Application of ionotropic receptor co-receptor genes in the behavior regulation of German cockroach

Abstract

The present invention belongs to the field of biotechnology, and discloses the application of ionotropic receptor co-receptor genes in the behavior regulation of German cockroaches, and specifically discloses the application of ionotropic receptor co-receptor gene IR25a inhibitor and / or ionotropic receptor co-receptor gene IR76b inhibitor in weakening the response of Blattaria insects to sex pheromones. The present invention discloses for the first time ionotropic receptor co-receptor genes IR25a and IR76b that can be used to regulate the reproduction-related behaviors of German cockroaches, and IR25a and / or IR76b are targeted and down-regulated, and IR25a and / or IR76b are degraded by ionotropic receptor co-receptor gene IR25a inhibitor and / or ionotropic receptor co-receptor gene IR76b inhibitor, so as to reduce the electrophysiological response of male insects to contact with sex pheromone standards, and cause the male insects' individual courtship behavior to female insects to be weakened or disappear, so as to achieve the purpose of interfering with and curbing the mating and reproduction of males and females.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and in particular relates to application of ionotropic receptor co-receptor genes in the behavior regulation of German cockroaches. Background Art

[0002] Blattella, commonly known as cockroaches, is one of the oldest and most successful insect groups in the world. More than 5,000 species of cockroaches have been recorded so far, and less than 1% of them are related to human life. As the most widely distributed important pest in the order Blattaria, cockroaches are distributed in tropical, subtropical, temperate and cold zones around the world. German cockroaches and American cockroaches are the two most common species. Among them, German cockroaches are more widely distributed and prefer humid, dark and warm indoor environments. They are easily exposed to various pathogenic microorganisms, causing food contamination. They are also the main allergens that cause asthma or other allergic diseases, which seriously threaten human health. At present, traditional chemical pesticides are still the main means of controlling cockroach populations. The abuse of traditional pesticides has caused cockroaches to develop resistance to pesticides and even have a negative impact on the ecological environment. Therefore, it is urgent to explore and develop eco-friendly cockroach control strategies.

[0003] As the most common chemical signal in the sexual communication system of insects, sex pheromones are a class of highly efficient behavioral regulators that dominate courtship and mating behaviors and ensure sexual reproduction. In German cockroaches, taste is one of the main means for males to identify female sexual signals at close range, and plays a vital role in initiating courtship behavior and completing subsequent mating. The function of taste receptor neurons is mainly determined by the taste receptors expressed in them, so it is feasible to screen for German cockroach courtship behavior regulators using taste receptors as targets. As an efficient and highly specific genetic manipulation method, RNA interference technology has attracted increasing attention in recent years for its potential in green pest control strategies. In particular, Blattaria insects are highly sensitive to RNA interference, making it possible to manipulate the expression of key genes related to courtship and reproductive behaviors through molecular and genetic technologies. The key to achieving the above breakthroughs and visions lies in discovering efficient and specific molecular targets for controlling the reproductive behavior of German cockroaches. However, key genes that regulate reproductive behaviors such as courtship and mating of German cockroaches have not yet been reported, which greatly hinders the development of cockroach control technology. Summary of the invention

[0004] The first aspect of the present invention aims to provide the use of an ionotropic receptor co-receptor gene IR25a inhibitor and / or an ionotropic receptor co-receptor gene IR76b inhibitor.

[0005] The second aspect of the present invention is to provide a dsRNA.

[0006] The third aspect of the present invention aims to provide biological materials related to the dsRNA of the second aspect of the present invention.

[0007] The fourth aspect of the present invention aims to provide a reagent.

[0008] The purpose of the fifth aspect of the present invention is to provide use of the dsRNA of the second aspect of the present invention, the biological material of the third aspect of the present invention and / or the reagent of the fourth aspect of the present invention.

[0009] The sixth aspect of the present invention aims to provide a method.

[0010] In order to achieve the above object, the technical solution adopted by the present invention is:

[0011] The first aspect of the present invention provides the use of an ionotropic receptor co-receptor gene IR25a inhibitor and / or an ionotropic receptor co-receptor gene IR76b inhibitor in any one of (1) to (8):

[0012] (1) Weakening the response of Blattodea insects to sex pheromones;

[0013] (2) preparing products that weaken the response of Blattodea insects to sex pheromones;

[0014] (3) disrupting / suppressing the mating of male and female Blattodea insects;

[0015] (4) preparing products for interfering with / suppressing the mating of male and female Blattaria insects;

[0016] (5) Prolonging the courtship latency period of Blattodea insects;

[0017] (6) preparing a product for prolonging the courtship latency period of Blattaria insects;

[0018] (7) Control of Blattodea insects;

[0019] (8) Preparing products for controlling Blattaria insects.

