Protein gmzg2 for regulating soybean plant type and improving yield and its coding gene and application
By knocking out the GmZG2 gene in soybeans using gene editing technology and inserting nucleotide mutations using the CRISPR/Cas9 system to change the coding sequence of the protein GmZG2, the problem of low soybean yield was solved, and soybean plant type was improved and yield increased.
Patent Information
- Application Number
- CN202410880441.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-07-02
- Publication Date
- 2026-04-28
- Estimated Expiration
- 2044-07-02
AI Technical Summary
Soybean yields are low, and existing technologies are insufficient to effectively regulate plant structure to increase yields.
By knocking out or regulating the expression of the GmZG2 gene in soybeans using gene editing technology, and inserting nucleotide mutations using the CRISPR/Cas9 system, the coding sequence of the protein GmZG2 can be altered, thereby regulating plant architecture and yield.
Rapidly improve soybean plant architecture, increase yield per unit area, and achieve an increase in soybean production.
Smart Images

Figure SMS_1 
Figure HDA0004924340520000011 
Figure HDA0004924340520000012
Abstract
Description
Technical Field
[0001] This invention belongs to the field of plant breeding and relates to the protein GmZG2, which regulates soybean plant architecture and increases yield, its encoding gene, and its applications. Background Technology
[0002] Soybeans, as an important dual-purpose crop for grain, oil, and feed, play a crucial role in ensuring my country's food security and agricultural trade. my country's soybean yield is relatively low, making increasing soybean yield per unit area a critical production issue that urgently needs to be addressed and a breeding technology problem that requires breakthroughs. Crop plant architecture plays a decisive role in the morphological development of individual plants and the entire crop population, and is a significant factor influencing plant yield, crop production level, and economic benefits. Crop plant architecture includes plant height, branching (tillering), leaf shape, and ear type (pod-setting habit). Improving soybean plant architecture has significant practical value for increasing soybean yield. Summary of the Invention
[0003] The technical problem to be solved by this invention is how to regulate plant shape and increase plant yield.
[0004] To address the problems existing in the prior art, the present invention provides a protein.
[0005] The protein provided by this invention may be any of the following:
[0006] A1) A protein with the amino acid sequence shown in SEQ ID No. 3;
[0007] A2) Proteins obtained by substituting and / or deleting and / or adding amino acid residues of the protein in A1) that have more than 75% identity with the protein shown in A1) and that regulate plant architecture and yield; for example, those skilled in the art can, based on the amino acid sequence shown in SEQ ID No. 3 and conventional techniques such as the conserved substitution of amino acids, obtain protein mutants with the same function as the amino acid sequence shown in SEQ ID No. 3 by substituting, deleting and / or adding one or more amino acids without affecting their activity.
[0008] A3) is a fusion protein obtained by attaching a protein tag to the N-terminus and / or C-terminus of A1) or A2).
[0009] The protein described in A1 above is named GmZG2.
[0010] To facilitate the purification or detection of the protein in A1), a tag protein can be attached to the amino or carboxyl terminus of the protein, which consists of the amino acid sequence of SEQ ID No. 3 in the sequence listing.
[0011] The proteins mentioned above can be synthesized artificially, or their encoding genes can be synthesized first and then expressed biologically.
[0012] The tagged proteins include, but are not limited to: GST (glutathione thiotransferase) tagged protein, His6 tagged protein (His-tag), MBP (maltose-binding protein) tagged protein, Flag tagged protein, SUMO tagged protein, HA tagged protein, Myc tagged protein, eGFP (enhanced green fluorescent protein), eCFP (enhanced cyan fluorescent protein), eYFP (enhanced yellow-green fluorescent protein), mCherry (monomer red fluorescent protein), or AviTag tagged protein.
[0013] Those skilled in the art can readily mutate the nucleotide sequence encoding the protein GmZG2 of this invention using known methods, such as directed evolution or point mutation. Any artificially modified nucleotides that possess 75% or more of the nucleotide sequence identity with the protein GmZG2 isolated in this invention, provided they encode and function as protein GmZG2, are derived from and equivalent to the nucleotide sequence of this invention.
