A molecular marker for detecting resistance to apple ring rot and its application

Abstract

The present invention belongs to the technical field of molecular biotechnology and molecular markers, and in particular, relates to a molecular marker for detecting apple ring rot resistance and its application. The molecular marker is located in the promoter region of the apple ring rot resistance-related gene MsARR1, and the nucleotide sequence of the gene MsARR1 is shown in SEQ ID NO.1. The apple germplasm with GNG base insertion at the position of ‑341bp to ‑343bp upstream of the sequence is susceptible to apple ring rot, while the apple germplasm without GNG base insertion is disease-resistant, wherein N is any one of A, G, C, and T. The present invention develops a molecular marker for detecting whether apples have ring rot resistance, which can be applied in apple ring rot molecular marker-assisted breeding, and accelerates the breeding process through early rapid screening of apple ring rot resistance germplasm resources, which helps to solve the problem of long apple disease resistance breeding cycle.

Description

Technical field:

[0001] The invention belongs to the technical field of molecular biotechnology and molecular markers, and in particular relates to a molecular marker for detecting resistance to apple ring rot and an application thereof. Background technology:

[0002] Apple is one of the main fruits in northern my country and occupies a very important position in the fruit industry. However, the frequent occurrence of diseases and insect pests has become an obstacle to the development of the apple industry. In particular, the large-scale occurrence of major diseases such as ring rot, anthracnose leaf blight, and rot has caused huge economic losses to the apple industry. Ring rot is one of the main apple diseases worldwide, and it occurs to varying degrees in East Asia, North America, Australia, South Africa and other regions. Although it has been a century since Japanese scientists first reported ring rot in 1907, there is still no effective prevention and control measure for apple ring rot. Disease-resistant breeding is the fundamental method to control ring rot.

[0003] One of the main tasks of disease-resistant breeding is to select disease-resistant parents. The current method of identifying ring rot resistance is mainly through fruit or branch / trunk inoculation. However, due to the limitation of childhood, the disease resistance identification of wild apple seeds and hybrid seedlings collected in the wild needs to wait until they bloom and bear fruit. This process takes at least 3-5 years. Even the evaluation of branch and trunk ring rot resistance needs to be carried out after the tree grows into an adult, which is not conducive to the early selection of disease-resistant germplasm. Therefore, the selection of early disease-resistant germplasm through molecular markers is conducive to accelerating the breeding process.

[0004] Through the above analysis, the problems and defects of the existing technology are: apple cannot be selected for disease-resistant germplasm at an early stage due to its complex genetic background and long juvenile period. Summary of the invention:

[0005] The object of the present invention is to provide a molecular marker for detecting resistance to apple ring rot, wherein the molecular marker is located in the promoter region of an apple ring rot resistance-related gene MsARR1, at a position of -341bp to -343bp upstream of the gene coding region, the nucleotide sequence of the gene MsARR1 is as shown in SEQ ID NO.1, and apple germplasm with a GNG base inserted at a position of -341bp to -343bp upstream of the sequence is susceptible to apple ring rot, while apple germplasm without a GNG base inserted is resistant, wherein N is any one of A, G, C, and T.

[0006] The nucleotide sequence of the MsARR1 gene of the present invention (SEQ ID NO.1) is as follows:

[0007]

[0008] The present invention also provides a primer pair for detecting the molecular marker associated with apple ring rot resistance, comprising a forward primer arr1-F1 and a reverse primer arr1-R1, wherein the nucleotide sequence of the forward primer arr1-F1 is shown in SEQ ID NO.2; the nucleotide sequence of the reverse primer arr1-R1 is shown in SEQ ID NO.3, that is,

[0009] arr1-F1: 5'-CAGTTCTCTCTCCGTACCAT-3' (SEQ ID NO.2),

[0010] arr1-R1: 5'-TTGGAACGTTCAGACACGAG-3' (SEQ ID NO. 3).

[0011] The invention also provides a kit containing the primer pair for detecting apple germplasm resistant to or susceptible to ring rot.

