The Bdorpainless gene is involved in the escape behavior of Bactrocera dorsalis and its application in the control of Bactrocera dorsalis

Abstract

The present invention belongs to the technical field of pest control, discloses the involvement of the Bdorpainless gene in the escape behavior of the fruit fly and its application in the control of the fruit fly, and specifically discloses the application of Bdorpainless as a target in the control of the fruit fly. The present invention discloses for the first time that the transient receptor potential ion channel Bdorpainless mediates the recognition of the extreme temperature and humidity environment by the fruit fly larvae, which can be used as a key target to interfere with the normal behavior of the fruit fly larvae, and can provide a new and feasible approach for pest control.

Description

Technical Field

[0001] The invention belongs to the technical field of pest control, and particularly relates to a Bdorpainless gene involved in the escape behavior of the citrus fruit fly and an application of the Bdorpainless gene in the control of the citrus fruit fly. Background Art

[0002] Nociception is essential for the survival of organisms in nature, enabling timely detection of potential threats and playing a key protective role in moments of extreme danger. Larvae are particularly susceptible to the influence of their surroundings due to their small size and limited mobility. Under the constraints of these biological factors, the survival of larvae requires both appropriate behavioral responses to environmental changes and physiological regulation of environmental changes, both of which require the ability of organisms to accurately perceive dangerous environments.

[0003] Transient receptor potential (TRP) channels are a class of cation channels that are critical in sensory signal transduction and are conserved from fruit flies to humans. These channels are responsible for detecting the external environment and are involved in a variety of senses, including mechanical sensation, vision, taste, smell, moisture, etc. Although transient receptor potential ion channels have been extensively characterized in the model insect Drosophila melanogaster, their functions in the important invasive agricultural and forestry pest Bactrocera dorsalis remain poorly understood.

[0004] The fruit fly is a highly invasive and destructive agricultural and forestry pest. The damage caused by the quarantine pest, the fruit fly, is becoming increasingly serious due to its strong environmental adaptability and invasion ability. Currently, the most effective prevention and control method is to use odor trapping combined with pesticides. The female insects mainly lay eggs in the host fruit, and the larvae are the main cause of damage. Since the larvae hide inside the fruit, it is difficult to effectively kill the larvae by spraying pesticides, which will hinder the trapping effect of the pesticide to a certain extent. Nowadays, there is an urgent need to understand the environmental adaptability of the larvae and develop new, effective, green and specific insecticide products for the effective targets of the larvae. Summary of the invention

[0005] The first aspect of the present invention aims to provide the use of Bdorpainless as a target in controlling the citrus fruit fly.

[0006] The second aspect of the present invention aims to provide a Bdorpainless gene mutant.

[0007] The third aspect of the present invention aims to provide the use of the Bdorpainless gene mutant of the second aspect of the present invention in controlling the citrus fruit fly.

[0008] The fourth aspect of the present invention aims to provide a method.

[0009] The purpose of the fifth aspect of the present invention is to provide a gRNA.

[0010] The purpose of the sixth aspect of the present invention is to provide biological materials related to the gRNA of the fourth aspect of the present invention.

[0011] The purpose of the seventh aspect of the present invention is to provide the use of the gRNA of the fourth aspect of the present invention or the biological material of the fifth aspect of the present invention in controlling the citrus fruit fly.

[0012] The eighth aspect of the present invention aims to provide a product.

[0013] The purpose of the ninth aspect of the present invention is to provide a CRISPR / Cas system.

[0014] In order to achieve the above object, the technical solution adopted by the present invention is:

[0015] The first aspect of the present invention provides the use of Bdorpainless as a target in controlling the citrus fruit fly.

[0016] Application of Bdorpainless as a target in screening or preparing products for controlling the citrus fruit fly.

[0017] Application of Bdorpainless as a target in curbing the pupation of larvae of the citrus fruit fly.

[0018] Application of Bdorpainless as a target in the preparation of products for inhibiting the pupation of larvae of the oriental fruit fly.

[0019] Application of Bdorpainless as a target in increasing the escape response temperature of the citrus fruit fly.

[0020] Application of Bdorpainless as a target in the preparation of products with escape reaction temperature of the citrus fruit fly.

