InDel molecular markers related to crude protein content and yield in alfalfa and their applications
By developing the InDel molecular marker Ms_Chr2_78776943 on chromosome 2 of alfalfa, and combining it with PCR amplification and electrophoresis detection, the problem of low breeding efficiency of alfalfa in existing technologies has been solved, and rapid and accurate screening of high crude protein and high-yield materials has been achieved.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-06-27
- Publication Date
- 2026-04-21
AI Technical Summary
Existing technologies lack effective molecular markers in alfalfa breeding, resulting in insufficient predictability, long cycles, low efficiency, and high costs, making it difficult to quickly screen varieties with high crude protein content and high yield.
An InDel molecular marker, Ms_Chr2_78776943, located on chromosome 2 of alfalfa, was developed. PCR amplification of Ms_Chr2_78776943-F and Ms_Chr2_78776943-R was performed using specific primers, followed by agarose gel electrophoresis detection, enabling rapid identification of crude protein content and yield in alfalfa.
It enables accurate identification of crude protein content and yield in alfalfa, simplifies the breeding process, improves breeding efficiency, reduces costs, and allows for rapid screening of materials with high crude protein and high yield.
Smart Images

Figure CN118581270B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biotechnology, specifically relating to the InDel molecular marker and its application related to crude protein content and yield in alfalfa. Technical Background
[0002] Alfalfa (Medicago sativa L.) is renowned for its high quality, high yield, high feed value, and excellent palatability, earning it the title of "King of Forage" and making it a preferred feed for dairy cows and other livestock. As an indispensable plant protein resource for animal husbandry, expanding its cultivation scale is of great practical significance for increasing my country's protein feed production. In domestic and international research on alfalfa breeding, traditional breeding methods are widely used, but these methods suffer from drawbacks such as insufficient predictability, long cycles, low efficiency, and high costs. In contrast, molecular breeding technology, through molecular marker-assisted selection (MAS), achieves precise breeding at the molecular level, thereby improving breeding efficiency and shortening the breeding cycle.
[0003] Insertion / deletion (InDel) polymorphism markers are a class of small-segment insertion or deletion variations in the genome sequence. They are known for their wide distribution, high density, stability and repetitiveness, and have been widely used in genetic diversity analysis, germplasm identification, genetic map construction, kinship identification and quantitative trait loci (QTL) mapping of important traits.
[0004] Genome-wide association studies (GWAS) are an effective method for linking phenotypes with genotypes, used for genetic mapping and candidate gene screening, and capable of simultaneously performing association analyses on multiple complex traits. With the development of high-throughput sequencing technology, GWAS has been applied in the study of quality and yield traits in various plants. However, given the relatively late start of alfalfa breeding, there are currently few studies on using GWAS to develop and locate genetic markers associated with crude protein content and yield. Therefore, developing molecular markers related to crude protein content and yield in alfalfa is of great significance for crop variety improvement and new variety breeding. Summary of the Invention
[0005] One of the objectives of this invention is to provide an InDel molecular marker related to the crude protein content and yield of alfalfa.
[0006] The second objective of this invention is to provide the application of the InDel molecular markers mentioned above that are related to the crude protein content and yield of alfalfa.
[0007] To achieve the above objectives, the present invention adopts the following technical solution:
[0008] The molecular marker disclosed in this invention, which is related to crude protein content and yield of alfalfa, is located on chromosome 2 of alfalfa and is named Ms_Chr2_78776943.
[0009] Primer pairs were used to amplify molecular markers associated with crude protein content and yield in alfalfa. The primer pair sequence corresponding to the molecular marker Ms_Chr2_78776943 is as follows:
[0010] Ms_Chr2_78776943-F: CGCGCTATAGCCACTATTTGAC (as shown in SEQ ID NO.1);
[0011] Ms_Chr2_78776943-R: GAAATTCACGGTCTTCTGTGG (as shown in SEQ ID NO.2).
[0012] This invention also discloses the application of the aforementioned molecular marker primer pairs in marker-assisted breeding for crude protein content and yield in alfalfa. In other words, the molecular markers of this invention can be used in future marker-assisted breeding. By extracting DNA from leaves during the seedling stage and detecting the presence of the molecular markers of this invention, the crude protein content and yield of alfalfa materials can be identified. The detection can be performed using PCR, specifically using the aforementioned molecular marker primer pairs, or it can be performed using sequencing methods.