[0014] The aforementioned 75% or higher degree of identity can be 80%, 85%, 90%, or 95% or higher degree of identity.
[0015] In this article, identity refers to the similarity of amino acid or nucleotide sequences. The identity of amino acid or nucleotide sequences can be determined using homology search sites on the Internet, such as the BLAST page on the NCBI homepage. For example, in Advanced BLAST 2.1, using blastp as the procedure, setting the Expect value to 10, setting all filters to OFF, using BLOSUM62 as the matrix, setting the Gap existence cost, Per residue gap cost, and Lambda ratio to 11, 1, and 0.85 (default values) respectively, and performing a search to calculate the identity of a pair of amino acid sequences or nucleotide sequences, then the identity value (%) can be obtained.
[0016] In this document, the 80% or more identity can be at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity.
[0017] In this document, the 90% or more identity can be at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity.
[0018] The protein mentioned above is derived from soybean (Glycine max (L.) Merr.).
[0019] The present invention also provides biomaterials related to the above-mentioned proteins, said biomaterials may be any of the following:
[0020] B1) Nucleic acid molecules that encode the proteins described above;
[0021] B2) An expression cassette containing the nucleic acid molecule described in B1);
[0022] B3) A recombinant vector containing the nucleic acid molecule described in B1), or a recombinant vector containing the expression cassette described in B2);
[0023] B4) Recombinant microorganisms containing the nucleic acid molecules described in B1), or recombinant microorganisms containing the expression cassette described in B2), or recombinant microorganisms containing the recombinant vector described in B3);
[0024] B5) A transgenic plant cell line containing the nucleic acid molecule described in B1), or a transgenic plant cell line containing the expression cassette described in B2);
[0025] B6) Transgenic plant tissue containing the nucleic acid molecules described in B1), or transgenic plant tissue containing the expression cassette described in B2);
[0026] B7) Transgenic plant organs containing the nucleic acid molecules described in B1), or transgenic plant organs containing the expression cassette described in B2);
[0027] C1) Nucleic acid molecules that inhibit, reduce, or silence the expression of the genes encoding the proteins described above;
[0028] C2) expresses the gene encoding the nucleic acid molecule described in C1);
[0029] C3) contains an expression cassette encoding the gene described in C2);
[0030] C4) A recombinant vector containing the encoding gene described in C2), or a recombinant vector containing the expression cassette described in C3);
[0031] C5) A recombinant microorganism containing the encoding gene described in C2), or a recombinant microorganism containing the expression cassette described in C3), or a recombinant microorganism containing the recombinant vector described in C4);
[0032] C6) A transgenic plant cell line containing the encoding gene described in C2), or a transgenic plant cell line containing the expression cassette described in C3), or a transgenic plant cell line containing the recombinant vector described in C4);
[0033] C7) Transgenic plant tissue containing the encoding gene described in C2), or transgenic plant tissue containing the expression cassette described in C3), or transgenic plant tissue containing the recombinant vector described in C4);
[0034] C8) A transgenic plant organ containing the encoding gene described in C2), or a transgenic plant organ containing the expression cassette described in C3), or a transgenic plant organ containing the recombinant vector described in C4).
[0035] In the above-mentioned biological materials, the nucleic acid molecule described in B1) may be a gene as shown in E1) or E2) below:
[0036] E1) The coding sequence is the cDNA molecule or DNA molecule of SEQ ID No. 2;
[0037] E2) The nucleotide is the cDNA molecule or DNA molecule of SEQ ID No. 1.
[0038] The DNA molecule shown in SEQ ID No. 2 (the GmZG2 gene that regulates plant architecture and yield traits) encodes the protein GmZG2, whose amino acid sequence is the same as that in SEQ ID No. 3.
[0039] The nucleotide sequence shown in SEQ ID No. 2 is the nucleotide sequence of the gene encoding protein GmZG2 (CDS).
[0040] The GmZG2 gene described in this invention can be any nucleotide sequence capable of encoding the protein GmZG2. Considering codon degeneracy and the codon preferences of different species, those skilled in the art can use codons suitable for expression in specific species as needed.
[0041] B1) The nucleic acid molecule may also include a nucleic acid molecule obtained by codon preference modification based on the nucleotide sequence shown in SEQ ID No. 2.