[0020] In some embodiments of the present invention, the ionotropic receptor co-receptor gene IR25a inhibitor is at least one of a substance that inhibits the activity of the ionotropic receptor co-receptor gene IR25a, a substance that degrades the ionotropic receptor co-receptor gene IR25a, or a substance that reduces the expression level of the ionotropic receptor co-receptor gene IR25a; further, it is a substance that reduces the expression level of the ionotropic receptor co-receptor IR25a.

[0021] In some embodiments of the present invention, the ionotropic receptor co-receptor gene IR76b inhibitor is at least one of a substance that inhibits the activity of the ionotropic receptor co-receptor gene IR76b, a substance that degrades the ionotropic receptor co-receptor gene IR76b, or a substance that reduces the expression level of the ionotropic receptor co-receptor gene IR76b; further, it is a substance that reduces the expression level of the ionotropic receptor co-receptor gene IR76b.

[0022] In some embodiments of the present invention, the substance that reduces the expression level of the ionotropic receptor co-receptor gene IR25a or the ionotropic receptor co-receptor gene IR76b is at least one of (9) to (11):

[0023] (9) siRNA, dsRNA, miRNA, ribozyme or shRNA targeting the ionotropic receptor coreceptor IR25a or ionotropic receptor coreceptor gene IR76b;

[0024] (10) a nucleic acid molecule encoding the siRNA, dsRNA, miRNA, ribozyme or shRNA targeting the ionotropic receptor co-receptor gene IR25a or the ionotropic receptor co-receptor IR76b described in (9);

[0025] (11) An expression cassette, vector or transgenic cell line comprising the nucleic acid molecule described in (10).

[0026] In some embodiments of the present invention, the ionotropic receptor co-receptor gene IR25a inhibitor or ionotropic receptor co-receptor gene IR76b inhibitor is at least one of (12) to (14):

[0027] (12) dsRNA targeting the ionotropic receptor coreceptor gene IR25a or the ionotropic receptor coreceptor gene IR76b;

[0028] (13) a nucleic acid molecule encoding the dsRNA targeting the ionotropic receptor co-receptor gene IR25a or the ionotropic receptor co-receptor gene IR76b described in (12);

[0029] (14) An expression cassette, vector or transgenic cell line comprising the nucleic acid molecule described in (13).

[0030] In some embodiments of the present invention, the dsRNA comprises a double-stranded RNA consisting of a nucleotide sequence shown in SEQ ID NO: 13 or SEQ ID NO: 14 and a nucleotide sequence shown in a reverse complementary sequence thereof.

[0031] In some embodiments of the present invention, the amino acid sequence of the ionotropic receptor co-receptor gene IR25a is shown as SEQ ID NO:2, and the amino acid sequence of the ionotropic receptor co-receptor gene IR76b is shown as SEQ ID NO:4.

[0032] In some embodiments of the present invention, the sex pheromone includes 3,11-dimethylnonacosane-2-one.

[0033] The second aspect of the present invention provides a dsRNA, wherein the dsRNA comprises a double-stranded RNA consisting of a nucleotide sequence represented by SEQ ID NO: 13 or SEQ ID NO: 14 and a nucleotide sequence represented by a reverse complementary sequence thereof.

[0034] The third aspect of the present invention provides a biological material related to the dsRNA of the second aspect of the present invention, wherein the biological material comprises any one of 1) to 12):

[0035] 1) A nucleic acid molecule encoding the dsRNA of the second aspect of the present invention;

[0036] 2) an expression cassette comprising the nucleic acid molecule described in 1);

[0037] 3) a vector comprising the nucleic acid molecule described in 1);

[0038] 4) a vector comprising the expression cassette described in 2);

[0039] 5) A transgenic cell line comprising the nucleic acid molecule described in 1);

[0040] 6) A transgenic cell line comprising the expression cassette described in 2);

[0041] 7) A transgenic cell line comprising the vector described in 3);

[0042] 8) A transgenic cell line comprising the vector described in 4);

[0043] 9) A recombinant microorganism containing the nucleic acid molecule described in 1);

[0044] 10) a recombinant microorganism containing the expression cassette described in 2);

[0045] 11) A recombinant microorganism containing the vector described in 3);

[0046] 12) A recombinant microorganism containing the vector described in 4).

[0047] In some embodiments of the invention, the transgenic cell line does not contain reproductive material.

[0048] The fourth aspect of the present invention is to provide a reagent, wherein the reagent comprises the dsRNA of the second aspect of the present invention and / or the biological material of the third aspect of the present invention.