[0013] This invention also discloses the application of the above-mentioned molecular markers in identifying the crude protein content and yield of alfalfa, especially in screening and identifying the crude protein content and yield of alfalfa. Specifically, the specific steps for identifying whether alfalfa has high crude protein content and high yield are as follows:
[0014] (1) Using the DNA of the tested germplasm as a template for PCR amplification, PCR amplification was performed using the primer pair corresponding to the molecular marker Ms_Chr2_78776943. The PCR amplification reaction system is shown in Table 1:
[0015] Table 1. Reaction system for PCR amplification
[0016]
[0017] Pre-denaturation at 94℃ for 4 min; denaturation at 94℃ for 30 s, annealing at 54℃ for 30 s, extension at 72℃ for 6 s, 40 cycles; extension at 72℃ for 10 min; store at 4℃.
[0018] (2) Detection of PCR products by agarose gel electrophoresis: Take 3.5 μL and judge the crude protein content and yield of alfalfa based on the band results.
[0019] PCR amplification was performed using primers Ms_Chr2_78776943-F and Ms_Chr2_78776943-R. If the PCR amplification product contained only one characteristic band of 100 bp as shown in SEQ ID NO.4, then alfalfa was of low crude protein content or low yield. If the PCR amplification product contained both one characteristic band of 100 bp as shown in SEQ ID NO.4 and one characteristic band of 85 bp as shown in SEQ ID NO.5, then alfalfa was of high crude protein content or high yield.
[0020] In addition, this invention also protects a kit for identifying crude protein content and yield characteristics in alfalfa, the kit containing primer pairs Ms_Chr2_78776943-F and Ms_Chr2_78776943-R. Other components of the kit are conventional reagents. Specifically, it also includes 10×PCR Buffer, dNTPs, and Taq DNA polymerase. This invention does not impose any special restrictions on the concentration of the primer pairs; primer concentrations well-known in the art can be used. This invention also does not impose any special restrictions on the source of the 10×PCR Buffer, dNTPs, and Taq DNA polymerase; common PCR amplification reagents well-known in the art can be used.
[0021] The kit of this invention can rapidly identify the crude protein content and yield of alfalfa materials, and can also rapidly identify the crude protein content and yield genotypes of alfalfa materials. The specific method follows the steps for identifying whether alfalfa has high crude protein content and high yield. By performing electrophoresis and / or sequencing on the PCR amplification products, if the PCR amplification product has only one characteristic band of 100 bp as shown in SEQ ID NO.4, then the alfalfa is homozygous for low crude protein content or low yield; if the PCR amplification product has both one characteristic band of 100 bp as shown in SEQ ID NO.4 and one characteristic band of 85 bp as shown in SEQ ID NO.5, then the alfalfa is heterozygous for high crude protein content or high yield.
[0022] The present invention has the following advantages:
[0023] (1) The inventors of this invention screened out a molecular marker Ms_Chr2_78776943 that is related to the crude protein content and yield of alfalfa. This molecular marker is located on chromosome 2. Using the molecular marker Ms_Chr2_78776943 of this invention, the crude protein content and yield of alfalfa can be quickly and accurately identified.
[0024] (2) Using markers related to crude protein content and yield for screening is beneficial for molecular marker-assisted selection breeding. The method is simple and feasible, which can improve efficiency and save costs.
[0025] (3) The molecular markers of the present invention have the characteristics of convenient detection, stable amplification products and high specificity. They can be easily, quickly and with high throughput applied to alfalfa breeding practices and material identification for high crude protein content and high yield. Attached Figure Description
[0026] Figure 1 This is a box plot showing the crude protein content distribution corresponding to the genotype at the Ms_Chr2_78776943 locus in the alfalfa population of Example 1 of this invention. 0 / 0 indicates that the genotype at the Ms_Chr2_78776943 locus is homozygous with low crude protein content, while 0 / 1 indicates that the Ms_Chr2_78776943 locus is heterozygous with high crude protein content. Dots represent extreme values, and ** indicates P < 0.01.
[0027] Figure 2 This is a box plot showing the fresh weight distribution of the genotype at the Ms_Chr2_78776943 locus in the alfalfa population of Example 1 of this invention. 0 / 0 indicates a homozygous, low-yielding genotype at the Ms_Chr2_78776943 locus, while 0 / 1 indicates a heterozygous, high-yielding genotype. Dots represent extreme values, and ** indicates P < 0.01.