[0042] B1) The nucleic acid molecule may also include nucleic acid molecules that have a nucleotide sequence identity of more than 95% with the nucleotide sequence shown in SEQ ID No. 2 and originate from the same species.
[0043] The nucleic acid molecules mentioned in this article can be DNA, such as cDNA, genomic DNA, or recombinant DNA; the nucleic acid molecules can also be RNA, such as gRNA, mRNA, siRNA, shRNA, sgRNA, miRNA, or antisense RNA.
[0044] The vectors described herein are well-known to those skilled in the art and include, but are not limited to: plasmids, bacteriophages (such as λ phage or M13 filamentous phage), granules (i.e., Cosmids), Ti plasmids, or viral vectors. Specifically, it may be the vector cas9 / gRNA.
[0045] Recombinant expression vectors containing the GmZG2 gene can be constructed using existing plant expression vectors. These plant expression vectors include, but are not limited to, binary Agrobacterium vectors and vectors suitable for plant microbombardment. The plant expression vectors may also contain the 3' untranslated region of the exogenous gene, i.e., containing a polyadenylate signal and any other DNA fragment involved in mRNA processing or gene expression. The polyadenylate signal can guide the addition of polyadenylate to the 3' end of the mRNA precursor; similar functions exist for the untranslated regions transcribed at the 3' end of genes including, but not limited to, Agrobacterium crown gall-inducing (Ti) plasmids (such as the Nos gene for lipase synthesis) and plant genes (such as the soybean storage protein gene).
[0046] When constructing a recombinant plant expression vector using the GmZG2 gene, any enhancing or constitutive promoter can be added before its transcription initiation nucleotide, including but not limited to the cauliflower mosaic virus (CAMV) 35S promoter and the maize ubiquitin promoter. These can be used alone or in combination with other plant promoters. Furthermore, when constructing a plant expression vector using the gene of this invention, enhancers, including translational enhancers or transcriptional enhancers, can also be used. These enhancer regions can be ATG start codons or adjacent region start codons, but they must be identical to the reading frame of the coding sequence to ensure correct translation of the entire sequence. The sources of the translation control signals and start codons are wide-ranging; they can be natural or synthetic. The translation initiation region can originate from the transcription initiation region or structural genes.
[0047] To facilitate the identification and screening of transgenic plant cells or plants, the plant expression vectors used can be processed, such as by adding genes that can be expressed in plants, encoding enzymes or luminescent compounds that produce color changes (GUS genes, luciferase genes, etc.), antibiotic resistance markers (gentamicin markers, kanamycin markers, etc.), or chemical reagent resistance marker genes (such as herbicide resistance genes). From a safety perspective, transgenic plants can be screened directly under stress without adding any selective marker genes.
[0048] In one specific embodiment, the recombinant vector is GmZG2-sgRNA, and the structure of the recombinant vector GmZG2-sgRNA is described as follows: a DNA molecule with a target sequence of 5'-GGGTCATTGCGATTGTGAGA-3' is inserted into a linear cas9 / gRNA vector through homologous recombination, while keeping other sequences of the cas9 / gRNA vector unchanged, to obtain a recombinant expression vector.
[0049] The microorganisms described in this article can be yeast, bacteria, algae, or fungi. Among them, bacteria can originate from genera such as *Escherichia*, *Erwinia*, *Agrobacterium*, *Flavobacterium*, *Alcaligenes*, *Pseudomonas*, and *Bacillus*. Specifically, *Agrobacterium tumefaciens* EHA105 is an example.
[0050] In one specific embodiment, the recombinant microorganism may be recombinant Agrobacterium EHA105 / GmZG2-sgRNA.
[0051] The recombinant Agrobacterium EHA105 / GmZG2-sgRNA is a recombinant bacterium obtained by introducing the recombinant vector GmZG2-sgRNA into Agrobacterium tumefaciens EHA105.
[0052] The present invention also provides the use of the protein GmZG2 described above, or the expression substance of the gene regulating it, or the substance regulating the activity or content of the protein, in any of the following:
[0053] The application of the protein or gene expression substance or substance that regulates the activity or content of the protein described in U1) in regulating plant architecture and yield.