[0021] The second aspect of the present invention provides a Bdorpainless gene mutant, wherein the Bdorpainless gene mutant has a deletion of A at position 1909 of the nucleotide sequence shown in SEQ ID NO:1.

[0022] In some embodiments of the present invention, the nucleotide sequence of the Bdorpainless gene mutant is shown as SEQ ID NO:13.

[0023] The third aspect of the present invention provides the use of the Bdorpainless gene mutant of the second aspect of the present invention in any one of 1) to 6):

[0024] 1) Control of the citrus fruit fly;

[0025] 2) Screening or preparing products for controlling the citrus fruit fly;

[0026] 3) Prevent the pupation of citrus fruit fly larvae;

[0027] 4) preparing products for preventing larvae of Bactrocera dorsalis from pupating;

[0028] 5) Increase the escape reaction temperature of Bactrocera dorsalis;

[0029] 6) preparing a product having an escape reaction temperature of the citrus fruit fly.

[0030] In some embodiments of the present invention, the products include but are not limited to reagents, kits and drugs.

[0031] A fourth aspect of the present invention provides a method, comprising the step of expressing a Bdorpainless gene mutant in vivo in Bactrocera dorsalis;

[0032] The method is at least one of a1 to a3:

[0033] a1) Methods for controlling the fruit fly;

[0034] a2) methods for preventing the pupation of larvae of the fruit fly;

[0035] a3) Method for increasing the escape reaction temperature of the citrus fruit fly

[0036] In some embodiments of the present invention, the method comprises using CRISPR / Cas9 gene editing technology to target and edit the Bdorpainless gene of Bactrocera dorsalis into a Bdorpainless gene mutant.

[0037] In some embodiments of the present invention, the method includes introducing gRNA and Cas9 protein into the body of the citrus fruit fly, thereby editing the Bdorpainless gene as shown in SEQ ID NO:1, and the sequence of the gRNA is shown in SEQ ID NO:12.

[0038] A fifth aspect of the present invention provides a gRNA, the sequence of which is shown in SEQ ID NO:12.

[0039] The sixth aspect of the present invention provides a biological material related to the gRNA of the fifth aspect of the present invention, wherein the biological material comprises at least one of b1) to b12):

[0040] b1) a nucleic acid molecule encoding the gRNA of the fifth aspect of the present invention;

[0041] b2) an expression cassette containing the nucleic acid molecule described in b1);

[0042] b3) a recombinant vector containing the nucleic acid molecule described in b1);

[0043] b4) a recombinant vector containing the expression cassette described in b2);

[0044] b5) a recombinant cell containing the nucleic acid molecule described in b1);

[0045] b6) a recombinant cell containing the expression cassette described in b2);

[0046] b7) a recombinant cell containing the recombinant vector described in b3);

[0047] b8) a recombinant cell containing the recombinant vector described in b4);

[0048] b9) a recombinant microorganism containing the nucleic acid molecule described in b1);

[0049] b10) a recombinant microorganism containing the expression cassette described in b2);

[0050] b11) a recombinant microorganism containing the recombinant vector described in b3);

[0051] b12) A recombinant microorganism containing the recombinant vector described in b4).

[0052] In some embodiments of the present invention, the recombinant vector is a plasmid vector, a phagemid, a viral vector, a cell vector, a phage, a cosmid, a F cosmid, or an artificial chromosome.

[0053] In some embodiments of the present invention, the plasmid vector may be an optional plasmid, the viral vector may be an optional virus, and the cell vector does not include propagation materials.

[0054] The seventh aspect of the present invention provides the use of the gRNA of the fifth aspect of the present invention or the biomaterial of the sixth aspect of the present invention in any one of c1) to c6):

[0055] c1) Control of fruit fly;

[0056] c2) Screening or preparing products for controlling Bactrocera dorsalis;

[0057] c3) To prevent the pupation of larvae of the fruit fly;

[0058] c4) preparing products for inhibiting the pupation of larvae of Bactrocera dorsalis;

[0059] c5) increasing the escape reaction temperature of the fruit fly;

[0060] c6) preparing a product having an escape reaction temperature of the oriental fruit fly.

[0061] In some embodiments of the present invention, the products include but are not limited to reagents, kits and drugs.

[0062] The eighth aspect of the present invention provides a product, comprising the Bdorpainless gene mutant of the second aspect of the present invention, the gRNA of the fifth aspect of the present invention, or the biomaterial of the sixth aspect of the present invention.