[0028] Figure 3 This is a partial sequence alignment result between high-crude-protein and low-crude-protein materials in the region associated with crude protein content.
[0029] Figure 4 This is a partial sequence alignment result between high-yield and low-yield materials in the yield-related region.
[0030] Figure 5 Electrophoresis images of molecular markers amplified from 10 alfalfa germplasm resources, using agarose gels with a concentration of 3.5%. M in the image represents a DNA marker.
[0031] Figure 6 Electrophoresis images of molecular markers amplified from 10 alfalfa germplasm resources, using agarose gels with a concentration of 3.5%. M in the image represents a DNA marker. Detailed Implementation
[0032] The present invention will be further described below with reference to specific embodiments, and the advantages and features of the present invention will become clearer with the description. However, unless otherwise specified, the specific experimental methods involved in the following embodiments are conventional methods or implemented according to the conditions recommended in the manufacturer's instructions.
[0033] Unless otherwise specified, the techniques used in the embodiments are conventional methods well known to those skilled in the art. Unless otherwise specified, the experimental methods in the following embodiments are conventional methods. Unless otherwise specified, the reagents and materials used can be purchased commercially.
[0034] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as are familiar to those skilled in the art. Furthermore, any methods and materials similar to or equivalent to those described herein may be used in this invention. The preferred embodiments and materials described herein are for illustrative purposes only.
[0035] Example 1: Development of molecular markers related to crude protein content and yield in alfalfa
[0036] This invention determined the crude protein content of alfalfa at the initial flowering stage. After measuring the crude protein content of the alfalfa population, GWAS analysis located an InDel locus in the alfalfa, named Ms_Chr2_78776943. This locus is located at position 78776943 on chromosome 2 of the alfalfa reference genome, with the first allele being type 0 / 0 and the second allele being type 0 / 1. A box plot showing the distribution of crude protein content corresponding to the genotypes at the Ms_Chr2_78776943 locus in the population is provided. Figure 1 This indicates that the crude protein content of alfalfa material with genotype 0 / 1 is significantly higher than that of alfalfa with genotype 0 / 0. An insertion / deletion fragment CAATTTTGAAATGAC (shown in SEQ ID NO. 3) is located at locus 78776943 on chromosome 2 of alfalfa. Figure 3 The insertion of the fragment shown in SEQ ID NO.3 affects the crude protein content of alfalfa. Alfalfa with the fragment shown in SEQ ID NO.3 has a low crude protein content, while alfalfa without the fragment shown in SEQ ID NO.3 has a high crude protein content.
[0037] This invention uses the fresh weight of alfalfa at the initial flowering stage to measure alfalfa yield. A higher value indicates higher yield, and a lower value indicates lower yield. After measuring the fresh weight of the alfalfa population, GWAS analysis located an InDel locus. Analysis showed that this InDel locus overlapped with a locus associated with alfalfa crude protein content. Similarly, the first allele was 0 / 0, and the second allele was 0 / 1. A box plot showing the distribution of fresh weight corresponding to the genotypes at the Ms_Chr2_78776943 locus in the population is shown. Figure 2This indicates that the fresh weight of alfalfa material with genotype 0 / 1 was significantly higher than that of alfalfa with genotype 0 / 0. An insertion / deletion fragment CAATTTTGAAATGAC (shown in SEQ ID NO. 3) was found at locus 78776943 on chromosome 2 of alfalfa. Figure 4 The insertion of the fragment shown in SEQ ID NO.3 affects alfalfa yield. Alfalfa with the fragment shown in SEQ ID NO.3 inserted is low-yielding alfalfa; alfalfa without the fragment shown in SEQ ID NO.3 is high-yielding alfalfa.
[0038] Based on the InDe1 variant and its upstream and downstream sequences, the following primers were designed using Snapgene software:
[0039] Ms_Chr2_78776943-F: CGCGCTATAGCCACTATTTGAC (as shown in SEQ ID NO.1);
[0040] Ms_Chr2_78776943-R: GAAATTCACGGTCTTCTGTGG (as shown in SEQ ID NO.2).
[0041] Then, the primers were used to perform PCR amplification on the test samples. The results showed that the PCR product of homozygous alfalfa samples with low crude protein content or low yield had only a 100bp characteristic band, while the PCR product of heterozygous alfalfa samples with high crude protein content or high yield had both a 100bp characteristic band and an 85bp characteristic band.