[0054] The application of the protein or gene-regulating substance or substance regulating the activity or content of the protein described in U2) in the preparation of products that regulate plant architecture and yield.
[0055] The application of the protein or gene-regulating substance described in U3) or the substance regulating the activity or content of the protein in cultivating plants with altered plant structure and increased yield.
[0056] The application of the protein or gene-regulating substance or substance regulating the activity or content of the protein described in U4) in the preparation of plant products with altered plant type and increased yield.
[0057] The application of the protein or gene expression substance or substance that regulates the activity or content of the protein described in U5) in plant breeding.
[0058] In this article, the substance that regulates the activity and / or content of the protein may be a substance that regulates gene expression, wherein the gene encodes the protein GmZG2.
[0059] In this article, the substance that regulates gene expression can be a substance that performs at least one of the following six types of regulation:
[0060] 1) Regulation occurring at the transcriptional level of the aforementioned gene;
[0061] 2) Regulation that occurs after the gene is transcribed (i.e., regulation of the splicing or processing of the primary transcript of the gene);
[0062] 3) Regulation of RNA transport of the gene (that is, regulation of the transport of mRNA of the gene from the nucleus to the cytoplasm);
[0063] 4) Regulation of the translation of the aforementioned genes;
[0064] 5) Regulation of mRNA degradation of the aforementioned gene;
[0065] 6) Post-translational regulation of the gene (i.e., regulation of the activity of the protein translated from the gene).
[0066] In the above applications, the substance that regulates gene expression or the substance that regulates the activity or content of the protein can be a biological material related to the protein, and the biological material can be the biological material described above.
[0067] In this invention, the purpose of plant breeding includes cultivating plants with altered plant type and increased / decreased yield.
[0068] The present invention also provides a method for cultivating plants with altered plant structure and increased yield, comprising: 1) inhibiting, reducing or silencing the expression level of the coding gene of the protein described above in the target plant, and / or inhibiting, reducing or silencing the activity and / or content of the coding gene of the protein described above, to obtain plants with altered plant structure and increased yield.
[0069] 2) Increase, enhance, or upregulate the expression level of the coding genes of the proteins mentioned above in the target plant, or / and increase, enhance, or upregulate the activity and / or content of the coding genes of the proteins mentioned above, to obtain plants with altered plant type and reduced yield.
[0070] In one specific embodiment, a method for cultivating plants with altered plant type and increased yield includes the following steps: inhibiting the expression of nucleic acid molecules encoding GmZG2 protein in the target plant to obtain transgenic plants with altered plant type and increased yield. Specifically, the inhibition of nucleic acid molecule expression encoding GmZG2 protein in the target plant can be achieved by introducing a knockout vector targeting the nucleic acid molecule encoding GmZG2 protein into the target plant.
[0071] The knockout vector may be a gene editing vector.
[0072] As one embodiment of the present invention, the method for cultivating plants with altered plant type and increased yield includes the following steps:
[0073] (1) Construct a gene editing vector containing a gene that inhibits the expression of GmZG2 gene, such as SEQ ID No.4;
[0074] (2) Introduce the gene editing vector constructed in step (1) into plants;
[0075] (3) Plants with altered plant type and increased yield obtained through screening and identification.
[0076] Specifically, the gene editing vector is a vector based on Cas9 gene editing technology. Specifically, the gene editing vector expresses sgRNA and Cas9 protein. The sgRNA targets a nucleic acid molecule encoding the GmZG2 protein. Specifically, the sgRNA sequence is: 5'-GGGTCATTGCGATTGTGAGA-3'.
[0077] In the above method, the target site for gene editing by the CRISPR / Cas9 system is the reverse complementary sequence of positions 245-264 of SEQ ID No. 1 (corresponding to positions 31-50 of SEQ ID No. 2 (coding sequence)).
[0078] In the above method, the CRISPR / Cas9 system gene editing can be performed by mutating the gene encoding the protein GmZG2 in the soybean genome as follows: inserting a nucleotide "A" between positions 247-248 of SEQ ID No. 1 (corresponding to positions 34-35 of SEQ ID No. 2 (coding sequence CDS)) to cause a frameshift mutation; thereby knocking out the gene encoding the GmZG2 protein.
