A molecular marker associated with the dirowy alternating leaf arrangement trait of soybean and its application

Abstract

This invention relates to the field of soybean molecular breeding technology, and in particular to a molecular marker associated with the distichous (diragian leaf arrangement) plant architecture trait of soybean and its application. This invention identified a mutant from a soybean mutant library. From a top-down perspective, this mutant exhibits one leaf per node, with trifoliate leaves arranged in a straight line ("I"), meaning all trifoliate leaves are arranged in a planar pattern. This reduces the space occupied by a single plant and decreases plant spacing, which is beneficial for increasing density and yield. This mutant has a non-synonymous mutation (C to T) at base 121 of the Glyma.03g232100 gene, leading to the development of the CAPS molecular marker. The CAPS molecular marker of this invention can identify wild-type and mutant genotypes, contributing to the improvement of soybean plant architecture and density-tolerant breeding. Utilizing the SNP loci identified in this invention and the developed CAPS molecular marker can help improve soybean plant architecture and density-tolerant breeding, demonstrating significant breeding application potential.

Description

Technical Field

[0001] This invention relates to the field of soybean molecular breeding technology, and in particular to a molecular marker related to the dirowy alternating leaf arrangement trait of soybean and its application. Background Technology

[0002] Plant architecture is a crucial factor influencing soybean yield. A suitable plant architecture allows soybean populations to fully utilize light energy, thereby increasing yield. Therefore, there is an urgent need for new soybean germplasm with compact plant structures, high density tolerance, lodging resistance, and high photosynthetic efficiency. Leaf arrangement, as an important indicator of plant architecture, plays a vital role in constructing an ideal soybean plant architecture. Mutants are key resources for studying specific plant architectures. Scientists have made significant progress in the study of mutants in model crops through identification, genetic analysis, and gene mining. The abphyl1 mutant found in maize is a typical example. Its expression is induced by endogenous cytokinin, and under the influence of cytokinin, its spatial expression location is rapidly altered. This change leads to a transformation in the arrangement of leaf primordia, changing from an alternate phyllotaxis to an opposite phyllotaxis, forming a regular phyllotaxis pattern. In the pin1 mutant of tomato and Arabidopsis thaliana, auxin accumulation inhibits leaf primordia differentiation, leading to a lack of leaf primordia in the meristem. This phenomenon hinders leaf formation and ultimately results in altered phyllotaxis.

[0003] Some studies have shown a close relationship between phyllotaxis formation and alterations and plant hormone signaling pathways. For example, the changes in phyllotaxis in the aforementioned mutants of maize, Arabidopsis thaliana, and tomato were caused by the obstruction of cytokinin and auxin synthesis or transport pathways, respectively. Besides individual plant hormones controlling phyllotaxis formation and development, plant hormones also synergistically regulate phyllotaxis formation and development. The stability and variation of the CTK / IAA threshold in maize growing points are key to regulating phyllotaxis stability and variation. The synchronous increase of three types of endogenous cytokinins may indicate that phyllotaxis mutations are related to variations in upstream regulatory genes of cytokinin synthesis genes. SPY in plants both inhibits the gibberellin signaling pathway and promotes the cytokinin signaling pathway, forming a complex hormone signaling regulatory network. The overlapping expression of ABPH1 and PIN1 at the leaf primordium initiation site suggests that cytokinin and auxin signaling interact and play specific roles in phyllotaxis. In fact, auxin mainly negatively regulates cytokinin signaling through a rapid and direct mechanism, namely, inhibiting cytokinin biosynthesis. This inhibitory effect is crucial in plants, balancing and coordinating signaling between auxin and cytokinin to ensure normal growth and development. Studies of the interactions between these hormones reveal the complexity of phyllotaxis. This process is not determined by a single mechanism, but rather by the combined action of multiple mechanisms. These mechanisms may include the interaction between auxin and cytokinin, the regulation of gene expression, and the influence of environmental factors.

[0004] Soybean belongs to the alternate phyllotaxis type, which can be further subdivided into alternating alternate phyllotaxis and distichous alternate phyllotaxis types. However, there are very few reports on soybean phyllotaxis, so the study of the spatial structure of soybean phyllotaxis is of great significance. Summary of the Invention

[0005] To address the aforementioned problems, this invention provides a molecular marker associated with the dirowyal foliage plant type trait of soybean and its application. This invention identifies a dirowyal foliage mutant from an EMS-induced mutagenesis population. el1 The mutant Glyma.03g232100 A non-synonymous mutation occurs at position 121 of the ATG gene, changing from C to T. Based on this, the present invention develops the CAPS molecular marker. The CAPS molecular marker of the present invention can identify wild-type and mutant genotypes, which is helpful for improving soybean plant architecture and dense-density breeding.