[0049] In some embodiments of the present invention, the reagent is used for any one of a1) to a4):

[0050] a1) Weakening the response of Blattodea insects to sex pheromones;

[0051] a2) disrupting / suppressing the mating of male and female insects of the order Blatta;

[0052] a3) Prolonging the courtship latency period of Blattodea insects;

[0053] a4) Control of Blattodea insects.

[0054] In some embodiments of the present invention, the Blattodea insects include at least one of Periplaneta fuliginosa, Periplaneta americana, Periplaneta australis, Blatta germanica, and Periplaneta japonica.

[0055] In some preferred embodiments of the present invention, the Blattaria insect is German cockroach.

[0056] In some embodiments of the present invention, the sex pheromone includes 3,11-dimethylnonacosane-2-one.

[0057] The fifth aspect of the present invention provides the use of the dsRNA of the second aspect of the present invention, the biological material of the third aspect of the present invention and / or the reagent of the fourth aspect of the present invention in any one of b1) to b8):

[0058] b1) weaken the response of Blattodea insects to sex pheromones;

[0059] b2) preparing products that weaken the response of Blattaria insects to sex pheromones;

[0060] b3) disrupting / suppressing the mating of male and female insects of the order Blatta;

[0061] b4) preparing products for interfering with / suppressing the mating of male and female insects of the order Blattata;

[0062] b5) Prolonging the courtship latency period of Blattaria insects;

[0063] b6) preparing products for prolonging the courtship latency period of Blattaria insects;

[0064] b7) controlling insects of the order Blattodea;

[0065] b8) preparing products for controlling insects of the order Blattaria.

[0066] In some embodiments of the present invention, the Blattodea insects include at least one of Periplaneta fuliginosa, Periplaneta americana, Periplaneta australis, Blatta germanica, and Periplaneta japonica.

[0067] In some preferred embodiments of the present invention, the Blattaria insect is German cockroach.

[0068] In some embodiments of the present invention, the sex pheromone includes 3,11-dimethylnonacosane-2-one.

[0069] The sixth aspect of the present invention is to provide a method comprising: a step of reducing the expression level and / or activity of ionotropic receptor co-receptor gene IR25a and / or ionotropic receptor co-receptor gene IR76b in Blattodea insects, wherein the method is any one of c1) to c4):

[0070] c1) Methods for disrupting / suppressing mating of male and female insects of the order Blattaria;

[0071] c2) methods for prolonging the courtship latency period of Blattodea insects;

[0072] c3) methods for controlling insects of the order Blattodea;

[0073] c4) A method for attenuating the response of Blattodea insects to sex pheromones.

[0074] In some embodiments of the present invention, the amino acid sequence of the ionotropic receptor co-receptor gene IR25a is shown as SEQ ID NO:2, and the amino acid sequence of the ionotropic receptor co-receptor gene IR76b is shown as SEQ ID NO:4.

[0075] In some embodiments of the present invention, the step of reducing the expression level and / or activity of the ionotropic receptor co-receptor gene IR25a and / or the ionotropic receptor co-receptor gene IR76b in Blattaria insects is to introduce the dsRNA of the second aspect of the present invention, the biological material of the third aspect of the present invention and / or the reagent of the fourth aspect of the present invention into the body of Blattaria insects.

[0076] In some embodiments of the present invention, the introduction method includes oral feeding or injection.

[0077] In some embodiments of the present invention, the oral feeding comprises pre-administering, spraying or atomizing the food or water to contain the dsRNA of the second aspect of the present invention, the biological material of the third aspect of the present invention and / or the agent of the fourth aspect of the present invention.

[0078] In some embodiments of the invention, the injection is into the hemolymph along the intersegmental folds of the abdomen of the Blattodea insect.

[0079] In some embodiments of the present invention, the Blattodea insects include at least one of Periplaneta fuliginosa, Periplaneta americana, Periplaneta australis, Blatta germanica, and Periplaneta japonica.

[0080] In some preferred embodiments of the present invention, the Blattaria insect is German cockroach.

[0081] In some embodiments of the present invention, the sex pheromone includes 3,11-dimethylnonacosane-2-one.

[0082] The beneficial effects of the present invention are:

[0083] The present invention discloses for the first time ionotropic receptor co-receptor genes (Ionotropic Receptor Co-receptor, IR-Co) IR25a and IR76b which can be used to regulate the reproduction-related behaviors of German cockroaches. Ionotropic receptor co-receptor genes IR25a and / or IR76b are targetedly down-regulated (inhibiting the expression of ionotropic receptor co-receptor genes IR25a and / or IR76b), degraded, and inhibited in their activities, thereby reducing the electrophysiological response of male insects to contact pheromone standards and weakening or eliminating the courtship behaviors of male insects to female insects, thereby achieving the purpose of interfering with and curbing mating and reproduction between males and females.