[0042] Example 2: Accuracy verification of the molecular markers described in this invention
[0043] The germplasm used for determining crude protein content and fresh weight was identified, and the specific germplasm materials used are shown in Tables 2 and 3:
[0044] Table 2. Crude protein content of 178 germplasm materials and their corresponding genotypes at the Chr2_78776943 locus.
[0045]
[0046]
[0047]
[0048]
[0049] Table 3. Fresh weights of 3200 germplasm accessions and their corresponding genotypes at the Chr2_78776943 locus.
[0050]
[0051]
[0052]
[0053] 1) Using the genomic DNA of alfalfa to be identified as a template, PCR amplification was performed using the primer pair to obtain the PCR product;
[0054] The PCR amplification reaction system is as follows: template DNA 10–100 ng, 10 μM forward primer 0.5 μL, 10 μM reverse primer 0.5 μL, 2×Taq PCR Master Mix 5 μL, and deionized water to a final volume of 10 μL. The preferred PCR amplification reaction program is: 94℃ pre-denaturation for 4 min; 94℃ denaturation for 30 s, 54℃ annealing for 30 s, 72℃ extension for 6 s, 40 cycles; 72℃ extension for 10 min; and storage at 4℃. Separation is performed by electrophoresis on a 3.5% agarose gel. After loading, the samples are electrophoresed at 110V DC for 2 h, and the PCR banding patterns of each sample are then read.
[0055] 2) Determine the crude protein content and yield of alfalfa based on the size of the PCR product: When the PCR product of the alfalfa to be identified is missing the fragment shown in SEQ ID NO.3, then the alfalfa to be identified is alfalfa with high crude protein content or high yield.
[0056] When the fragment shown in SEQ ID NO.3 is inserted into the PCR product of the alfalfa to be identified, the alfalfa to be identified is alfalfa with low crude protein content or low yield.
[0057] Specifically, when the fragment shown in SEQ ID NO.3 is inserted into the PCR product of the alfalfa to be identified, the band length of the PCR product is 100bp (SEQ ID NO.4), then the alfalfa to be identified is alfalfa with low crude protein content or low yield.
[0058] The sequence of SEQ ID NO.4 is as follows:
[0059] CGCGCTATAGCCACTATTTGACAACACCAAGATAAATTCAAATTTTCATATAACA
[0060] ATTTTGAAATGACCAATTTCAAATCCACAGAAGACCGTGAATTTC.
[0061] When the PCR product of the alfalfa to be identified is missing the fragment shown in SEQ ID NO.3, and the band length of the PCR product is 85bp (SEQ ID NO.5), then the alfalfa to be identified is alfalfa with high crude protein content or high yield.
[0062] The sequence of SEQ ID NO.5 is as follows:
[0063] CGCGCTATAGCCACTATTTGACAACACCAAGATAAATTCAAATTTTCATATAACA
[0064] ATTTCAAATCCACAGAAGACCGTGAATTTC.
[0065] When the PCR product of the alfalfa to be identified consists of two bands, namely a band with the inserted fragment shown in SEQ ID NO.3 and a band with the deleted fragment shown in SEQ ID NO.3, and one band of the PCR product is 100bp in length and the other is 85bp, then the alfalfa to be identified is a heterozygous alfalfa with high crude protein content or high yield.
[0066] Table 2 shows the crude protein content of 178 alfalfa accessions and their corresponding genotypes at the Chr2_78776943 locus. Of these, 43 accessions had a genotype of 0 / 0, and 135 had a genotype of 0 / 1. The 43 accessions had an average crude protein content of 22.22% at the initial flowering stage, classifying them as low-crude-protein alfalfa. The 135 accessions with genotype 0 / 1 had an average crude protein content of 22.60%, classifying them as high-crude-protein alfalfa, which was 0.38% higher than the average of the 43 low-crude-protein accessions. Analysis of variance showed a significant difference in crude protein content between the high-crude-protein and low-crude-protein accessions (P < 0.01). Ten germplasm samples (CF005594, Leiting, CF031930, CF049890, Dongmu No. 1, Juneng 201, CF005567, P610821619, Sutter, CF040145) were selected, and the PCR results corresponded consistently with the genotypes and actual crude protein content measurements. Figure 5 Therefore, the InDel molecular marker of the present invention can effectively identify the crude protein content of alfalfa and can be used for the prediction and screening of alfalfa varieties with high crude protein content.