[0079] The present invention also provides a method for regulating plant architecture and increasing yield, comprising regulating the activity and / or content of the proteins described above in the target plant, and / or the expression level of the genes encoding the proteins, to regulate plant architecture and increase yield.
[0080] In the above method, regulating the activity and / or content of the protein GmZG2 in the target plant, or / and the expression level of the gene encoding the protein, includes introducing the gene encoding the protein GmZG2 to the recipient plant to inhibit, reduce, or silence the protein, thereby obtaining a target plant with altered plant architecture and increased yield; the gene encoding the protein GmZG2 encodes the protein GmZG2.
[0081] The importation refers to the importation through recombination methods, including but not limited to Agrobacterium-mediated transformation, bio-projectile methods, electroporation, in-planta technology, and so on.
[0082] In the above applications and methods, the regulation can be to increase, enhance, or upregulate.
[0083] In the above applications and methods, the regulation can be suppression, reduction, or silencing.
[0084] In this article, regulating the expression of the gene encoding the protein can be achieved by inhibiting, reducing, or downregulating the expression of the gene. Inhibition, reduction, or downregulation of the gene expression can be achieved through gene knockout or gene silencing.
[0085] Gene knockout refers to the phenomenon of inactivating a specific target gene through gene editing technology. Gene knockout inactivates a specific target gene by altering its DNA sequence.
[0086] To facilitate the identification and screening of transgenic cells or plants, the recombinant expression vectors used can be processed, such as by adding genes that can be expressed in plants, encoding enzymes or luminescent compounds that produce color reactions, antibiotic resistance markers, or chemical reagent resistance marker genes. Alternatively, without adding any selective marker genes, transformed plants can be directly screened for resistance under stress.
[0087] The plants obtained by the above methods can be transgenic plants or plants obtained through conventional breeding techniques such as hybridization. In the above methods, the transgenic plants are understood to include not only first- and second-generation transgenic plants, but also their progeny. For transgenic plants, the gene can be propagated within the species, or it can be transferred into other varieties of the same species using conventional breeding techniques, particularly commercial varieties. The transgenic plants include seeds, callus tissue, complete plants, and cells.
[0088] In this article, plant type traits may include plant height, number of pods per plant, number of grains per plant and / or number of branches.
[0089] In the above applications or methods, the plant is any one of the following:
[0090] N1) Dicotyledons:
[0091] N2) Leguminosae;
[0092] N3) Leguminosae (family legumes);
[0093] N4) Plants of the genus *Glycine*;
[0094] N5) soybeans.
[0095] This invention uses gene editing technology to knock out the GmZG2 gene, thereby reducing GmZG2 gene expression and rapidly improving soybean plant architecture and increasing yield per unit area. Attached Figure Description
[0096] Figure 1 This is the mutation type of the gmzg2 mutant.
[0097] Figure 2 The strain type is the gmzg2 mutant. Detailed Implementation
[0098] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.
[0099] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.
[0100] Unless otherwise specified, all quantitative experiments in the following examples are performed in triplicate.
[0101] MS salt in the following examples: PhytoTech, catalog number: M524; MS organic: PhytoTech, catalog number: M533; B5 organic: Phytotech, catalog number: G219; B5 salt: Phytotech, catalog number: G768.
[0102] The linear cas9 / gRNA vectors used in the following examples were purchased from Beijing Weishang Lide Biotechnology Co., Ltd., catalog number: VK005-15.
[0103] The culture medium preparation method used in this invention is as follows:
[0104] 1) YEP solid medium consists of a solvent and a solute; the solutes and their concentrations in YEP solid medium are: NaCl 5g / L, yeast extract 5g / L, tryptone 10g / L, and agar 15g / L; the solvent is water. The pH of YEP solid medium is 7.0.
[0105] 1) Germination medium (pH 5.8): 3.12 g / L B5 salt, 1 ml / L B5 organic, 20 g / L sucrose, 7.5 g / L agar, with the remainder being water.