[0084] The present invention designs specific dsRNAs that can effectively block male courtship behavior and prolong courtship latency based on the two genes of ionotropic receptor co-receptor genes IR25a and IR76b. The dsRNAs corresponding to the genes are respectively injected into the male insects, which can make the male insects in some treatment groups lose their courtship behavior towards wild-type female insects, and in the male insects that can courtship, their courtship latency is significantly prolonged. In particular, injecting dsIR25a into the male insects of German cockroaches can significantly reduce the electrophysiological response of male insects to contact pheromone standards, and inhibit the activity of neurons in the antennae of male insects (subtype 2), thereby interfering with and curbing male-female mating and reproduction, thereby achieving the ultimate purpose of pest control. The present invention provides a potential molecular target for the prevention and control strategy of fundamentally controlling the population of German cockroaches by interfering with their courtship and mating activities. In addition, gene editing technology has achieved breakthroughs in German cockroaches in recent years. The present invention can also provide a new molecular target for genetic control of German cockroaches using gene editing technology in the future. BRIEF DESCRIPTION OF THE DRAWINGS

[0085] Figure 1 The expression level changes of IR25a gene (A) or IR76b gene (B) after dsRNA injection in male insects in Example 3, the internal reference gene is actin-5c, *** indicates P<0.001.

[0086] Figure 2 The courtship behavior of male insects towards wild-type female insects in Example 4 changes; wherein A is the wing-raising rate (courtship rate) of male insects, * indicates P<0.05, *** indicates P<0.001; B is the courtship latency of male insects, * indicates P<0.05, *** indicates P<0.001.

[0087] Figure 3The electrophysiological response of male insects to the sex pheromone standard after two injections of dsIR25a in Example 5; wherein A is the response frequency (number of pulses per second) of the antennal sensilla of male insects to the sex pheromone standard, *** indicates P<0.001; B is a representative single sensilla recording spectrum, and the black arrow represents the starting time point of the representative pheromone stimulation. DETAILED DESCRIPTION

[0088] The present invention is further described in detail below through specific examples.

[0089] It should be understood that these embodiments are only used to illustrate the present invention and are not used to limit the scope of the present invention.

[0090] In order to make the purpose, technical scheme and advantages of the embodiments of the present invention clearer, the technical scheme in the embodiments of the present invention will be described clearly and completely below. If the specific conditions are not specified in the embodiments, they are carried out according to conventional conditions or conditions recommended by the manufacturer. If the manufacturer of the reagents or instruments used is not specified, they are all conventional products that can be purchased commercially.

[0091] The features and performance of the present invention are further described in detail below in conjunction with the embodiments.

[0092] Example 1 Obtaining the coding sequences of the German cockroach IR25a and IR76b genes

[0093] Based on the German cockroach genome annotation information and antenna differential transcriptome analysis data, first according to gene ID: C0J52_39515, the ionotropic receptor co-receptor (Ionotropic Receptor Co-receptor, IR-Co) gene IR25a potential coding sequence (CDS), further using the third generation genome and bioinformatics analysis means to proofread the potential coding sequence, obtain its complete CDS sequence, length of 2796bp, nucleotide sequence as shown in SEQ ID NO: 1. This gene encodes 931 amino acid residues, as shown in SEQ ID NO: 2. Based on the German cockroach genome annotation information and antenna differential transcriptome analysis data, first according to gene ID: C0J52_38862, the ionotropic receptor co-receptor gene IR76b potential coding sequence (CDS), further using the third generation genome and bioinformatics analysis means to proofread the potential coding sequence, obtain its complete CDS sequence, length of 1617bp, nucleotide sequence as shown in SEQ ID NO: 3. IR76b encodes 538 amino acid residues, as shown in SEQ ID NO: 4. The protein sequences encoded by the IR25a and IR76b genes both have the conserved ligand binding domain and transmembrane domain of ionotropic receptors.