[0012] The present invention also provides the use of the primer pair for detecting molecular markers related to apple ring rot resistance in detecting germplasms resistant to and susceptible to apple ring rot, comprising the following steps:

[0013] 1) Extracting genomic DNA from the apple germplasm to be tested;

[0014] 2) using the genomic DNA of the apple germplasm to be tested as a template, and using the forward primer arr1-F1 and the reverse primer arr1-R1, a PCR amplification reaction is performed;

[0015] 3) Sequencing the PCR amplification product. If the base at -341 to -343 bp in the amplification product sequence is GNG, the apple plant to be tested is a variety susceptible to apple ring rot; if there is no GNG three-base insertion at -341 to -343 bp in the amplification product sequence, the apple plant to be tested is a germplasm resistant to apple ring rot; the N is any one of the bases A, G, C, and T.

[0016] The amplification reaction system is:

[0017]

[0018] The amplification reaction procedure is as follows:

[0019]

[0020] The present invention also provides application of the primer pair for detecting molecular markers related to apple ring rot resistance in apple molecular marker-assisted breeding.

[0021] The present invention also provides an MsARR1 gene for regulating resistance to apple ring rot, wherein the gene MsARR1 is derived from wild apple (Malus sieversii), and its nucleotide sequence is shown in SEQ ID NO: 1; the amino acid sequence of the protein encoded by the gene is shown in SEQ ID NO: 4; overexpressing the MsARR1 gene in a germplasm susceptible to apple ring rot can improve the resistance of the susceptible germplasm to apple ring rot; silencing the MsARR1 gene in a germplasm resistant to apple ring rot can reduce the resistance of the resistant germplasm to apple ring rot.

[0022] The amino acid sequence of the protein encoded by the MsARR1 gene is as follows:

[0023] MAEQIVCFVIEKLIKLLITTEANLSRDVCKEVGFIKDELESIRLFLKDADAKAAEDGETTNDSVKTWVNQVREAAFYIEDVIDEYLLRVTRHLQDRGFIPLFHKIIRLVKKMRSQDGIVSKVDRMKELVRGIQERRQRYELSSIDRQGRDNGEKTLLWHDPRVASLFIEEAEVVGIESARKELTDLLVGGAPRREVISVVGMGGLGKTTLARKVYDSLTVMDHFKCYAWITVSQSYRVEDLLRTVVKMFYNSRKENFPEDIDTTDEESLIRKSREYLQQKRYVVVFDDVWKVKFWEAIEHALPDNKGGRIMITTRIQEVADFCKKSCFVHVHHLQPLPPKNAWKLFCRKAFQFELEGNCPLELEDMSREIVKKCEGLPLAIVCIGGLLSTKVKVVSEWQKLYNSLSSELESNPHLTGLTRILSLSYDHLPYYLKSCVLYFGIFPEDYSINCVRLIRLWIAEGFVKLKKGKTLEEVGEEYLTEVIHRSLVQVSEVYIDGKARSCRVHDILREVLLKKGVDSSFCHILSEFELTYKPTIRRLSIDNSPSDASGIITQSQIRSVFAFNQEEWPESYLNTLRGNFKLLKVLDFMDAPINQLPKYVGDLYLLTYLSLRNTKVELLPDSIGNLQNLETLDLKQSLVSEIPAKINKLVKLRHLLAYYRDYSLAFWSNMQRGVKIHEGIGCLQALQKLYFVEANHGGIKLIKELGQLRQLRKLGLTKLKREDGKALCACIEKINHLETLELTAISEDEVLDLESISTPPQFIRKLILYGRLEQLPSWISNLQHLVALVIFWSRLRDSPLKALQNLPNLLDLGLGQMGHEGMRLHFEEGGFQKLRKLRLREVEGLNSLIIDNGVMPILQEFHIGPSPQLKDVPSGICRLRNLRDLRFYDMTKEFARQMDPNNGPHYWIVKHIRHVDFIYNYVPGYGEYETHSLYDSDFSFWSNV-(SEQ ID NO:4)。

[0024] The invention also provides an expression vector carrying the MsARR1 gene.

[0025] The expression vector carrying the MsARR1 gene can be introduced into plant cells by using Agrobacterium-mediated genetic transformation, gene gun transformation, or PEG-mediated transformation.

[0026] The present invention further provides an application of the MsARR1 gene in regulating resistance to apple ring rot, and utilizes genetic engineering to increase the expression of the MsARR1 gene in susceptible plants, thereby increasing the resistance of susceptible plants to apple ring rot.

[0027] The apples include wild apple (Malus sieversii) and hybrids thereof with cultivated apple (Malus domestica).