[0006] To achieve the above objectives, the present invention provides the following technical solution:

[0007] This invention provides the application of reagents for detecting SNP sites in identifying the dirowy-leaved plant type of soybean, characterized in that the SNP sites are located in the soybean gene. Glyma.03g232100The 121st base has a polymorphism of C or T, and is T in the soybean dirowy alternate leaf type; the soybean gene Glyma.03g232100 The nucleotide sequence is shown in SEQ ID NO.3.

[0008] Preferably, the soybean plant type with dirowyal leaf arrangement is characterized by the soybean plant having three compound leaves arranged in a straight line.

[0009] This invention provides a CAPS molecular marker associated with the dirowyal foliage plant type trait of soybean, characterized in that the nucleotide sequence of the CAPS molecular marker in the dirowyal foliage plant type of soybean is shown in SEQ ID NO.4.

[0010] This invention provides a soybean gene Glyma.03g232100 The gene mutant, the nucleotide sequence of which is shown in SEQ ID NO.5.

[0011] This invention provides a primer pair for detecting the CAPS molecular marker described in the above technical solution, consisting of a forward primer and a reverse primer; the nucleotide sequence of the forward primer is shown in SEQ ID NO.1, and the nucleotide sequence of the reverse primer is shown in SEQ ID NO.2.

[0012] This invention provides a kit for identifying the dirowy-leaved plant type of soybean, the kit comprising the primer pair and HinfI restriction endonuclease described in the above technical solution.

[0013] This invention provides the application of the CAPS molecular marker, gene mutant, primer pair, or kit described in the above-mentioned technical solutions in identifying the dirowy-leaved plant type of soybean and / or the dense-density-tolerant plant type of soybean in breeding.

[0014] Preferably, the soybean plant type with dirowyal leaf arrangement is characterized by the soybean plant having three compound leaves arranged in a straight line.

[0015] This invention provides a method for identifying the dirowy alternating phyllotype of soybean plants, comprising the following steps:

[0016] Using the genomic DNA of the soybean plant to be identified as a template, PCR amplification was performed using the primer pairs described in the above technical solution to obtain the amplification product;

[0017] The amplification product was digested with HinfI restriction endonuclease to obtain the digested product;

[0018] When the enzyme digestion product is two electrophoretic bands, the plant type of the soybean to be identified is a diarctic alternate leaf arrangement plant type.

[0019] This invention provides the application of the method described in the above technical solution in the breeding of soybean varieties tolerant to high plant density.

[0020] Beneficial effects:

[0021] This invention identified a mutant from a soybean mutant library. From a top-down perspective, this mutant exhibits one leaf per node, with the trifoliate leaves arranged in a straight line, meaning all trifoliate leaves are planar. This reduces the space occupied by a single plant and decreases plant spacing, which is beneficial for increasing density and yield. This mutant was named... el1 The mutant Glyma.03g232100 A non-synonymous mutation from C to T occurs at base position 121 of the gene, leading to the development of the CAPS molecular marker. The CAPS molecular marker of this invention can identify wild-type and mutant genotypes, which is helpful for improving soybean plant architecture and density-tolerant breeding.

[0022] This invention utilizes el1 The yield performance of the hybrid offspring of the mutant and the conventional variety ZH13 at plant spacings of 13cm, 9.5cm, and 6.5cm showed [specific characteristics]. el1 Recombinant inbred lines with mutant phenotypes exhibited significant yield advantages. Utilizing the SNP sites of the mutant phenotype and the developed CAPS molecular markers of this invention can help improve soybean plant architecture and density tolerance breeding, demonstrating significant potential for breeding applications. Attached Figure Description

[0023] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the accompanying drawings used in the embodiments will be briefly described below.

