different copper ion addition time and concentration on astaxanthin production

[0068] The astaxanthin-producing Yarrowia lipolytica engineered strain FSQ03 was inoculated in YPD (4% peptone, 2% yeast extract, 0.5% glucose) medium and cultured at 30°C shaker at 220rpm for 16h to obtain primary seeds; the primary seeds were transferred to a shake flask containing YPD medium with different concentrations of copper ions (copper ion concentrations ranging from 0 to 300 μmol / L) at a transfer rate of 1%, with the inoculation time being recorded as 0h, the time for adding copper ions was 0-48h, and the culture was carried out at 30°C shaker at 220rpm. The content of intracellular astaxanthin was determined after 5 days. The results are shown in Table 1.

[0069] Table 1 Astaxanthin content and yield (mg / L) under different copper ion concentrations and addition time conditions in shake flasks

[0070]

[0071] The results showed that when the astaxanthin-producing Yarrowia lipolytica engineered strain FSQ03 was fermented, adding copper ions at a final concentration of 30-150 μmol / L in the fermentation medium could promote the production of astaxanthin, and the addition time was preferably within the fermentation culture cycle of 24 hours, that is, it was preferably to add copper ions 24 hours after inoculation. Under this condition, the fermentation yield of Yarrowia lipolytica engineered strain FSQ03 was about 413 mg / L.

[0072] Example 6 Fermentation tank culture

[0073] Seed culture medium: yeast powder 10g / L, peptone 20g / L, glucose 20g / L, sterilized at 121℃ for 20min, sterilized with glucose; fermenter culture medium: corn steep liquor powder 30g / L, soy peptone 20g / L, glucose 20g / L, soybean oil 2g / L, pyruvic acid 4g / L, copper sulfate 250μmol / L, sterilized at 121℃ for 30min, sterilized with glucose.

[0074] A single colony of the Yarrowia lipolytica engineered strain FSQ03 producing astaxanthin was selected and inoculated into a shake flask seed culture medium for cultivation at a temperature of 30°C, a rotation speed of 220rpm, and a time of 18h to obtain a seed solution; then the seed solution was inoculated into a 5L fermenter containing 2.5 liters of culture solution at a 2% inoculation rate, the culture temperature was 30°C, the pH was regulated to 6.8 by ammonia water 48h before fermentation, and the pH was controlled to 6.5 by 1M sodium hydroxide at 48-96h of fermentation. During the process, the speed and ventilation were used to control the dissolved oxygen to above 15%, and the sugar supplement rate was controlled to 3.6g / L / h, and the fermentation culture was carried out for 6d. After the fermentation was completed, the astaxanthin fermentation yield reached 4.1g / L by liquid chromatography.

[0075] The embodiments described above are only descriptions of the preferred modes of the present invention, and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope determined by the claims of the present invention.

Claims

1. A method for constructing an engineered bacterium for producing astaxanthin, characterized in that: The following steps are involved: The initial strain of the engineering bacteria is Yarrowia lipolytica, and the expression cassettes of the phytoene dehydrogenase gene carB, the phytoene synthase / lycopene cyclase gene carRP, the β-carotene ketolase gene crBKT and the β-carotene hydroxylase gene crtZ are introduced into the initial strain in the form of a plasmid, and a plasmid overexpressing the HMG-CoA reductase encoding gene HMG1 and the GGPP synthase encoding gene GGS1 is also introduced to obtain the engineering bacteria; The nucleotide sequence of the phytoene dehydrogenase gene carB is shown in SEQ ID NO.1; the nucleotide sequence of the phytoene synthase / lycopene cyclase gene carRP is shown in SEQ ID NO.2; the nucleotide sequence of the β-carotene ketolase gene crBKT is shown in SEQ ID NO.3; the nucleotide sequence of the β-carotene hydroxylase gene crtZ is shown in SEQ ID NO.4; The GenBank number of the HMG-CoA reductase encoding gene HMG1 is NP_732900.1; the GenBank number of the GGPP synthase encoding gene GGS1 is XP_045941587.1; The Yarrowia lipolytica is Yarrowia lipolytica MYA2613; The promoter of the expression cassette of the β-carotene ketolase gene crBKT is the copper ion inducible promoter MT-2, and the terminator is the CYC1 terminator; the nucleotide sequence of the copper ion inducible promoter MT-2 is shown in SEQ ID NO.5; The promoter of the expression cassettes of the phytoene dehydrogenase gene carB gene, the phytoene synthase / lycopene cyclase gene carRP and the β-carotene hydroxylase gene crtZ is the hp4d promoter, and the terminator is the CYC1 terminator.

2. An engineered bacterium for producing astaxanthin constructed according to the construction method of claim 1.

3. The use of the engineered bacteria according to claim 2 in the production of astaxanthin, characterized in that: The method comprises the steps of adding copper ions with a final concentration of 30-150 μmol / L to a culture medium for culturing the engineered bacteria.

4. A method for producing astaxanthin, characterized in that: The method comprises the steps of using the engineered bacteria according to claim 2 to ferment and produce astaxanthin; The culture medium used in the fermentation includes components in the following concentrations: 30 g / L corn steep liquor dry powder, 20 g / L soy peptone, 20 g / L glucose, 2 g / L soybean oil, 4 g / L pyruvic acid and 250 μmol / L copper sulfate.

Images