A strain of Kluyveromyces marxianus and its application in animal feed

Abstract

The present invention relates to the field of microorganisms, and discloses a strain of Kluyveromyces marxianus and its application in animal feed. The Kluyveromyces marxianus is particularly Kluyveromyces marxianus ( Kluyveromyces marxianus ) WMXk65, which is registered in the General Microbiological Center of China National Microbiological Culture Collection Committee with a registration number of CGMCC No. 29928. The purpose of the present invention is to alleviate the shortage of protein resources in my country's feed industry and provide a safe Kluyveromyces marxianus feed protein, which has a high protein content, high nutritional value, is beneficial to the growth of aquatic animals and has no negative impact on disease resistance.

Description

Technical Field

[0001] The invention belongs to the field of microorganisms, and specifically relates to a strain of Kluyveromyces marxianus and application thereof in animal feed. Background Art

[0002] The most notable nutritional characteristic of fish is its high protein demand. However, the price of fish meal continues to rise and it is heavily dependent on imports, which limits the rapid development of the aquatic industry. The development of new protein sources has become one of the important means to solve this problem. Single cell protein (SCP) is a dried cell and / or purified protein separated from microbial cells with a high protein content. It is rich in nutrients, not restricted by season, climate, land, etc., has a short growth cycle, and is gradually being developed and applied in the feed industry. Yeast has a large body size, and the protein content can reach 30% to 50% of the cell dry weight. It is rich in nucleotides and B vitamins, which is better than fish meal; among them, Kluyveromyces marxianus ( Kluyveromyces marxianus ) is a safe food-grade yeast that has been certified as safe by the European Food Safety and Health Supervision Agency and certified as a GRAS-level microorganism by the US FDA. It has also been approved as a new food ingredient by the National Health and Family Planning Commission of China. The Ministry of Agriculture and Rural Affairs has approved Kluyveromyces marxianus (CGMCC 10621) as a new feed additive and allowed its production, operation and use in the People's Republic of China, and issued a new product certificate for feed and feed additives. Kluyveromyces marxianus ) has a short growth cycle and is resistant to high temperatures. In addition, Kluyveromyces marxianus can utilize a variety of carbon sources and can use cheap substrates for protein synthesis.

[0003] Snow Lotus Mushroom, also known as Tibetan Ling Mushroom, is a wild natural yogurt fermentation bacteria. The bacteria are a complex of Kluyveromyces bacteria as the main body and other beneficial bacteria for cooperative fermentation.

[0004] A strain of Kluyveromyces marxianus ( Kluyveromyces marxianus ), in order to alleviate the current shortage of feed protein, a safe feed protein source that can replace fish meal was found. Summary of the invention

[0005] The purpose of the present invention is to alleviate the shortage of protein resources in my country's feed industry and provide a safe Kluyveromyces marxianus ( Kluyveromyces marxianus ) Feed protein.

[0006] The present invention provides a Kluyveromyces marxianus yeast, wherein the Kluyveromyces marxianus yeast is Kluyveromyces marxianus yeast ( Kluyveromyces marxianus)WMXk65, whose registration number in the General Microbiological Center of China Culture Collection Administration is CGMCC No.29928.

[0007] The Kluyveromyces marxianus yeast is separated from yogurt fermented with saussurea ovata.

[0008] The application of the Kluyveromyces marxianus in any of the following should also be within the protection scope of the present invention:

[0009] 1) Prepare animal feed that improves the weight gain rate and feed intake rate of animals;

[0010] 2) Prepare animal feed that improves the survival rate and disease resistance of animals;

[0011] 3) Improve the animal's weight gain and food intake rate;

[0012] 4) Improve the survival rate and disease resistance of animals.

[0013] The present invention provides an animal feed, wherein the animal feed contains the above-mentioned Kluyveromyces marxianus and / or a metabolite of the Kluyveromyces marxianus.

[0014] The animal feed contains the above-mentioned Kluyveromyces marxianus and / or metabolites of the Kluyveromyces marxianus, and also contains other nutrients, such as one or more of flour, soybean meal, fish meal, choline chloride, calcium dihydrogen phosphate, soybean oil, VC, bentonite, vitamins, minerals, lysine hydrochloride, arginine hydrochloride, DL-methionine, threonine, etc.