[0024] Figure 1 for el1 Phenotypic analysis results of mutants; in the figure, a represents the wild-type plant phenotype; b represents the mutant phenotype. el1 Plant phenotype, scale bar: 10cm;

[0025] Figure 2 for Glyma.03g232100 Schematic diagram of gene structural variation (a) and CAPS molecular marker development (b); in the figure, Wild type represents wild type, Mutant represents wild type. el1 Mutant; M stands for StarMarker D2000 Marker. el1 for el1 The mutant, ZH13, is the wild-type ZH13. el1 like consists of 5 homozygous groups. el1 The mutant inbred lines, ZH13 like, consist of 5 homozygous wild-type ZH13 lines;

[0026] Figure 3 for el1 Results of single-plant yield in mutant hybrid offspring under high-density conditions. Detailed Implementation

[0027] This invention provides the application of reagents for detecting SNP sites in identifying the dirowy-leaved plant type of soybean, wherein the SNP sites are located in the soybean gene. Glyma.03g232100 The 121st base has a polymorphism of C or T, and is T in the soybean dirowy alternate leaf type; the soybean gene Glyma.03g232100 The nucleotide sequence is shown in SEQ ID NO.3, as follows:

[0028] el1 The mutant is Glyma.03g232100 The mutation is caused by a non-synonymous C-to-T mutation at the 121st base of the ATG gene, which results in the 42nd amino acid changing from proline to serine.

[0029] This invention provides a CAPS molecular marker associated with the dirowyline alternate foliage plant type trait of soybean. The nucleotide sequence of the CAPS molecular marker in the dirowyline alternate foliage plant type of soybean is shown in SEQ ID NO.4, and is as follows:

[0030] 5'-TTAAGTGAGTTTTTCCTCAATGGCATTGAAGGATATAAAACAAGAGTGGAAGGGGCAACTTCTGTTAATATTGTTATAGTATTTATTTCTTGTCATCGTAATTTTTCTGCACTTGTTGCAGCTGCA GTTGCAGGCTTTGCACCTTCCTCTTTCTCTCTCTCTCTCTCTCTCTCTCTCTCGGGACAAGAGAGCAGAATAATGGAGCTCCAAACCCGAACAATTATGGCGTAACCGAAAACCCAGACACTCCC CTCTTCGAAGACATCGACAGCACCTGCTCCACTCCCTACGTCAGCGCCCCTTCCAGTCCCGGCCGGGAATCCATCTCCGCCGCCGGAGCCGGCTTCTTCTACAGTGCTCCTGCCAGCCCAATGCACTTCACTATATCCGCCGCTTCCACTTACTCACACTCACCCTCTTGGTCTTCCTTGGAAAAAAACTCTTGTTGCGATTTTGAGTTCTCGGCCCGGTTCGGTTCGTCCGGGTTGACTGGTTCGGGTTCGATGA-3'. In this invention, the preferred soybean plant type with dirowial alternate foliage is a trifoliate compound leaf that forms a straight line. The CAPS molecular markers provided in this invention can identify the dirowial alternate foliage plant type trait in soybeans, and the soybean varieties include the main cultivated soybean varieties.

[0031] This invention provides a soybean gene Glyma.03g232100 The gene mutant, the nucleotide sequence of which is shown in SEQ ID NO.5, is as follows:

[0032]

[0033] This invention provides a primer pair for detecting the CAPS molecular marker described in the above-mentioned technical solution, consisting of a forward primer and a reverse primer; the nucleotide sequence of the forward primer is shown in SEQ ID NO.1, and the nucleotide sequence of the reverse primer is shown in SEQ ID NO.2. The primer pair provided by this invention can specifically amplify the CAPS molecular marker and wild-type sequence described in the above-mentioned technical solution, and the dirowy-leaved plant type trait of soybean can be identified based on the amplification results.

[0034] This invention provides a kit for identifying the dirowyline phyllotype of soybean. The kit includes the primer pairs and HinfI restriction endonuclease described in the above-described technical solution. The primer pairs in the kit can specifically amplify the CAPS molecular marker and wild-type sequence described in the above-described technical solution. The CAPS molecular marker can be digested by the HinfI restriction endonuclease in the kit, while the wild-type sequence will not be digested. This characteristic allows for rapid and accurate identification of the dirowyline phyllotype trait in soybean.

[0035] Based on the above advantages, this invention provides the application of the CAPS molecular marker, the gene mutant, the primer pair, or the kit described in the above technical solutions in identifying the distichous alternate foliage plant type and / or the soybean dense-density tolerant plant type in breeding. In this invention, the preferred distichous alternate foliage plant type is a soybean plant with trifoliate leaves arranged in a straight line.