[0094]

[0095] MALENRLLFLLLAMFFDFSASQKINIMILNEERNWEASDSFRAAQEYFKQTPTLGVEIGNLMNVTGNTTDAKTFLEMMCTEYNNSIAEKNPPHIVLDFTMSSVPSETAKSFTAALGLPTISTSFGQEGDLRQWRTLDEREKKYLIQIMPPADIIPEVIRSIVVSQNITNAGILFDDSIVMDHKYKSLLQNIPTRHMIVKVDQQGPRAQLERMRSRDIFNYFIVGRMTTIKKVFDVAYKKKYFMRQFAWHGITSDSGNVYCDCKNATVFYVKPRPNQEYTDRYDLLKTKFGLSGTPEITVSFYFDIAVRTLMAAKTIMKGKPYWENYVTCNDYDEKSRPVPDVNLMKAFTEVTEKPSYGPFVLKSNGQSMMKFNMDMTLVTINNKIPVKSVEVATWEADLVKGLDIKNGDKMVENSAVTVYRIVTVVQKPFVMYDGVDDKNRTKFKGYCIDLIDEIRNITKFDYDIFEAPDGKFGNMDENGEWNGMIKELILKNADIALGSLSVMAERENVVDFTVPYYDLVGITILMKKPKAATSLFKFLTVLENDVWLCILAAYFFTSFLMWVFDRWSPYSYQNNREKYKDDEEKREFNLKECLWFCMTSLTPQGGGEAPKNLSGRLVAATWWLFGFIIIASYTANLAAFLTVSRLDTPVESLDDLAKQYKIQYAPLANSSAQTYFQRMADIESRFYEIWKDMSLNDSLTDVERAKLAVWDYPVSDKYTKIWQAMKEAKFPDSLEAAVARVMESKSSSEGFAFIGDATDIRYLVLTSCDLQMVGEEFSRKPYAIATQQGSPLKDQFNNAILQLLNKRKLEKLKEQWWNQNPEKKRNCEKQDDQTDGISIQNIGGVFIVIFVGIGLACITLAFEYWWYRFKRNPQVVDTGNVVVQPRTIPTAGGGKMDPLTMPGFRPRNTGFSERPFTQRNAALAAVNNPW(SEQ ID NO:2)。

[0096]

[0097] (SEQ ID NO:4).

[0098] Example 2 Preparation of dsRNA fragments of German cockroach IR25a and IR76b genes

[0099] Based on the sequences shown in SEQ ID NO: 1 and SEQ ID NO: 3, specific primer pairs for amplifying IR25a and IR76b gene fragments were designed using the NCBI online primer design tool Primer-BLAST. The primer sequences used to amplify the IR25a gene fragment are as follows: 5'-TTGAGGCACCTGATGGGAAA-3' (SEQ ID NO: 5) and 5'-GTGTGAGGGAGGTCATGCAA-3' (SEQ ID NO: 6). The primer sequences used to amplify the IR76b gene fragment are as follows: 5'-ATGTCCCCGAGAATGAACGC-3' (SEQ ID NO: 7) and 5'-TGTTTTCCAAAAGGTGGCGG-3' (SEQ ID NO: 8).

[0100] To obtain the DNA template required for synthesizing IR25a gene dsRNA, the recombinant plasmid containing the sequence shown in SEQ ID NO: 1 was used as a template, and PCR amplification was performed using primer pairs SEQ ID NO: 5 and SEQ ID NO: 9 (5'-taatacgactcactataggGTGTGAGGGAGGTCATGCAA-3', wherein the lowercase letter portion is the T7 promoter sequence) and primer pairs SEQ ID NO: 6 and SEQ ID NO: 10 (5'-taatacgactcactatagg TTGAGGCACCTGATGGGAAA-3', wherein the lowercase letter portion is the T7 promoter sequence).

[0101] To obtain the DNA template required for synthesizing IR76b gene dsRNA, the recombinant plasmid containing the sequence shown in SEQ ID NO:3 was used as a template, and PCR amplification was performed using primer pairs SEQ ID NO:7 and SEQ ID NO:11 (5'-taatacgactcactataggTGTTTTCCAAAAGGTGGCGG-3', wherein the lowercase letter portion is the T7 promoter sequence) and primer pair SEQ ID NO:8 and SEQ ID NO:12 (5'-taatacgactcactatagg ATGTCCCCGAGAATGAACGC-3', wherein the lowercase letter portion is the T7 promoter sequence).

[0102] The PCR amplification procedures for the above two gene fragments were: 94°C for 2 min, followed by 34 cycles of 94°C for 30 s, 55°C for 30 s and 72°C for 30 s, and finally 72°C for 5 min. The DNA polymerase used for PCR was Ex Taq enzyme from TAKARA. Further, dsRNA was synthesized and purified using the T7 RiboMAXTM Express RNAi System (Beijing Promega Company) in vitro transcription kit, which were respectively recorded as dsIR25a (sequence as shown in SEQ ID NO: 13) and dsIR76b (sequence as shown in SEQ ID NO: 14). The concentration was adjusted to 3 μg / μL with RNase-free water under the monitoring of NanoDrop One UV spectrophotometer and stored in a -80°C refrigerator for later use.