[0063] In some embodiments of the present invention, the product is used to control the fruit fly, inhibit the pupation of the larvae of the fruit fly and / or increase the escape reaction temperature of the fruit fly.

[0064] The ninth aspect of the present invention provides a CRISPR / Cas system, comprising the gRNA of the fifth aspect of the present invention and / or the biological material of the sixth aspect of the present invention.

[0065] In some embodiments of the present invention, the CRISPR / Cas system further comprises: Cas protein and / or biological material associated with the Cas protein.

[0066] In some embodiments of the present invention, the Cas protein comprises a Cas9 protein.

[0067] The beneficial effects of the present invention are:

[0068] The present invention discloses for the first time that the transient receptor potential ion channel Bdorpainless mediates the recognition of extreme temperature and humidity environments by the larvae of the oriental fruit fly, which can be used as a key target for interfering with the normal behavior of the larvae of the oriental fruit fly and can provide a new and feasible approach for pest control. BRIEF DESCRIPTION OF THE DRAWINGS

[0069] Figure 1 Phylogenetic analysis of Bdorpainless. A phylogenetic tree was created using the maximum likelihood method in MEGA 5.2.2 software, including the main members of the transient receptor potential ion channel TRPA subfamily.

[0070] Figure 2 Amino acid sequence alignment of Bdorpainless homologous genes.

[0071] Figure 3 Figure 2 shows the expression pattern of Bdorpainless in different developmental stages and tissues; A represents larvae (L1, L2, L3, L4, L5, L6 and L7); B represents eggs, pupae and adults (1 day, 6 days, 12 days, 16 days and 20 days); C represents different tissues (antennae, beak, maxillary palps, forelegs, midlegs, hindlegs, wings and genitals).

[0072] Figure 4The figure shows the construction of the mutant Bdorpainless; A is the target sequence and PAM sequence (red) of the sgRNA on the exon; B is the genotype of the wild-type Bactrocera dorsalis; and C is the genotype of the mutant Bdorpainless.

[0073] Figure 5 Bdorpainless mediates the temperature-sensing behavior of Bactrocera dorsalis; A is a schematic diagram of the temperature-sensing behavior assay of the wild type and Bdorpainless mutant; B is a survival test of WT and Bdorpainless mutant; C is an escape behavior assay of WT compared with Bdorpainless mutant; in the figure, **** represents P < 0.001.

[0074] Figure 6 Bdorpainless mediates the humidity behavior of Bactrocera dorsalis; wherein, A is a schematic diagram of the humidity sensory behavior assay of the wild type and Bdorpainless mutant; B is the time of WT burrowing into the soil compared with the Bdorpainless mutant; C is the humidity soil selection rate compared with the Bdorpainless mutant; D is the pupation rate in the soil compared with the Bdorpainless mutant; in the figure, ns represents no significant difference, ** represents P < 0.01, *** represents P < 0.005.

[0075] Figure 7 It is the structural formula of the Bdorpainless gene. DETAILED DESCRIPTION

[0076] The present invention is further described in detail below through specific examples.

[0077] It should be understood that these embodiments are only used to illustrate the present invention and are not used to limit the scope of the present invention.

[0078] In order to make the purpose, technical scheme and advantages of the embodiments of the present invention clearer, the technical scheme in the embodiments of the present invention will be described clearly and completely below. If the specific conditions are not specified in the embodiments, they are carried out according to conventional conditions or conditions recommended by the manufacturer. If the manufacturer of the reagents or instruments used is not specified, they are all conventional products that can be purchased commercially.

[0079] The features and performance of the present invention are further described in detail below in conjunction with the embodiments.

[0080] Example 1 Sequence alignment and phylogenetic analysis of the TRPA gene family of insects

[0081] Sequence alignment and phylogenetic analysis of the TRPA gene family of insects were performed. The phylogenetic tree was constructed using the maximum likelihood method using MEGA 5.2.2 software, and the phylogenetic evaluation was performed by 1000 repeated bootstrap analysis. Bootstrap values ​​exceeding 50% were marked on the nodes of the phylogenetic tree. The sequences used to construct the phylogenetic tree were retrieved from the National Center for Biotechnology Information (http: / / www.ncbi.nlm.nih.gov / BLAST / Blast.cgi) using the BLAST service, and the sequence accession numbers are detailed in Table 1. Sequence alignment of painless protein amino acids from multiple species was performed using DNAMAN V7.0 (Lynnon, Biosoft, Canada). DNAMAN was used to align Bdorpainless and add domain annotations (Tracey, WD et al., 2003).