[0036] This invention provides a method for identifying the dirowy alternating phyllotype of soybean plants, comprising the following steps:

[0037] Using the genomic DNA of the soybean plant to be identified as a template, PCR amplification was performed using the primer pairs described in the above technical solution to obtain the amplification product;

[0038] The amplification product was digested with HinfI restriction endonuclease to obtain the digested product;

[0039] When the enzyme digestion product produces two electrophoretic bands, the soybean plant type to be identified is a distichous alternate phyllotaxis type. In this invention, the preferred distichous alternate phyllotaxis type of soybean is a soybean plant with trifoliate leaves arranged in a straight line.

[0040] The method of this invention can identify wild-type and mutant genotypes. This invention is based on… el1By designing specific primers for the mutated gene locus, amplification results and electrophoretic analysis revealed that the mutant genotype could be cleaved by the HinfI restriction enzyme, showing two bands of 323 bp and 189 bp; the wild-type genotype was not cleaved by the restriction enzyme, showing a single 512 bp band. This demonstrates that the CAPS molecular marker and method provided by this invention can identify wild-type and mutant genotypes and can be used for molecular identification aids in molecular breeding.

[0041] Based on the above advantages, this invention provides the application of the method described in the above technical solution in the cultivation of soybean varieties tolerant to dense plant types. In this invention, the dense-plant soybean is preferably one in which, when viewed from a top-down perspective, each node of the plant grows one leaf, and the trifoliate compound leaves are arranged in a straight line, i.e., all trifoliate compound leaves are arranged in a planar manner.

[0042] The plant spacing of the soybean with the dirowyaltic alternate leaf arrangement described in this invention is preferably less than 9.5 cm, and more preferably 6.5-9.5 cm. In this invention, the invention utilizes... el1 The yield performance of the hybrid offspring of the mutant and the conventional variety ZH13 at plant spacings of 13cm, 9.5cm, and 6.5cm showed [specific characteristics]. el1 Recombinant inbred lines with mutant phenotypes exhibited a significant yield advantage. This invention... el1 Its utilization helps improve soybean plant architecture and density-tolerant breeding, and has significant potential for breeding applications.

[0043] To further illustrate the present invention, the following detailed description, in conjunction with the accompanying drawings and embodiments, describes a molecular marker related to the dirowyal leaf arrangement trait of soybean and its application, but these descriptions should not be construed as limiting the scope of protection of the present invention.

[0044] Example 1 el1 Identification and phenotypic analysis of mutants

[0045] A specific mutant strain was screened by EMS mutagenesis using Zhongpin 661 as the recipient material. el1 The mutant is described in the literature [Xu Weijia, Lu Jin, Gao Huihui, et al. Preliminary mapping of genes for dirowyaltic alternate phyllotaxis in cultivated soybean [J]. Soybean Science, 2021. DOI:10.11861 / j.issn.1000-9841.2021.04.0457.]. el1 The mutant was named Wanzhonghuang 601 in the literature. Viewed from above, each node of the plant grows one leaf, and the trifoliate leaves are arranged in a straight line, meaning all trifoliate leaves are arranged in a planar manner. Figure 1 (b) in the text, while WT is a cross-shaped pattern, meaning that the three compound leaves are arranged alternately at equal intervals. Figure 1 (a) in the text. Furthermore, due to the reduction in the space occupied by individuals, el1The mutant may be more tolerant of dense planting than the ordinary soybean population, and is a potential ideal plant type for increasing soybean yield through dense planting.

[0046] Example 2 Wild type and el1 CAPS molecular marker design for mutants

[0047] Wild-type Zhonghuang 13 (ZH13) and... were extracted using the CTAB method. el1 The genomic DNA of the mutant, after passing electrophoresis quality checks, was used for subsequent PCR analysis. According to... el1 For the mutated gene site, specific primers were designed to amplify a 512 bp sequence. The primer sequences are as follows:

[0048] el1-F: 5'-TTAAGTGAGTTTTTCCTCAATGGCA-3', SEQ ID NO.1;

[0049] el1-R: 5'-TCATCGAACCCGAACCAGTC-3', SEQ ID NO.2;

[0050] Using PCR amplification technology, specific primers were used to amplify wild-type ZH13 and... cp1 The mutant was detected using a PCR amplification system consisting of 12.5 μL of 2×Taq Master Mix, 1.0 μL each of forward and reverse primers, 2.0 μL of genomic DNA, and 8.5 μL of ddH2O. The PCR amplification program was as follows: 95℃ pre-denaturation for 5 minutes; 95℃ denaturation for 30 seconds, 62℃ annealing for 30 seconds, 72℃ extension for 10 seconds, 36 cycles (with a 0.2℃ decrease per cycle); 72℃ final extension for 5 minutes; and storage at 16℃ for 2 hours. After the PCR reaction, 1.2% agarose gel electrophoresis was used for detection. The product size was consistent with the theoretical fragment size, the product specificity was high, and there were no impurities. The PCR product was sent to a biosequencing company for sequencing. The sequencing results were analyzed using SeqMan software to identify the mutation sites. The results showed... el1 The mutant site is a T base, while the wild-type ZH13 has a C base at the corresponding site. Figure 2 (a) in the middle.