[0028] In a preferred embodiment of the present invention, the MsARR1 gene is constructed into the pRI101 vector and transiently expressed in susceptible apple fruit by Agrobacterium (EHA105)-mediated method, thereby improving the disease resistance of apple fruit.

[0029] The present invention uses disease-resistant wild apple 'T04' and disease-susceptible wild apple 'V41.1' as test materials, and uses transcriptome sequencing to screen genes with expression differences of more than 2 times before and after inoculation with apple ring rot pathogen B.dothidea, and discovers a new gene, which is named MsARR1. In wild apple 'V41.1' susceptible to ring rot, the transcript expression after inoculation with ring rot pathogen has no significant change compared with the simulated inoculation, while the expression of the gene in disease-resistant wild apple 'T04' increased to 5.2 times (48 hours after inoculation with B.dothidea) Figure 1 ). The expression of this gene in the fruit was reduced by virus-induced gene silencing (VIGS), which confirmed that silencing this gene can reduce the resistance of apple fruit to ring rot ( Figure 2 A, Figure 3 A, Figure 4 A), while overexpression of the MdARR1 gene can improve the resistance of apple fruit to ring rot ( Figure 2 B, Figure 3 B, Figure 4 B). Sequence comparison revealed that there was no difference in the nucleotide sequence of the MsARR1 gene between the resistant and susceptible germplasms. Further comparison of the promoter regions of the MsARR1 gene between the resistant and susceptible germplasms revealed that there was a 3-base insertion in the promoter region of the susceptible germplasm compared with the resistant germplasm ( Figure 5 ). Analysis of promoter activity revealed that the insertion of these three bases resulted in decreased promoter activity of MsARR1 ( Figure 6 The inventors used these three base differences in the promoter region as molecular markers for breeding apple germplasm resistant to ring rot.

[0030] Compared with the prior art, the present invention has the following advantages:

[0031] The present invention provides a gene MsARR1 related to apple ring rot resistance, and develops a molecular marker for detecting whether apples have ring rot resistance, which can be applied to apple ring rot molecular marker-assisted breeding, accelerates the breeding process through early rapid screening of apple ring rot-resistant germplasm resources, and helps solve the problem of long apple disease-resistant breeding cycle. Description of the drawings:

[0032] Figure 1 Schematic diagram of the experimental results of the induction of expression of MsARR1 gene by the ring rot pathogen B. dothidea in wild apples resistant to ring rot 'T04' and susceptible to ring rot 'V41.1'.

[0033] Figure 2 The experimental results show that the MsARR1 gene was silenced by VIGS technology in wild apple resistant to ring rot to reduce disease resistance, and overexpressed in wild apple susceptible to ring rot to increase disease resistance. WT: wild type; OE: overexpression; VIGS: virus-induced gene silencing; EV1 and EV2 are empty vector controls, respectively.

[0034] Figure 3 Schematic diagram of the relative expression experimental results of MsARR1 gene in fruit after VIGS and overexpression treatment.

[0035] Figure 4 This is a schematic diagram of the experimental results of quantitatively analyzing the growth changes of ring rot fungi using fluorescent quantitative PCR technology after VIGS and overexpression treatments. The pathogen-specific gene BdACTIN represents fungal DNA, and the apple-specific gene MdEF1-α represents apple DNA on the vertical axis. The ratio of the two represents the changes in the biomass of the pathogen. A is the growth change of the pathogen after overexpression of the MsARR1 gene in V41.1 fruit, OE is the overexpression fruit, and EV1 is the empty vector control; B is the growth change of the pathogen after silencing the MsARR1 gene in T04 fruit, VIGS is the gene-silenced fruit, and EV2 is the empty vector control.

[0036] Figure 5 is the GNG molecular marker on the promoter of the MsARR1 gene; T04 is a wild apple with high resistance to ring rot; S5, V51.11, V41.1, and T08 are wild apples with high sensitivity to ring rot.

[0037] Figure 6 This is a graph showing the experimental results showing that the GNG tri-base insertion resulted in a decrease in promoter activity in response to the ring rot pathogen. Specific implementation method:

[0038] The technical solution of the present invention is further described in detail below through specific embodiments and in conjunction with the accompanying drawings.