[0082] The full length of the Bdorpainless gene was obtained based on the sequence reported in the article (Su et al., 2018) (SEQ ID NO: 1) (the structure of the Bdorpainless gene is shown in Figure 7 Bdorpainless protein has high homology in different insects. Phylogenetic tree analysis shows that Bdorpainless is clustered with other species, suggesting that painless gene has conserved functions in species ( Figure 1 ), which includes the main members of the transient receptor potential ion channel TRPA subfamily. The amino acid sequence alignment of Bdorpainless with other species showed that these proteins contain some conserved positions. These positions contain 6 common transmembrane helical segments (TM1-TM6) ( Figure 2 ).

[0083] Table 1 Sequence accession number information

[0084]

[0085]

[0086] Example 2 Expression of Dorpainless in Different Developmental Stages and Tissues of Bactrocera dorsalis

[0087] qRT-PCR technology was used to study the expression distribution of the Bdorpainless gene. Bactrocera dorsalis at different developmental stages were selected, including 1-7-day-old larvae, pupae, and eggs; 1-day-old immature males and females; 12-day-old mature males and females; 16-day-old mature males and females; 20-day-old mature males and females; and 12-day-old adult tissues (including antennae, beaks, maxillary palps, legs, wings, and genitals). All experiments were repeated three times.

[0088] Total RNA was isolated from different developmental stages and tissue samples using TRIzol reagent (Invitrogen, Carlsbad, CA). cDNA was synthesized from 500 ng RNA according to the instructions of the First Strand cDNA Synthesis Kit (Thermo Fisher Scientific). α-Tubulin was used as an internal reference gene. The specific primer sequences are shown in Table 2. qRT-PCR amplification was performed in a 96-well reaction plate (Thermo Fisher Scientific). The reaction solution was 20 μL, which contained 10 μL 2×qPCR MasterMix and 1 μL of each primer (10 μM), 10-fold dilution of the cDNA template to 4 μL, and 4 μL RNase water. PCR amplification was performed under the following program: 95°C for 3 minutes; 40 cycles of 95°C for 15 seconds and 60°C for 1 minute. Melting curve analysis was then performed. The data were calculated using the relative quantification method (ΔΔCt).

[0089] Table 2 Primer sequence information

[0090]

[0091]

[0092] The qRT-PCR method was used to study the relative expression profile of Bdorpainless in multiple adult tissues and different developmental stages. The qRT-PCR results showed that Bdorpainless was expressed in larvae of all instars ( Figure 3 A), indicating that Bdorpainless has important physiological functions in the larval stage. The relative expression level of Bdorpainless protein at 20 days of age was higher than that at other developmental stages ( Figure 3 In addition, Bdorpainless is expressed in multiple adult tissues, but at relatively low levels in antennae and wings ( Figure 3 Middle C).

[0093] Example 3

[0094] The transient receptor potential ion channel Bdorpainless gene was knocked out in fruit flies, and the transient receptor potential ion channel Bdorpainless gene was mutated using gene editing experiments. The specific process is as follows:

[0095] (1) Preparation of injection solution: The concentration of gRNA (CTACGTCATGGTGCCTACATTGG (SEQ ID NO: 12)) injected into Bactrocera dorsalis was 300 ng / μL. Before injection, 2.5 μL of target gRNA was mixed and 0.3 μL of 5 μg / μL Cas9 protein (TrueCut TM Cas9 Protein v2 Thermo Fisher, Thermo Fisher / Thermo Fisher), mixed and centrifuged at 12000 rpm in a 4°C centrifuge for 10 minutes.

[0096] (2) Embryo collection: Generally, the eggs of Bactrocera dorsalis are collected once every 10 minutes and placed on a homemade egg stand in a certain direction. A small amount of Halocarbon Oil is added to completely immerse the eggs and prevent them from moving during injection.