[0103] UUGAGGCACCUGAUGGGAAAUUUGGCAACAUGGAUGAGAAUGGAGAGUGGAAUGGCAUGAUCAAGGAACUUAUUCUUAAGAAUGCAGACAUUGCACUGGGCUCCUUGUCAGUGAUGGCAGAGCGUGAAAAUGUAGUGGACUUCACAGUGCCAUAUUAUGACUUGGUCGGCAUCACUAUCCUCAUGAAGAAACCUAAAGCUGCCACUUCGCUCUUCAAAUUUUUAACUGUGCUUGAGAAUGAUGUGUGGCUGUGCAUCCUCGCAGCAUACUUCUUCACUAGUUUUCUGAUGUGGGUGUUUGACCGCUGGAGUCCAUACAGUUAUCAGAAUAACAGAGAAAAAUACAAGGAUGAUGAAGAAAAGCGAGAAUUCAAUCUGAAGGAGUGCCUCUGGUUUUGCAUGACCUCCCUCACAC(SEQ IDNO:13).

[0104] AUGUCCCCGAGAAUGAACGCUGUACCUAUGUCGUCACACCAAAAUCAUUCAUGGCCCAUGGCAUUGCUUUUGCUUAUCCCAAGAACAGUACCUUGGCAAAACUAUUUGACCCGAUAUUCCAGGCAUUGGUGGAAACAGGAAUUGUGAAACAUCUGCUGAAGAAAGAUCUGCCUCCCACUGAGAUCUGUCCUCUGAACUUGAAGAGUACAGAACGACAGCUGAGGAACGGUGAUCUGUUCACGACCUACAUGGUGGUAGUUAUUGGCUUCAUUGCUGGAAUUGCCGCUUUCAUUGGAGAGGUGAUGUACACCACUGUCAAGAGAUGCGCUGCUGGAACUAAGAUAGAGGUACCAGACACCGAUUGGACAGGAAAUGUCGGAUACAAGAAAUCGCAGCUAUUCCCUCCGCCUUAUUCUGUGUUUAUGCAGCAACAACCGCCACCUUUUGGAAAACA(SEQ ID NO:14).

[0105] In vivo injection of dsIR25a and dsIR76b and detection of RNA interference efficiency

[0106] Male cockroaches on the day of eclosion were selected and randomly divided into three groups. One group was injected with dsRNA corresponding to the mouse lymphotoxin protein (Muslta) gene (sequence as shown in SEQ ID NO:15) as a control group; one group was injected with dsIR25a or dsIR76b as a dsIR25a experimental group; and the other group was injected with dsIR76b as a dsIR76b experimental group. After the male cockroaches were anesthetized with carbon dioxide for a short time, dsRNA was injected into the hemolymph from the 7th / 8th intersegmental fold of the abdomen using a microinjector (Alcott Biotechnology) under the magnified field of view of a microscope. The injection volume was 2 μL, and the dsRNA concentration was 3 μg / μL. The injected cockroaches were placed in a clean bioassay container. Wait 10 to 20 minutes to allow them to recover from the effects of carbon dioxide. Labels were attached to the containers with the injection date, type and dose of dsRNA, and age of the German cockroaches. On the third day of eclosion, the male cockroaches were injected for the second time, with the same injection dose as the first time.

[0107] On the 5th day after eclosion, 12 to 15 pairs of male antennae were collected from each sample, and total RNA was extracted using the Trizol kit method. Subsequently, 2 μg of total RNA was reverse transcribed to obtain the first-strand cDNA. qPCR primers were designed using the NCBI online tool Primer Blast online tool. The qPCR primer sequences of the IR25a gene were as follows: 5'-ACCTCGTACAATCCCTACG-3' (SEQ ID NO: 16) and 5'-TTCTCTGGGTAAAGGGTCTC-3' (SEQ ID NO: 17), and the qPCR primer sequences of the IR76b gene were as follows: 5'-GCAGGATGGATTTCACACAA-3' (SEQ ID NO: 18) and 5'-CCTTTTCGATGAGGAATCGG-3' (SEQ ID NO: 19). qPCR detection was performed using the German cockroach actin gene (actin-5c) as the internal reference gene, and 4 biological replicates were set for each control and experimental group.

[0108] qPCR test results Figure 1 As shown in the figure, it can be seen that the two injections of dsRNA have a significant inhibitory effect on the expression of IR25a or IR76b in the antennae of male insects. Among them, the RNA interference efficiency of IR25a is about 94% ( Figure 1 A), the RNA interference efficiency of IR76b is about 96% ( Figure 1 (B).