[0039] Example 1: Discovery and verification of the ring rot resistance-related gene MsARR1

[0040] The disease-resistant wild apple germplasm T04 and the disease-susceptible wild apple germplasm V41.1 from Uzbekistan were used as test materials and inoculated with the apple ring rot pathogen Botryosphaeria dothidea (abbreviated as B.dothidea). Genes with a more than 2-fold expression difference before and after were screened through transcriptome, and compared with genes in the apple genome database (https: / / www.rosaceae.org / ). A new gene was obtained and named MsARR1, and the nucleotide sequence is shown in SEQ ID NO: 1. The expression of the MsARR1 gene in susceptible and resistant wild apples and its effect on ring rot resistance were analyzed as follows:

[0041] 1. Apple fruit pathogen inoculation and sample collection

[0042] Wild apple (Malus sieversii) 'V47.7' and 'T04' fruits were inoculated with the ring rot pathogen B. dothidea, and samples were taken at 0h, 12h, 24h, 48h and 72h to extract total RNA.

[0043] 2. Extraction of Total RNA from Wild Apple Fruit

[0044] The total RNA of wild apple fruit was extracted using the plant polysaccharide and polyphenol total RNA extraction kit produced by Tiangen Biotechnology Co., Ltd. The specific steps are as follows:

[0045] (1) Add 25 μL of β-mercaptoethanol and 475 μL of lysis buffer SL to an RNase-free EP tube; take 200 μL of

[0046] mg of peel was quickly ground into powder in liquid nitrogen, added to the above EP tube, immediately mixed by vigorous shaking, and centrifuged at 13,000 rpm for 5 min at 4°C;

[0047] (2) The supernatant obtained in step (1) was transferred to a filter column (CS) and centrifuged at 13,000 rpm for 5 min at 4°C;

[0048] (3) Gently pipette the supernatant in the collection tube of step (2) and transfer it to another new RNase-free EP tube. During the pipetting process, the pipette tip must not touch the sample sediment at the bottom of the tube;

[0049] (4) Slowly add 200 μL of anhydrous ethanol to the EP tube in step (3), immediately pipette and mix, transfer the mixture into the adsorption column (CR3), centrifuge at 13,000 rpm for 60 sec at 4°C, pour out the liquid in the collection tube, and put the adsorption column (CR3) back into the collection tube;

[0050] (5) Add 350 μL of deproteinized solution RW1 to the adsorption membrane in step (4), centrifuge at 13,000 rpm for 60 sec at 4°C, and discard the liquid in the collection tube;

[0051] (6) Add 80 μL of DNase I working solution to the center of the membrane of adsorption column CR3 and place it at room temperature for 15 min;

[0052] (7) Add 350 μL of deproteinized solution RW1 to the adsorption column CR3, centrifuge at 13,000 rpm for 60 sec at 4°C, and discard the waste liquid in the collection tube;

[0053] (8) Add 700 μL of rinse solution RW to the adsorption membrane, centrifuge at 13,000 rpm for 60 sec at 4°C, and discard the waste liquid in the collection tube;

[0054] (9) Add 700 μL of RW to the adsorption column CR3, centrifuge at 13,000 rpm for 60 sec at 4 °C, and discard the waste liquid in the collection tube;

[0055] (10) Place the empty adsorption column from step (9) back into the collection tube, centrifuge at 13,000 rpm for 2 min at 4°C, and remove the remaining rinse solution;

[0056] (11) Place CR3 in a new 1.5 ml RNase-free centrifuge tube, open the cover of the adsorption column CR3 and let it stand at room temperature for 2 min to dry the remaining rinse solution;

[0057] (12) Add 35 μL of RNase-Free ddH2O to the adsorption membrane of CR3, let it stand at room temperature for 2 min, and then centrifuge it at 13,000 rpm for 2 min at 4°C to collect the RNA solution; (13) Add the collected RNA solution to the adsorption membrane of CR3 again, let it stand at room temperature for 2 min, and then centrifuge it at 13,000 rpm for 2 min at 4°C to collect a higher concentration of RNA solution;

[0058] 3. Apple cDNA Synthesis

[0059] cDNA synthesis was performed using Takara's PrimeScript TM1st Strand cDNA Synthesis Kit, the specific steps are as follows:

[0060] (1) Removal of genomic DNA: 1 μL gRNA Eraser, 2 μL 5× gRNA Eraser Buffer, 2.5 μg RNA, add ddH2O to 10 μL, centrifuge briefly, and react at 42°C for 2 min;

[0061] (2) Reverse transcription reaction solution: Add 1 μL of PrimeScript RT Enzyme MixⅠ, 4 μL of RNase Free ddH2O, 4 μL of 5× PrimeScript Buffer 2 (for Real Time), and 1 μL of RT Primer Mix to the reaction solution in step (1). Centrifuge briefly, incubate at 37°C for 15 min, and incubate at 85°C for 5 s to terminate the reaction. Obtain cDNA for qRT-PCR reaction.