[0067] Furthermore, Table 3 shows the fresh weight of the 200 alfalfa accessions and their corresponding genotypes at the Chr2_78776943 locus. Of these, 60 accessions had a genotype of 0 / 0, and 140 had a genotype of 0 / 1. The average fresh weight of the 60 accessions was 0.75 kg, classifying them as low-yielding alfalfa. The average fresh weight of the 140 accessions with genotype 0 / 1 was 0.88 kg, classifying them as high-yielding alfalfa, which was 0.13 kg higher than the average of the 60 low-yielding accessions. Analysis of variance showed a significant difference in fresh weight between the high-yielding and low-yielding types (P<0.01). Ten germplasm samples (Longyin BeZa87, CF021077, Juneng 995, Baoding, Zhonglan 12, Muge, Suntory, Huaiyang 4, Bara310SC, and CF050248) were selected. The PCR test results corresponded consistently with the genotypes and actual fresh weight measurements. Figure 6 Therefore, the InDel molecular marker of the present invention can effectively identify the yield of alfalfa and can be used for the prediction and screening of high-yielding alfalfa varieties.
[0068] In summary, the InDel molecular marker of this invention can be used to screen alfalfa varieties that are not only high in crude protein but also high in yield, which is of great significance for molecular marker-assisted breeding of alfalfa.
[0069] The embodiments described above are merely preferred embodiments of the present invention and are only used to explain the present invention. They are not intended to limit the scope of the present invention. For those skilled in the art, other implementation methods can be easily made by substitution or modification based on the technical content disclosed in this specification. Therefore, all changes and improvements made on the principle of the present invention should be included within the scope of the patent application of the present invention.
Claims
1. The InDel molecular marker Ms_Chr2_78776943, associated with crude protein content and yield of alfalfa, is characterized by, The nucleotide sequence of the molecular marker Ms_Chr2_78776943 is shown in SEQ ID NO.4 and SEQ ID NO.
5. This molecular marker is an insertion / deletion of the fragment shown in SEQ ID NO.3 on chromosome 2 of the alfalfa reference genome. The primer pair sequence for amplifying the molecular marker Ms_Chr2_78776943 is as follows: Ms_Chr2_78776943-F: CGCGCTATAGCCACTATTTGAC; Ms_Chr2_78776943-R:GAAATTCACGGTCTTCTGTGG.
2. The application of the primer pair for amplifying the InDel molecular marker Ms_Chr2_78776943 described in claim 1 in identifying or assisting in the identification of crude protein content and yield traits in alfalfa.
3. A method for identifying the crude protein content and yield of alfalfa, characterized in that, The method includes the following steps: (1) Extract genomic DNA from alfalfa to be tested; (2) Using the genomic DNA extracted in step (1) as a template, perform PCR amplification using the primer pair of the molecular marker Ms_Chr2_78776943 described in claim 1, and perform electrophoresis detection and / or sequencing on the PCR amplification products; (3) The determination is based on the electrophoresis bands and / or sequencing results of step (2), and the specific criteria are as follows: PCR amplification was performed using primers Ms_Chr2_78776943-F and Ms_Chr2_78776943-R. If the PCR amplification product contained only one characteristic band of 100 bp as shown in SEQ ID NO.4, then alfalfa was of low crude protein content or low yield. If the PCR amplification product contained both one characteristic band of 100 bp as shown in SEQ ID NO.4 and one characteristic band of 85 bp as shown in SEQ ID NO.5, then alfalfa was of high crude protein content or high yield.
4. The application of a reagent kit in identifying crude protein content and yield genotype in alfalfa, characterized in that, The kit contains the primer pair of the molecular marker Ms_Chr2_78776943 as described in claim 1. The method for identifying the crude protein content and yield genotype of alfalfa using the kit is as follows: (1) Extract genomic DNA from alfalfa to be tested; (2) Using the genomic DNA extracted in step (1) as a template, perform PCR amplification using the primer pair of the molecular marker Ms_Chr2_78776943 described in claim 1, and perform electrophoresis detection and / or sequencing on the PCR amplification products; (3) Perform electrophoresis and / or sequencing on the PCR amplification products. If the PCR amplification product has only one characteristic band of 100 bp as shown in SEQ ID NO.4, then alfalfa is a homozygous low crude protein content or low-yield genotype. If the PCR amplification product has both one characteristic band of 100 bp as shown in SEQ ID NO.4 and one characteristic band of 85 bp as shown in SEQ ID NO.5, then alfalfa is a heterozygous high crude protein content or high-yield genotype.