[0109] CACCCUCUCCACGAAUUGCUCGGCCGUUCACUGGAACUCCUGGGCCUGACCCAGCUCCCUGCUAGUCCCUGCGGCCCACAGUUCCCCGGACCCGACUCCCUUUCCCAGAACGCAGUAGUCUAAGCCCUUAGCCUGCGGUUCUCCUAGGCCCCAGCCUUUCCUGCCUUCGACUGAAACAGCAGCAUCUUCUA (SEQ ID NO: 15).

[0110] Example 4 Injection of dsIR25a or dsIR76b significantly inhibits the courtship rate of German cockroach males towards wild-type females

[0111] As described in Example 3, the dsRNA live injection scheme was used to perform RNA interference on the IR25a or IR76b gene in the antennae of the male German cockroach to analyze the changes in the male courtship behavior under the premise of effectively reducing the expression of IR25a or IR76b. The courtship behavior test was performed using video recording on the 5th day after the male insect emerged. The specific process is as follows: a single male insect was placed in a single-mouth transparent glass tube (7 cm long, 2 cm in diameter), and then a wild-type female insect on the 3rd day after emergence was introduced to make a 1:1 pairing of male and female, and the other end of the glass tube was blocked with a cotton ball. The courtship and mating behavior of German cockroaches was recorded using a Lumix GH4 high-definition camera for 15 minutes. The acquired behavioral source video was analyzed to analyze two main behavioral parameters: 1) the rate of male wing raising (a landmark behavioral feature of the courtship stage); 2) the latency of male wing raising (the time interval from the male antennae contacting the female to the occurrence of male wing raising).

[0112] The results are as follows Figure 2 As shown in the figure, compared with the control group, the courtship rate of male insects injected with dsIR25a or dsIR76b decreased significantly. In the treatment group injected with dsIR25a, about 41% of the male individuals no longer courted wild-type female insects, and in the treatment group injected with dsIR76b, about 87% of the male individuals no longer courted wild-type female insects ( Figure 2 Among the remaining males that could mate, their courtship latency was significantly prolonged ( Figure 2 (B).

[0113] Example 5 Injection of dsIR25a significantly inhibits the electrophysiological response of German cockroach males to sex pheromones

[0114] The standard of 3,11-dimethylnonacoustic-2-one, a component of the contact pheromone of German cockroach, was prepared into a n-hexane solution with a concentration of 50 ng / μL. A certain volume of the n-hexane solution of the standard was taken and dried naturally in a chromatographic bottle, and a 10 mM KCl solution (containing 0.1% Triton X-100) of the same volume as that of n-hexane was added to prepare a single sensillum recording stimulus solution, which was vortexed and allowed to stand for use. The 10 mM KCl solution was used as the control solution for single sensillum recording. The German cockroach male was microinjected with dsRNA as described in Example 3. On the 6th day after eclosion, the TasteProbe single sensillum recorder (Synthch, Germany) was used to detect the electrophysiological response of the male insect to the sex pheromone. The insect body and antennae were fixed with low melting point paraffin, the reference electrode silver wire was inserted into the abdomen of the insect body, and the capillary glass tube containing the stimulus solution was inserted into the silver wire at the other end as the recording electrode. Under a microscope, the glass tip of the recording electrode was slowly inserted into the top of the antennal stinging sensilla (subtype 2) so that the stimulus liquid contacted the top hole of the sensilla. After successful recording, the recording electrode containing the control solution was replaced to record the same sensilla. The number of pulses in the antennae of the male insects in the control group and the treatment group in response to the stimulus liquid within 1 second was counted using Autospike software.

[0115] The results are as follows Figure 3 As shown, it can be seen that the male insects injected with dsIR25a have a weaker response to the sex pheromone standard compared with the control group, which is manifested by a significant decrease in the number of pulses per second.

[0116] The embodiments of the present invention are described in detail above in conjunction with the accompanying drawings, but the present invention is not limited to the above embodiments. Various changes can be made within the knowledge of ordinary technicians in the relevant technical field without departing from the purpose of the present invention. In addition, the embodiments of the present invention and the features in the embodiments can be combined with each other without conflict.