[0015] In the above, the metabolite can be obtained from the fermentation broth of the Kluyveromyces marxianus. The metabolite can be a sterile metabolite of the Kluyveromyces marxianus or a bacterial metabolite of the Kluyveromyces marxianus. The sterile metabolite of the Kluyveromyces marxianus (sterile fermentation filtrate) can be prepared specifically according to the following method: the Kluyveromyces marxianus is cultured in a liquid culture medium, and the Kluyveromyces marxianus in the liquid culture (fermentation broth) is filtered out to obtain the sterile metabolite of the Kluyveromyces marxianus. The bacterial metabolite of the Kluyveromyces marxianus can be prepared specifically according to the following method: the Kluyveromyces marxianus is cultured in a liquid fermentation medium, and the fermentation broth is collected, and the fermentation broth is the bacterial metabolite of the Kluyveromyces marxianus.

[0016] The application of the above-mentioned animal feed in any of the following should also be within the protection scope of the present invention:

[0017] 1) Improve the weight gain rate of animals;

[0018] 2) Increase the animal's feeding rate;

[0019] 3) Improve the survival rate of animals;

[0020] 4) Improve animals’ disease resistance.

[0021] The present invention provides a method for preparing animal feed, characterized in that it comprises the steps of cultivating the Kluyveromyces marxianus and adding the Kluyveromyces marxianus into the animal feed.

[0022] The present invention provides a method for breeding animals with high weight gain rate and / or food intake rate, comprising using the above-mentioned animal feed or adding the above-mentioned Kluyveromyces marxianus to the animal feed.

[0023] The present invention provides a method for breeding animals with high survival rate and / or disease resistance, comprising the steps of using the animal feed or adding the above-mentioned Kluyveromyces marxianus to the animal feed.

[0024] The above animals are aquatic animals.

[0025] Furthermore, the above-mentioned aquatic animals are fish.

[0026] Furthermore, the fish is zebrafish.

[0027] The Kluyveromyces marxianus has a high protein content and high nutritional value. It is also beneficial to the growth of aquatic animals and has no negative impact on disease resistance. Compared with the control group, there was no difference in the survival rate of each treatment group; the weight gain rate and feeding rate of the 50% replacement group of Kluyveromyces marxianus (WMXk65) were significantly higher than those of the control group, and the 75% replacement group also increased. At the same time, as the replacement ratio of Kluyveromyces marxianus (WMXk65) increased, the survival rate of zebrafish increased accordingly. The results show that Kluyveromyces marxianus is expected to become a new energy feed with great potential.

[0028] Collection Instructions

[0029] Strain name: Kluyveromyces marxianus;

[0030] Latin name: Kluyveromyces marxianus;

[0031] Strain ID: WMXk65;

[0032] Depository: General Microbiology Center, China Microbiological Culture Collection Administration;

[0033] Abbreviation of depository institution: CGMCC;

[0034] Address: No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing;

[0035] Deposit date: March 4, 2024;

[0036] The registration number of the Collection Center is: CGMCC No.29928. BRIEF DESCRIPTION OF THE DRAWINGS

[0037] Figure 1 PDA and Bengal red medium were used to screen yeast from milk fermented with Saussurea salsa.

[0038] Figure 2 Protein, fat and amino acid composition of feed fish meal, soybean meal and Kluyveromyces marxianus dry powder;

[0039] Figure 3 Experimental feed formulation for evaluation of alternative protein farming with Kluyveromyces marxianus.

[0040] Figure 4 Evaluation of growth performance of zebrafish fed with Kluyveromyces marxianus alternative protein for 6 weeks;

[0041] Figure 5 Evaluation of disease resistance of zebrafish fed with Kluyveromyces marxianus alternative protein for 6 weeks; DETAILED DESCRIPTION

[0042] The present invention is further described in detail below in conjunction with specific embodiments, and the examples provided are only for illustrating the present invention, rather than for limiting the scope of the present invention. The examples provided below can be used as a guide for further improvements by those of ordinary skill in the art, and do not constitute a limitation of the present invention in any way.