[0097] (3) Preparation of injection needle: Set the parameters according to the instructions of the needle puller to break the glass capillary. After breaking, add 3 μL of injection solution with a micro-sample needle to prevent the liquid from being sucked back during needle grinding and causing needle blockage; process the needle tip on the needle grinder to make it have an ideal tip. Then connect the injection needle to the microinjection instrument.

[0098] (4) Microinjection of embryos: Place the stage with arranged embryos under the microscope, adjust the position of the injection needle under the precision optical microscope, and place the injection needle and the embryo on the same plane. Press the pedal to adjust the drop volume. Insert the needle tip into the tail of the embryo. Deliver the mixture into the embryo by pressing the pedal on the microinjector. Inject 200 eggs each time.

[0099] (5) Mutant screening: The eggs injected with gRNA and Cas9 protein were gently picked with a fine brush and placed in larval feed (150 g corn flour, 150 g banana, 0.6 g sodium benzoate, 30 g yeast, 30 g sucrose, 30 g paper towel, 1.2 mL hydrochloric acid, 300 mL water), and raised in an artificial incubator with environmental conditions of L:D = 14:10, H = 55%, T = 26.5 ° C until they matured and transferred to wet sand for pupation. The adults after eclosion were raised separately before mating, and the mid-legs were collected to extract genomic DNA using mutant verification primers (Bdorpainless - / --F / R, the specific sequence is shown in Table 2) for genotype detection and the test insects are raised separately in a small box, and the one-to-one correspondence is marked in sequence. According to the sequencing results, the mutation of the G0 target region is detected, and the 5 sequencing peak individuals are paired separately with the unmated wild type of the same age. After laying eggs, the eggs are collected in the larval feed to obtain the G1 generation, and they are raised until adults according to the conventional orange fruit fly breeding method. After the G1 generation emerges, the mid-legs of the G1 generation adults are continued to be collected, and the above method is repeated to extract the genome and PCR amplification, and the genotype of the G1 generation individuals is detected, and the heterozygous mutant individuals of the same genotype are mixed and mated to obtain homozygous bodies in the G2 generation; if there are no heterozygous mutant individuals of the same genotype, the heterozygous mutant individuals are continued to mate with the unmated wild type of the same age, and after the heterozygous mutants of the same genotype are obtained in the G2 generation, the mixed mating is continued to obtain homozygous bodies in the G3 generation and expanded and preserved.

[0100] By using CRISPR / Cas9 genome editing, the Bdorpainless gene was mutated ( Figure 4 ). The present invention injected about 200 fresh eggs, and as a result, about 76 eggs were hatched, and 63 larvae survived to adulthood. DNA was isolated from the midfoot of the injected G0 adults for genotyping, and 58.7% (37 / 63) of the G0 generation carried the Bdorpainless site mutation. In terms of genetic hybridization, the 5 G0 mutant fruit flies were reversely hybridized with wild-type individuals. After three generations of screening, we obtained a homozygous mutant with a 1bp deletion (the deletion of "A" at position 1909 in SEQ ID NO: 1) ( Figure 4 The nucleotide sequence of the homozygous mutant Bdorpainless gene is shown in SEQ ID NO:13.

[0101] Example 4

[0102] The behavior test of the mutant Bactrocera dorsalis of Example 3 was carried out as follows:

[0103] 1. Temperature sensing behavior assay

[0104] (1) Survival test: Take 4th instar larvae and place them in a clean 1.5 mL EP tube. Make a small hole with a diameter of 1 mm on the tube cap to maintain air circulation. Place the Bactrocera dorsalis in a water bath at 32°C to 40°C (with a temperature gradient of 1°C) for 2 hours, and place the control group in a water bath at 25°C for 2 hours. Immediately after the water bath treatment, measure the mortality of 4th instar larvae. If the 4th instar larvae can move when gently touched with a brush, they are considered alive.

[0105] (2) Escape behavior: The larvae were placed in a 50 μL petri dish at room temperature. The dish was then transferred to a hot plate surface set at 70°C. Care was taken to ensure that the dish was always in close contact with the hot plate. When the larvae showed obvious escape behavior, we used a fine temperature probe to measure the current temperature of the water droplet and recorded it ( Figure 5 (A).