Claims

1. Use of an ionotropic receptor co-receptor gene IR25a inhibitor and / or an ionotropic receptor co-receptor gene IR76b inhibitor in any one of (1) to (8): (1) Weakening the response of Blattodea insects to sex pheromones; (2) preparing products that weaken the response of Blattodea insects to sex pheromones; (3) disrupting / suppressing the mating of male and female Blattodea insects; (4) preparing products for interfering with / suppressing the mating of male and female Blattaria insects; (5) Prolonging the courtship latency period of Blattodea insects; (6) preparing a product for prolonging the courtship latency period of Blattaria insects; (7) Control of Blattodea insects; (8) preparing products for controlling Blattaria insects; The ionotropic receptor co-receptor gene IR25a inhibitor or ionotropic receptor co-receptor gene IR76b inhibitor is at least one of (9) to (11): (9) dsRNA targeting the ionotropic receptor coreceptor gene IR25a or the ionotropic receptor coreceptor gene IR76b; (10) a nucleic acid molecule encoding the dsRNA targeting the ionotropic receptor co-receptor gene IR25a or the ionotropic receptor co-receptor gene IR76b described in (9); (11) an expression cassette, vector or transgenic cell line comprising the nucleic acid molecule described in (10); The dsRNA is a double-stranded RNA consisting of a nucleotide sequence shown in SEQ ID NO: 13 or SEQ ID NO: 14 and a nucleotide sequence shown in a reverse complementary sequence thereof; The Blattaria insect is German cockroach.

2. The use according to claim 1, characterized in that: The amino acid sequence of the ionotropic receptor co-receptor gene IR25a is shown in SEQ ID NO:2, and the amino acid sequence of the ionotropic receptor co-receptor gene IR76b is shown in SEQ ID NO:

4.

3. A dsRNA, which is a double-stranded RNA consisting of the nucleotide sequence shown in SEQ ID NO: 13 or SEQ ID NO: 14 and the nucleotide sequence shown in the reverse complementary sequence thereof.

4. A biological material related to the dsRNA according to claim 3, wherein the biological material comprises any one of 1) to 12): 1) A nucleic acid molecule encoding the dsRNA according to claim 3; 2) an expression cassette comprising the nucleic acid molecule described in 1); 3) a vector comprising the nucleic acid molecule described in 1); 4) a vector comprising the expression cassette described in 2); 5) A transgenic cell line comprising the nucleic acid molecule described in 1); 6) A transgenic cell line comprising the expression cassette described in 2); 7) A transgenic cell line comprising the vector described in 3); 8) A transgenic cell line comprising the vector described in 4); 9) A recombinant microorganism containing the nucleic acid molecule described in 1); 10) a recombinant microorganism containing the expression cassette described in 2); 11) A recombinant microorganism containing the vector described in 3); 12) A recombinant microorganism containing the vector described in 4).

5. A reagent, characterized in that The agent comprises the dsRNA of claim 3 and / or the biological material of claim 4.

6. The reagent according to claim 5, characterized in that The reagent is used for any one of a1) to a4): a1) Weakening the response of Blattodea insects to sex pheromones; a2) disrupting / suppressing the mating of male and female insects of the order Blatta; a3) Prolonging the courtship latency period of Blattodea insects; a4) Control of Blattodea insects.

7. Use of the dsRNA according to claim 3, the biological material according to claim 4 and / or the reagent according to claim 5 or 6 in any one of b1) to b8): b1) weaken the response of Blattodea insects to sex pheromones; b2) preparing products that weaken the response of Blattaria insects to sex pheromones; b3) disrupting / suppressing the mating of male and female insects of the order Blatta; b4) preparing products for interfering with / suppressing the mating of male and female insects of the order Blattata; b5) Prolonging the courtship latency period of Blattaria insects; b6) preparing products for prolonging the courtship latency period of Blattaria insects; b7) Controlling insects of the order Blattodea; b8) preparing products for controlling insects of the order Blattaria; The Blattaria insect is German cockroach.

8. A method comprising: reducing the expression level and / or activity of ionotropic receptor co-receptor gene IR25a and / or ionotropic receptor co-receptor gene IR76b in Blattodea insects, wherein the method is any one of c1) to c4): c1) Methods for disrupting / suppressing mating of male and female insects of the order Blattaria; c2) methods for prolonging the courtship latency period of Blattodea insects; c3) methods for controlling insects of the order Blattodea; c4) methods for attenuating the response of Blattodea insects to sex pheromones; The Blattaria insect is German cockroach; The step of reducing the expression level and / or activity of the ionotropic receptor co-receptor gene IR25a and / or the ionotropic receptor co-receptor gene IR76b in Blattaria insects is to introduce the dsRNA according to claim 3, the biological material according to claim 4, or the reagent according to claim 5 or 6 into the body of Blattaria insects.

9. The method according to claim 8, characterized in that The amino acid sequence of the ionotropic receptor co-receptor gene IR25a is shown in SEQ ID NO:2, and the amino acid sequence of the ionotropic receptor co-receptor gene IR76b is shown in SEQ ID NO:4.

Images