[0043] The experimental methods in the following examples, unless otherwise specified, are all conventional methods, and are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial channels.

[0044] The quantitative experiments in the following examples were performed in triplicate unless otherwise specified.

[0045] The following examples were processed using IBM SPSS statistics 26 statistical software, and the graphs were drawn using GraphPad Prism 8. The experimental results are expressed as mean ± standard error. One-way ANOVA test was used, and statistical significance was set at P <0.05.

[0046] Aeromonas cerevisiae Hm091 and Aeromonas hydrophila NJ-1 in the following examples have been recorded in: Xia R, HaoQ, Xie Y, Zhang Q, Ran C, Yang Y, Zhou W, Chu F, Zhang X, Wang Y, Zhang Z, Zhou Z. Effects of dietary saccharomyces cerevisiae on growth, intestinal and liver health, intestinal microbiota and disease resistance of channel catfish (ictalurus punctatus). Aquaculture Reports 2022;24:101157. The public can obtain them from the Feed Research Institute of the Chinese Academy of Agricultural Sciences to repeat this experiment.

[0047] Example 1 Isolation of Kluyveromyces marxianus from Yuzushi fermented milk

[0048] 1. Screening of Kluyveromyces marxianus from milk

[0049] Take an appropriate amount of snow lotus bacteria and inoculate it into pasteurized pure milk, let it stand at room temperature for 48 hours, transfer an appropriate amount of snow lotus bacteria fermented milk to YPD liquid medium, and culture it at 30℃ for 24 hours. Dilute the seed liquid and spread it on PDA solid medium, then activate the grown single colony with YPD liquid medium, and spot it on Bengal red solid medium for yeast screening, such as Figure 1 Then, 18s rDNA sequencing (universal primers NS1: GTAGTCATATGCTTGTCTC (sequence 2), NS8: TCCGCAGGTTCACCTACGGA (sequence 3)) was performed, using the extracted and screened yeast genome as a template, PCR amplification and sequencing to obtain the 18s rDNA sequence, as shown in sequence 1. After comparison with the known sequences in NCBI, K. marxianus The similarity of isolateMON-24 sequence was 100%, and finally a strain of Kluyveromyces marxianus (WMXk65) was obtained.

[0050] 2. Collection of WMXk65

[0051] Kluyveromyces marxianus strain WMXk65 was deposited in the China General Microbiological Culture Collection Center on March 4, 2024, with the deposit number CGMCC No. 29928; the deposit address is: Institute of Microbiology, Chinese Academy of Sciences, Beijing, China. Hereinafter referred to as Kluyveromyces marxianus CGMCC No. 29928 or strain WMXk65.

[0052] Example 2 Determination of protein source (fish meal, soybean meal, Kluyveromyces marxianus powder) in zebrafish feed

[0053] 1. Obtaining protein sources for zebrafish feed;

[0054] Protein sources in zebrafish feed: fish meal and soybean meal were purchased from the market; Kluyveromyces marxianus dry powder: Kluyveromyces marxianus (WMXk65) was inoculated into YPD liquid medium (50 mL / 250 mL), cultured at 30°C and 200 rpm to the late logarithmic stage, transferred to 3 L YPD liquid medium for secondary seed liquid activation, and finally transferred to a 50 L fermenter for fermentation at 30°C and 72 h; the bacteria were collected by centrifugation, dried at 70°C, crushed by a crusher, and passed through a 100-mesh sieve to obtain Kluyveromyces marxianus dry powder;

[0055] 2. Determination of crude protein in protein source by Kjeldahl method (GB / T 6432-2018);

[0056] Calculation formula: Crude protein (%) = *100

[0057] In the formula: V2 is the volume of the standard hydrochloric acid solution consumed in the titration of the substance to be tested (mL); V1 is the volume of the standard hydrochloric acid solution consumed in the titration of the blank (mL); c is the concentration of the standard hydrochloric acid solution (mol / L); m is the mass of the substance to be tested (g); V is the total volume of the digestion of the substance to be tested (mL); V' is the volume of the digestion solution used for distillation (mL); 14 is the molar mass of nitrogen (g / mol); 6.25 is the average coefficient for converting nitrogen into crude protein.