[0062] 4. Real-time fluorescence quantitative qRT-PCR analysis of MsARR1 gene expression

[0063] The AceQ qPCR SYBR Green Master Mix kit from Novozymes Biotech was used, with apple MdEF1-α as the internal reference gene. The qRT-PCR reaction system was prepared on ice in the dark, and the reaction system is shown in Table 1.

[0064] Table 1 Reaction system

[0065] 2×AceQ qPCR SYBR Green Master Mix 10.0μL Specific primer arr1-F2: 5'-AATGCTACGCTTGGATTACG-3' (SEQ ID NO.5) 0.4μL Specific primer arr1-R2: 5'-CTGGGAAGTTCTCCTTTCTT-3' (SEQ ID NO.6) 0.4μL 50×ROX Reference Dye 1 0.4μL cDNA 2.0μL ddH2O 6.8μL

[0066] The real-time fluorescence quantitative PCR instrument model is ABI 5700, and the reaction program is set as follows:

[0067]

[0068] Carry out PCR reaction according to the set program and perform data analysis after the reaction is completed.

[0069] The results of the expression of MsARR1 gene in wild apple 'T04' resistant to ring rot and wild apple 'V41.1' susceptible to ring rot were shown in Figure 2. Figure 1 As shown. Figure 1It can be seen that, with the expression level without pathogenic bacteria as the control (0 hours), the expression of MsARR1 gene in wild apple 'V41.1' susceptible to ring rot disease did not change significantly after inoculation with B. dothidea, while the expression of MsARR1 gene in wild apple 'T04' resistant to disease increased to 5.2 times (P<0.01) 48 hours after inoculation with B. dothidea. This indicates that MsARR1 gene can be induced by ring rot fungus and increase its expression in disease-resistant wild apple germplasm, while the expression of this gene cannot be induced by ring rot fungus in susceptible varieties.

[0070] 5. MsARR1 gene silencing and overexpression

[0071] The online software SGN VIGS Tool was used to select a 300bp sequence as the target fragment (SEQ ID NO.7), and specific primers with EcoRⅠ and BamHⅠ restriction sites were designed: VIGS-MsARR1-F300 (EcoRⅠ): 5'-gcatgaattcATGGCAGAACAAATTGTATG-3' (SEQ ID NO.8) and VIGS-MsARR1-R300 (BamHⅠ): 5'-gtcgcggatccCGGAATAAATCCACGATCTTG-3' (SEQ ID NO.9). The amplified fragment was ligated into the pTRV2 vector, and sequencing confirmed that the recombination result was correct. The recombinant pTRV2-MsARR1 and pTRV1 Agrobacterium bacterial suspensions were cultured overnight, the bacterial precipitates were collected by centrifugation and resuspended with the infection solution, and the pTRV2-MsARR1 and pTRV1 bacterial suspensions were mixed in a ratio of 1:1; the surface of the wild apple 'T04' resistant to ring rot disease with a smooth surface, uniform size and no damage was selected, and the surface was disinfected and wiped clean with 75% (v / v) alcohol, and the resuspended bacterial suspension was sucked with a 1 ml syringe and injected 0.5 cm below the fruit skin to silence the T04 apple MsARR1 gene ( The fruit injected with the mixed bacterial solution of pTRV2 and pTRV1 was used as the empty vector control (T04-EV2). The injected fruit was cultured in the dark at 25℃ for 7 days, and the humidity was maintained during the culture period. Then, B.dothidea was inoculated to observe the changes in disease resistance. At the same time, wild-type apple T04 without any treatment was inoculated with B.dothidea (T04-WT) as the wild-type control to observe the changes in disease resistance. The growth changes of the ring rot pathogen were quantitatively analyzed by fluorescent quantitative PCR technology. The results are shown in the figure. Figure 2 A. Figure 3 A. Figure 4 As shown in B.