[0106] 2) Liquid culture medium (pH 5.4): 0.43 g / L MS salt, 1 ml / L B5 organic, 40 mg / L acetylsuccinone, 150 mg / L dithiothreitol, 100 mg / L L-cysteine, 30 g / L sucrose, 3.9 mg / L 2-morpholinoethanesulfonic acid, with the remainder being water.
[0107] 3) Co-culture medium (pH 5.4): 0.43 g / L MS salt, 1 ml / L B5 organic, 40 mg / L acetylsuccinone, 150 mg / L dithiothreitol, 100 mg / L L-cysteine, 30 g / L sucrose, 7.5 g / L agar, 3.9 mg / L 2-morpholinoethanesulfonic acid, with the remainder being water.
[0108] 4) Recovery medium (pH 5.4): 3.1 g / L B5 salt, 1 ml / L B5 organic, 30 g / L sucrose, 150 mg / L cephalosporin, 150 mg / L termethin, 1 mg / L 6-BA, 0.98 g / L 2-morpholinoethanesulfonic acid, 7.5 g / L agar, 4 ml / L Fe salt (200×), 50 mg / L L-asparagine, 50 mg / L L-glutamine, with the remainder being water.
[0109] 5) Screening medium (pH 5.4): 3.1 g / L B5 salt, 1 ml / L B5 organic, 0.98 g / L 2-morpholinoethanesulfonic acid, 30 g / L sucrose, 150 mg / L cephalosporin, 150 mg / L termethin, 1 mg / L 6-BA, 6 mg / L glufosinate, 7.5 g / L agar, 4 ml / L Fe salt (200×), 50 mg / L L-asparagine, 50 mg / L L-glutamine, with the remainder being water.
[0110] 6) Elongation medium (pH 5.6): 4.0 g / L MS salt, 1 ml / L B5 organic, 0.6 g / L 2-morpholinoethanesulfonic acid, 30 g / L sucrose, 150 mg / L cephalosporin, 150 mg / L termethin, 0.1 mg / L IAA, 0.5 mg / L GA, 1 mg / L 6-BA, 6 mg / L glufosinate, 7.5 g / L agar, 4 ml / L Fe salt (200×), 50 mg / L L-asparagine, 50 mg / L L-glutamine, balance water.
[0111] 7) Rooting medium (pH 5.7): 2.165 g / L MS salt, 1 ml / L B5 organic, 0.6 g / L 2-morpholinoethanesulfonic acid, 20 g / L sucrose, 7.5 g / L agar, 50 mg / L L-asparagine, 50 mg / L L-glutamine, with the remainder being water.
[0112] The cultivated soybean Jack in the following examples has been described in: Chen L, Cai Y, Liu X, Yao W, Guo C, Sun S, Wu C, Jiang B, Han T, Hou W (2018), Improvement of soybean Agrobacterium-mediated transformation efficiency by adding glutamine and asparagine into the culture media. International Journal of Molecular Sciences 19, 3039. This biological material is available to the public from the applicant and is intended solely for the purpose of replicating the experiments of this invention and shall not be used for any other purpose.
[0113] The Agrobacterium tumefaciens EHA105 in the following examples has been described in: Cai Y, Chen L, Liu X, Guo C, Sun S, Wu C, Jiang B, Han T and Hou W (2018a), CRISPR / Cas9-mediated targeted mutationnesis of GmFT2a delays flowering time in soya bean. Plant Biotechnol J16, 176-185. This biological material is available to the public from the applicant and is intended solely for the purpose of repeating experiments of this invention and shall not be used for any other purpose.
[0114] The Cas9 / gRNA vector used in the following examples was purchased from Beijing Weishang Lide Biotechnology Co., Ltd., catalog number: VK005-15. This vector contains a Cas9 protein expression unit.
[0115] The data in the following examples were processed using SPSS 11.5 statistical software. The experimental results are expressed as mean ± standard deviation. One-way ANOVA was used, and P < 0.05 (*) indicates a significant difference, and P < 0.01 (**) indicates a highly significant difference.