[0058] 3. Soxhlet extraction method (GB / T 6433-2006) to determine crude fat in protein sources;

[0059] Calculation formula: Crude protein (%) = (m2-m3) / m1*100

[0060] Where: m1 is the mass of the substance to be tested (g); m2 is the mass of the fat bag (substance to be tested and filter paper) after drying and removing water (g); m3 is the mass of the fat bag (substance to be tested and filter paper) after extraction, drying and removing water (g);

[0061] 4. First, pre-treat the protein source (GB / T 18246-2019, GB / T 15399-2018), and then determine the amino acid composition in the protein source using an amino acid analyzer.

[0062] The results are as follows Figure 2 As shown in the data, the crude protein and crude fat of fish meal were higher than those of Kluyveromyces marxianus (WMXk65) dry powder, while the crude protein and crude fat of soybean meal were lower than those of Kluyveromyces marxianus (WMXk65) dry powder, which provided a reference for the subsequent zebrafish feed formula design.

[0063] Example 3 Evaluation of Kluyveromyces marxianus replacing fish meal in the basic diet of zebrafish

[0064] (1) The dry powder of Kluyveromyces marxianus (WMXk65) obtained in Example 2 was used to replace 0%, 50%, and 75% of the fish meal in the basic diet of zebrafish to prepare feed. The feed formula is as follows: Figure 3 shown.

[0065] (2) Healthy 2-month-old zebrafish of the same size were selected as the test subjects and randomly divided into 3 test groups, with 6 parallels in each group, 15 fish in each parallel, and 90 fish in each group. After 6 weeks of near-full feeding, the growth performance of zebrafish was evaluated:

[0066] initial weight (IBW, g);

[0067] final weight (FBW, g);

[0068] Weight gain rate (WG, %) = 100 × (final average weight - initial average weight) / initial average weight;

[0069] Feed efficiency (FCR) = (final total fish weight + total weight of dead fish - initial total weight) / food intake;

[0070] Feeding rate % = 100 × average daily food intake / average body weight;

[0071] Survival rate (SR, %) = 100 × number of fish at the end of the experiment / number of fish at the beginning of the experiment.

[0072] The results are as follows Figure 4 shown.

[0073] (3) Zebrafish cultured for 6 weeks were fasted for 24 hours and challenged with Aeromonas virens Hm091 and Aeromonas hydrophila NJ-1. Aeromonas virens Hm091 and Aeromonas hydrophila NJ-1 were streaked on LB plates and cultured at 37°C for 24 hours. The colonies were picked and added to 60 ml LB liquid culture medium (250 mL conical flask), and then cultured in a shaker at 37°C and 200 rpm for 18 hours. The absorbance OD600 was measured. The Hm091 and NJ-1 bacterial solutions were added to the challenge tank at a final concentration of 2×10 7 CFU / ml, 3 replicates per treatment group, 10 fish per replicate. Observe the cumulative mortality of fish within 72 hours and remove dead fish in time. Finally, calculate the survival rate. No feeding was performed during the challenge period to evaluate the disease resistance of zebrafish:

[0074] Survival rate (%) = 100 × number of surviving fish at the time point of the challenge test / number of fish at the start of the challenge test;

[0075] The results are as follows Figure 5 shown.

[0076] The results are as follows Figure 4 As shown in the figure, there was no difference in the survival rate of each treatment group compared with the control group; the weight gain rate and feeding rate of the 50% replacement group of Kluyveromyces marxianus (WMXk65) were significantly higher than those of the control group, and the 75% replacement group also increased; Figure 5 As shown in the figure, after 6 weeks of dual-bacteria combined challenge and feeding, the survival rate of zebrafish in each treatment group was no different from that in the control group, but as the replacement ratio of Kluyveromyces marxianus (WMXk65) increased, the survival rate of zebrafish increased accordingly. This breeding evaluation result proves that replacing 50% of the fish meal protein in the zebrafish basal diet with Kluyveromyces marxianus (WMXk65) isolated from milk has a positive effect on the growth of zebrafish, and will not have a negative impact on the survival rate and disease resistance of zebrafish. It can effectively replace fish meal in feed and be used as a feed protein source.