[0106] 2. Hygrosensory behavior assay

[0107] Place the dry sand on a plate and dry it in an oven at 100°C for 3 hours. Then weigh 600 grams of sand and put it into a plastic basin filled with clean water, allowing the water to cover the soil surface. Soak for 10 minutes and then take it out and drain it naturally for about 30 minutes. Weigh it after there is no water on the surface of the sand.

[0108] Soil moisture content is usually expressed in absolute moisture content and relative moisture content:

[0109] Absolute water content of sandy soil = [wet soil weight - dry soil weight] × dry soil weight (Wds) × 100%;

[0110] Saturated water content of sand = [saturated wet soil weight - dry soil weight] × dry soil weight (Wds) × 100%;

[0111] Relative soil moisture content = absolute soil moisture content / saturated soil moisture content × 100%.

[0112] The absolute moisture content of dry soil is calculated to be 20%, and the amount of water to be added for various sandy soil moisture levels is calculated. Spraying is used to simulate the natural rainfall process, and water is evenly added to the sandy soil to make the sandy soil reach the required relative moisture content (20%, 40%, 60% or 80%).

[0113] Time to burrow into the soil: 30 mature larvae (7 days old) were placed in sandy soils of 4 different humidity levels (20%, 40%, 60%, 80%), and the time to burrow into the soil was recorded. Larvae that did not burrow into the soil for more than 5 minutes were considered to have failed to burrow into the soil and could be ignored.

[0114] Soil selection rate: 10 larvae were placed in a petri dish, and the petri dish was placed in sandy soil with different humidity (20%, 40%, 60%, 80%). Observation and recording were carried out at the same time to determine the selection of sandy soil under different humidity. Each group of experiments was repeated 5 times.

[0115] Soil pupation rate: The larvae were placed in sandy soil with humidity of 20%, 40%, 60% and 80%, and their pupation rate was recorded after 2 days. Each group of experiments was repeated 5 times.

[0116] The temperature sensing behaviors of wild-type and Bdorpainless mutant larvae were observed and compared. Figure 5(A). After 2 hours of heat stress at 32℃, 33℃ and 34℃, the mortality rate increased slightly, but the instantaneous mortality rate was no different from that of the control group. After 2 hours of heat stress at 35℃ to 40℃, the instantaneous mortality rate was significantly different from that of the 25℃ control group. As the temperature gradually increased, the instantaneous mortality rate also increased rapidly ( Figure 5 (B).

[0117] A petri dish containing the droplet and larvae was further transferred to a heating plate. The temperature at which the larvae began their characteristic noxious spiral rolling was recorded. In the experiment, we measured the escape response temperature of wild-type populations and Bdorpainless mutant larvae. The escape response temperature of Bdorpainless mutant larvae was significantly higher than that of wild-type ( Figure 5 Middle C).

[0118] In order to explore the role of Bdorpainless in humidity response, the humidity perception behavior of B. dorsalis was observed. This example observed the soil drilling time of B. dorsalis in sandy soils with different humidity, the selectivity of mature larvae to sandy soils with different humidity, and the pupation rate in sandy soils with different humidity ( Figure 6 Compared with the control group, Bdorpainless showed no significant difference in sand selectivity and drilling time at different humidity levels ( Figure 6 However, in a sandy environment with a humidity of 20% to 80%, the pupation rate of the Bdorpainless mutant larvae decreased, which was significantly different from that of the wild type ( Figure 6 (middle D).

[0119] The embodiments of the present invention are described in detail above in conjunction with the accompanying drawings, but the present invention is not limited to the above embodiments. Various changes can be made within the knowledge of ordinary technicians in the relevant technical field without departing from the purpose of the present invention. In addition, the embodiments of the present invention and the features in the embodiments can be combined with each other without conflict.

Claims

1. A Bdorpainless gene mutant, characterized in that: The Bdorpainless gene mutant is a nucleotide sequence shown in SEQ ID NO:1 in which A at position 1909 is deleted. The nucleotide sequence of the Bdorpainless gene mutant is shown in SEQ ID NO:

13.

2. Use of the Bdorpainless gene mutant according to claim 1 in any one of 1) to 4): 1) Prevent the pupation of citrus fruit fly larvae; 2) Preparation of products for inhibiting the pupation of larvae of the fruit fly; 3) Increase the escape reaction temperature of Bactrocera dorsalis; 4) Prepare a product to increase the escape reaction temperature of the citrus fruit fly.

Images