[0072] At the same time, an overexpression vector of the MsARR1 gene was constructed, and the cDNA fragment of the coding region of the MsARR1 gene was inserted into the pRI101-Flag plasmid to construct the expression vector pRI101-35S-MsARR1-FLAG, and the constructed expression vector was transformed into the Agrobacterium EHA105 strain. The wild apple 'V41.1' fruit susceptible to ring rot was injected with EHA105 for overexpression (V41.1-OE). Two days after the injection, B. dothidea was inoculated to observe the changes in disease resistance; at the same time, V41.1 fruit injected with Agrobacterium EHA105 containing the empty vector pRI101-Flag (V41.1-EV1) and wild-type V41.1 fruit without any treatment (V41.1-WT) were inoculated with B. dothidea to observe the changes in disease resistance, and the growth changes of the ring rot pathogen were quantitatively analyzed by fluorescent quantitative PCR technology. The results are shown in the figure. Figure 2 B. Figure 3 B. Figure 4 As shown in A.

[0073] from Figure 2 As can be seen from A, the ring spots on T04 fruit caused by ARR1 gene silencing were significantly larger than those in the empty vector control group and the wild-type control group. Figure 4 As can be seen in B, the growth rate of pathogenic fungi in gene silenced T04 fruit (SI) is significantly higher than that in empty vector control T04 fruit (EV1). Figure 3 A shows that the expression of MsARR1 gene in T04 apples injected with gene silencing sequence vector is significantly lower than that in the empty vector control and wild type control. This indicates that the use of VIGS technology to silence the expression of MsARR1 gene in wild apples resistant to ring rot 'T04' leads to reduced resistance to ring rot.

[0074] from Figure 2 B shows that the ring rot area of ​​'V41.1' apples injected with the expression vector (V41.1-OE) is significantly smaller than that of the empty vector control group (V41.1-EV1) and the wild-type control (V41.1-WT). Figure 4 As can be seen in A, the growth rate of pathogenic fungi in gene-overexpressing V41.1 fruits (OE) is significantly lower than that in empty vector control V41.1 fruits (EV2). Figure 3 B shows that the expression of MsARR1 gene in 'V41.1' apples injected with the overexpression vector was significantly higher than that in the empty vector control V41.1-EV1 and the wild type control V41.1-WT, indicating that overexpression of the MsARR1 gene in the wild apple 'V41.1' susceptible to ring rot resulted in improved resistance to ring rot.

[0075] The SEQ ID NO.7 sequence is:

[0076] 5'-ATGGCAGAACAAATTGTATGCTTTGTGATCGAAAAGTTAATTAAACTACTCATCACCACAGAAGCAAACCTTTCAAGAGACGTATGCAAAGAAGTTGGTTTCATCAAAGATGAGCTAGAGAGCATCCGATTATTCCTCAAGGACGCAGAT GCTAAGGCGGCAGAAGATGGAGACGACAAATGACAGTGTCAAAACTTGGGTCAACCAAGTAAGAGAAGCAGCTTTTTACATTGAAGATGTCATTGATGAATATTTGCTTCGTGTCACAAGGCACCTTCAAGATCGTGGATTTATTCCG-3'.

[0077] Example 2: Amplification and sequencing of promoter fragments

[0078] Since the expression of MsARR1 gene in resistant / susceptible wild apple germplasm was significantly different, PCR amplification and sequencing of DNA from resistant / susceptible plants revealed that the coding sequence of MsARR1 gene in resistant plants (apple T04) and susceptible plants (apple S5, V41.1, V51.11 and T08) was the same, but there were 3 base differences in the promoter region. The specific steps were as follows:

[0079] 1. Extraction of Apple Genomic DNA

[0080] Apple genomic DNA extraction reference kit was used, and the specific steps are as follows:

[0081] (1) First, prepare a new RNase-free centrifuge tube, add 800 μL of buffer GP1 and 0.8 μL of β-mercaptoethanol, and preheat it in a metal bath at 65°C; take 200 mg of young wild apple leaves, keep them low in liquid nitrogen, and grind them into powder;

[0082] (2) Place the powder in step (1) into a preheated centrifuge tube, vortex quickly to mix, and incubate in a 65°C metal bath for 20 min, mixing manually several times during the incubation process;