[0077] The experimental subject of the above embodiment of the present invention is zebrafish, which is a typical freshwater fish of the Cyprinidae family. Its physiology, development and metabolism are highly similar to those of mammals. The National Institutes of Health (NIH) of the United States lists zebrafish as the third largest vertebrate model organism. Zebrafish is currently the only vertebrate suitable for high-throughput drug screening. It is small in size, has a short development cycle, a short experimental cycle, low cost, in vitro fertilization, transparency, a high number of eggs laid per time, and a small amount of experimental drugs. Therefore, the zebrafish used in this experiment can be used as a typical representative of other fish.

[0078] In addition, fish meal is a nutritionally balanced, easily digestible and palatable feed ingredient that promotes growth and improves health during important growth stages of fish. It is the highest quality protein source in the aquaculture industry [1]. Therefore, fish meal is the preferred protein source in farmed fish feed and has been widely used in aquatic feed. According to estimates by the Marine Ingredients Organization, about 86% of fish meal is used in aquaculture, 9% is used in pig farming, 4% is used for other purposes (mainly pet food), and 1% is used in poultry farming. Among them, in current commercial formulas, the amount of animal protein source added to herbivorous fish feed is about 20%, the amount of fish meal added to omnivorous fish feed is about 20%, and the amount of fish meal added to carnivorous fish feed is more than 30%. The control group of this experiment used fish meal as the protein source of the zebrafish basal diet, and the experimental group gradiently replaced the fish meal protein in the zebrafish basal diet. The results showed that the replacement of fish meal protein had a positive effect on the growth performance and disease resistance of zebrafish. Therefore, the Kluyveromyces marxianus WMXk65 in this experiment can provide a reference for the use of non-grain protein sources in aquaculture, and the use of WMXk65 is not limited to the formula designed in this experiment. It can be used as a feed egg source in the feed of farmed fish, not just zebrafish. Other applications that can meet its use conditions should also be within the scope of protection of the present invention.

[0079] The present invention has been described in detail above. It will be apparent to those skilled in the art that the present invention may be implemented in a wide range under equivalent parameters, concentrations and conditions without departing from the spirit and scope of the present invention and without the need for unnecessary experimentation. Although the present invention provides specific embodiments, it should be understood that further improvements may be made to the present invention. In short, according to the principles of the present invention, this application intends to include any changes, uses or improvements to the present invention, including changes made by conventional techniques known in the art that depart from the scope disclosed in this application. Applications of some of the basic features may be made within the scope of the following appended claims.

Claims

1. Kluyveromyces marxianus, characterized in that: The Kluyveromyces marxianus is Kluyveromyces marxianus ( Kluyveromyces marxianus )WMXk65, whose registration number in the General Microbiological Center of China Culture Collection Administration is CGMCC No.29928.

2. Use of the Kluyveromyces marxianus according to claim 1 in any of the following: 1) Prepare animal feed that improves the weight gain rate and feed intake rate of animals; 2) Preparation of animal feed with improved disease resistance; 3) Improve the animal's weight gain and food intake rate; The disease resistance refers to the ability to resist Aeromonas veronii Hm091 and Aeromonas hydrophila NJ-1, and the animal is a fish.

3. An animal feed, characterized in that: The animal feed contains the Kluyveromyces marxianus according to claim 1.

4. Use of the animal feed according to claim 3 in any of the following: 1) Improve the weight gain rate of animals; 2) Increase the animal's feeding rate; The animal is a fish.

5. A method for preparing the animal feed according to claim 3, characterized in that: The method comprises the steps of cultivating the Kluyveromyces marxianus according to claim 1 and adding the Kluyveromyces marxianus to animal feed, wherein the animal is a fish.

6. A method for breeding animals with high weight gain rate and / or food intake rate, characterized in that: The Kluyveromyces marxianus according to claim 1 is added to animal feed, wherein the animal is a fish.

Images