[0051] This invention further successfully developed CAPS markers using variant sites. Analysis of individual plants and phenotypes in a recombinant inbred line population was conducted, investigating a total of 219 recombinant inbred lines, including 155 wild-type phenotypes and 64 mutant phenotypes. The mutant phenotype could be digested with HinfI restriction enzyme, showing two bands of 323 bp and 189 bp; the wild-type material was not digested with restriction enzyme, showing a single 512 bp band. Figure 2(b) In the 155 wild-type recombinant inbred lines, 147 genotypes and phenotypes corresponded, with a concordance rate of 94.8%; in the 64 mutant phenotype recombinant inbred lines, 60 lines had corresponding genotypes and phenotypes, with a concordance rate of 93.8%. Overall, the accuracy rate of marker-assisted phenotype identification reached over 93%, indicating that the CAPS marker of this invention can effectively identify the genotype of dense-planting, high-yielding plant materials and can be used for molecular identification aided by molecular breeding.

[0052] Example 3 el1 Breeding applications of mutants

[0053] For evaluation el1 The application of mutants in high-density breeding, combining wild-type ZH13 with... el1 The mutants were planted at densities of 13cm, 9.5cm, and 6.5cm, and the results were as follows: Figure 3 As shown in Table 1, it indicates that... el1 Recombinant inbred lines with mutant phenotypes exhibited a significant yield advantage. This invention... el1 Its utilization helps improve soybean plant architecture and density-tolerant breeding, and has significant potential for breeding applications.

[0054] Table 1 el1 Trait results of mutant hybrid offspring under high-density conditions

[0055]

[0056] Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, and not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.

Claims

1. The application of a reagent for detecting SNP sites in identifying the diarctic alternate phyllotaxis plant type of soybean, characterized in that... The SNP site is located at the 121st base after the ATG in the soybean gene Glyma.03g232100, with a polymorphism of C or T, and T in the soybean dirowy alternate leaf type; the reference genome for the soybean gene Glyma.03g232100 is Zhonghuang 13; the nucleotide sequence of the soybean gene Glyma.03g232100 with the 121st base after the ATG being T is shown in SEQ ID NO.

5.

2. The application according to claim 1, characterized in that, The soybean plant type with dirowy alternate leaf arrangement is characterized by the trifoliate compound leaves of the soybean plant arranged in a straight line.

3. A mutant of the soybean gene Glyma.03g232100, characterized in that, The nucleotide sequence of the gene mutant is shown in SEQ ID NO.

5.

4. A kit for identifying the distichous alternate phyllotaxis plant type of soybean, characterized in that, The kit contains primer pairs and HinfI restriction endonuclease; the primer pairs consist of a forward primer and a reverse primer; the nucleotide sequence of the forward primer is shown in SEQ ID NO.1, and the nucleotide sequence of the reverse primer is shown in SEQ ID NO.

2.

5. The application of the gene mutant of claim 3 or the kit of claim 4 in identifying the soybean dirowy alternate leaf type and / or the soybean dense-density tolerant type in breeding.

6. The application according to claim 5, characterized in that, The soybean plant type with dirowy alternate leaf arrangement is characterized by the trifoliate compound leaves of the soybean plant arranged in a straight line.

7. A method for identifying the distichous alternate phyllotaxis plant type of soybean, characterized in that, Includes the following steps: Using the genomic DNA of the soybean plant to be identified as a template, PCR amplification was performed using the primer pair in the kit described in claim 4 to obtain the amplification product; The amplification product was digested with HinfI restriction endonuclease to obtain the digested product; When the enzyme digestion product is two electrophoretic bands, the plant type of the soybean to be identified is a diarctic alternate leaf arrangement plant type.

8. The application of the method of claim 7 in the breeding of soybean varieties tolerant to high plant density.

Images