[0083] (3) Add 800 μL of chloroform to the centrifuge tube, pipette thoroughly to mix, and centrifuge at 13,000 rpm for 10 min at room temperature;

[0084] (4) Steadily pipette the upper aqueous phase solution obtained in step (3) into another sterile centrifuge tube, add 800 μL of buffer GP2, and pipette thoroughly to mix;

[0085] (5) Transfer the mixed liquid obtained in step (4) to the adsorption column, centrifuge at room temperature, 13,000 rpm for 1 min, and discard the waste liquid in the collection tube;

[0086] (6) Add 500 μL of buffer GD to the adsorption column (CB3) in step (5), centrifuge at 13,000 rpm for 1 min at room temperature, discard the waste liquid, and place the adsorption column (CB3) in a collection tube;

[0087] (7) Add 700 μL of rinse solution PW to the adsorption column (CB3) in step (6), centrifuge at 13,000 rpm for 1 min, pour out the liquid in the centrifuge tube, put the adsorption column (CB3) back into the collection tube, and repeat this step once;

[0088] (8) Place the empty adsorption column (CB3) back into the collection tube, centrifuge at 13,000 rpm for 2 min at room temperature, and discard the waste liquid in the collection tube;

[0089] (9) Place the adsorption column (CB3) at room temperature, open the cover and leave it for 2-3 minutes to dry the remaining rinse solution in the adsorption membrane as much as possible to avoid affecting subsequent experiments;

[0090] (10) Discard the collection tube from step (9), place the adsorption column (CB3) in a new sterile 1.5 mL centrifuge tube, add 50 μL of buffer TE to the middle of the adsorption membrane (note that it should be added in an airtight manner), and then let it stand at room temperature for 2 min. Centrifuge at 13,000 rpm for 2 min, and centrifuge the resulting DNA solution into a centrifuge tube;

[0091] (11) The above DNA solution is added back into the adsorption column (CB3) and centrifuged again to obtain a DNA solution with a higher concentration.

[0092] 2. Amplification of the Promoter Segment

[0093] PCR amplification was performed using primers arr1-F1: 5'-CAGTTCTCTCTCCGTACCAT-3' (SEQ ID NO. 2) and arr1-R1: 5'-TTGGAACGTTCAGACACGAG-3' (SEQ ID NO. 3) and wild apple genomic DNA as a template.

[0094] The amplification system is:

[0095]

[0096] The reaction procedure is as follows:

[0097]

[0098] The PCR product was detected as a single band by 1% agarose gel electrophoresis and sequenced.

[0099] In this example, the promoter region of the MsARR1 gene of disease-resistant plants (apple T04) and susceptible plants (apple S5, V41.1, V51.11 and T08) was amplified and sequenced. The results are as follows: Figure 5 As shown. Figure 5 It can be seen that there are three base differences in the promoter region. There is no GNG insertion at -341 to -343 bp in the amplified product sequence of apple T04, while there are GGG, GAG, GCG and GTG insertions at -341 to -343 bp in the amplified product sequence of susceptible plants (apple S5, V41.1, V51.11 and T08), respectively.

[0100] 3. Promoter Activity Analysis

[0101] In order to further analyze the effect of the above promoter base differences on the response of MsARR1 gene to ring rot infection, a dual luciferase activity experiment was conducted. The specific steps are as follows:

[0102] 1. Design primers arr1-F3: 5'-GGGAGACTTATCCCGAGAAC-3' (SEQ ID NO.10) and arr1-R3: 5'-AGTATGAGCATCCAACAACC-3' (SEQ ID NO.11);

[0103] 2. Use the genomic DNA of disease-resistant wild apple T04 and disease-susceptible wild apple V41.1 as templates for PCR reaction to obtain the full-length promoter. The PCR reaction system is as follows:

[0104]

[0105] The reaction procedure is as follows:

[0106]

[0107]

[0108] The PCR product was purified and recovered and connected to the upstream of the GFP gene in the pRI101-GFP vector to replace the original CaM35S promoter. The constructed vector was transferred into Agrobacterium GV3101. Agrobacterium was cultured to an OD600 of about 0.5-0.6, and the cells were collected by centrifugation at 5000rpm. The suspension was suspended with a buffer solution (10mM MES, 50μmol / L AS, 10mM MgCl 2) suspended bacteria. Four-week-old Nicotiana benthamiana leaves were selected and the bacterial solution was injected from the back of the leaves with a 1mL disposable syringe. To keep the experimental results stable, the control group and the experimental group were injected into different parts of the same leaf, with roughly the same penetration area. After 2 days of culture, the spore solution of the ring spot pathogen was injected into the injection site of the leaf. 24 hours after injection, fluorescence detection was performed using a live fluorescence imaging system. The experimental results are shown in Figure 6 shown.

[0109] from Figure 6 It can be seen that the promoter isolated from the disease-resistant wild apple T04 does not contain the GNG (N is any base among A, G, C, T) insertion sequence, and can effectively drive the expression of the GFP gene, while the promoter isolated from the disease-susceptible wild apple V41.1 contains the GAG ​​insertion sequence and cannot drive the expression of the GFP gene in response to the ring rot fungus. This indicates that the insertion of the three bases GNG in the promoter region of MsARR1 leads to a decrease in the promoter's response activity to the ring rot fungus ( Figure 6 ). Therefore, the presence or absence of this three-base insertion was determined as a molecular marker for screening germplasm resistant to ring rot.

Claims

1. A primer pair for detecting molecular markers associated with apple ring rot resistance, characterized in that: The molecular marker is located in the promoter region of the apple ring rot resistance-related gene MsARR1, at the position -341bp to -343bp upstream of the gene coding region. The nucleotide sequence of the gene MsARR1 is shown in SEQ ID NO.

1. Apple germplasm with GNG base insertion at the position -341bp to -343bp upstream of the sequence is susceptible to apple ring rot, while apple germplasm without GNG base insertion is resistant, wherein N is any one of A, G, C, and T. The primer pair includes a forward primer arr1-F1 and a reverse primer arr1-R1. The nucleotide sequence of the forward primer arr1-F1 is shown in SEQ ID NO.2; the nucleotide sequence of the reverse primer arr1-R1 is shown in SEQ ID NO.

3.

2. A kit for detecting apple varieties resistant to apple ring rot containing the primer pair according to claim 1.

3. Use of the primer pair for detecting molecular markers associated with apple ring rot resistance as claimed in claim 1 in detecting apple ring rot resistance and susceptible germplasm, characterized in that: The following steps are involved: 1) Extracting genomic DNA from the apple plant to be tested; 2) using the genomic DNA of the apple plant to be tested as a template, and using the forward primer arr1-F1 and the reverse primer arr1-R1, a PCR amplification reaction is performed; 3) Sequencing the PCR amplification product. If the base at -341 to -343 bp in the amplification product sequence is GNG, the apple plant to be tested is a variety susceptible to apple ring rot; if there is no GNG three-base insertion at -341 to -343 bp in the amplification product sequence, the apple plant to be tested is a germplasm resistant to apple ring rot; the N is any one of the bases A, G, C, and T.

4. Use of the primer pair for detecting molecular markers associated with apple ring rot resistance according to claim 3 in detecting apple ring rot resistance and susceptible germplasm, characterized in that: The amplification reaction system is:

5. Use of the primer pair for detecting molecular markers associated with apple ring rot resistance according to claim 3 in detecting apple ring rot resistance and susceptible germplasm, characterized in that: The amplification reaction procedure is as follows:

6. Use of the primer pair for detecting molecular markers associated with apple ring rot resistance as claimed in claim 1 in apple molecular marker-assisted breeding.

7. A MsARR1 gene for regulating apple ring rot resistance, characterized in that: The gene MsARR1 is derived from wild apple (Malus sieversii), and its nucleotide sequence is shown in SEQ ID NO:1; the amino acid sequence of the protein encoded by the gene is shown in SEQ ID NO:4; overexpressing the MsARR1 gene in susceptible germplasm of apple ring rot can improve the resistance of the susceptible germplasm to apple ring rot; at the same time, silencing the MsARR1 gene in the disease-resistant germplasm of apple ring rot can reduce the resistance of the disease-resistant germplasm to apple ring rot.

8. An expression vector carrying the MsARR1 gene according to claim 7.

9. Use of the MsARR1 gene according to claim 7 in regulating resistance to apple ring rot, characterized in that: By using genetic engineering methods, the expression of MsARR1 gene in susceptible plants is increased, thereby improving the resistance of susceptible plants to apple ring rot.

Images