[0116] Example 1: Obtaining GmZG2 protein and GmZG2 gene-edited plants
[0117] 1. Obtaining the GmZG2 protein and its encoding gene
[0118] The soybean GmZG2 gene is located on chromosome 6 and encodes the protein GmZG2. Using the soybean variety Jack as a reference genome, the genomic sequence of the GmZG2 gene is SEQ ID No. 1, the coding sequence of the GmZG2 gene is SEQ ID No. 2, and the protein GmZG2 with the amino acid sequence SEQ ID No. 3 is encoded.
[0119] 2. Obtaining sgRNA
[0120] The target sequence for GmZG2 sgRNA was selected using the online CRISPR-P tool (http: / / cbi.hzau.edu.cn / cgi-bin / CRISPR). The target site is located in the first exon region of GmZG2, and the selected sgRNA sequence is 5'-GGGTCATTGCGATTGTGAGA-3' (i.e., the reverse complementary sequence of positions 245-264 of SEQ ID No. 1 (corresponding to positions 31-50 of SEQ ID No. 2 (coding sequence)).
[0121] After the target site is designed, the sgRNA is integrated into the vector. First, the target primers for the sgRNA are synthesized. The primer sequence information is as follows:
[0122] GmZG2-F:5'-TT GGGGTCATTGCGATTGTGAGA -3';
[0123] GmZG2-R:5'-AAC TCTCACAATCGCAATGACCC -3';
[0124] (The underlined sequence is a 20bp sgRNA)
[0125] Add 5 μL each of GmZG2-F and GmZG2-R primers and 15 μL of water to a 25 μL system. Anneal at 95 °C for 3 min, then anneal at 0.1 °C / s to 16 °C and hold at 16 °C for 10 min to complete the annealing process, and obtain the gRNA annealed product with sticky ends.
[0126] 3. Preparation of GmZG2 gene editing expression vector GmZG2-sgRNA
[0127] Take 1 μL of the gRNA annealing product with sticky ends obtained in step 2 above and perform T4 ligation with the Cas9 / gRNA vector to obtain the recombinant vector Cas9-sgRNA. This vector expresses sgRNA. The target sequence binding region of the sgRNA is the reverse complementary sequence of positions 245-264 of SEQ ID No. 1, which corresponds to the reverse complementary sequence of positions 31-50 of SEQ ID No. 2 (coding sequence).
[0128] 4. Preparation of recombinant bacteria
[0129] The recombinant vector Cas9-sgRNA prepared in step 2 was transformed into E. coli DH5α and plated on LB+Kan solid medium. Single clones were picked, plasmids were extracted, and sent for sequencing.
[0130] Sequencing primer SQ: 5'-GATGAAGTGGACGGAAGGAAGGAG-3', the plasmid with the correctly inserted fragment was named the recombinant vector GmZG2-sgRNA.
[0131] The structure of the recombinant vector GmZG2-sgRNA is described as follows: A DNA molecule with the sgRNA sequence 5'-GGGTCATTGCGATTGTGAGA-3' is inserted into the cas9 / gRNA vector through homologous recombination, while keeping other sequences of the cas9 / gRNA vector unchanged, to obtain the recombinant expression vector.
[0132] The recombinant vector GmZG2-sgRNA contains an sgRNA gene expression cassette with nucleotide sequences from positions 35 to 582 of SEQ ID No. 4. The sgRNA gene is shown as nucleotides from positions 480 to 499 of SEQ ID No. 4 in the sequence listing. Nucleotides 35-479 constitute the promoter for initiating sgRNA gene transcription, and nucleotides 576-582 constitute the terminator for terminating sgRNA gene transcription. Cas9-sgRNA also contains a Cas9 protein gene expression cassette with nucleotide sequences from positions 584 to 5568 of SEQ ID No. 4, and can express the Cas9 protein.
[0133] 5. Obtaining and phenotypic identifying the GmZG2 mutant
[0134] The recombinant vector GmZG2-sgRNA was transformed into Agrobacterium tumefaciens EHA105 by electroporation. The plasmid was extracted and sequenced for verification. The recombinant strain that was correctly sequenced was named EHA / GmZG2-sgRNA.
[0135] 6. Agrobacterium-mediated transformation
[0136] The EHA-GmZG2-sgRNA constructed in step 4 was transformed into the soybean variety Jack (hereinafter referred to as wild-type soybean) using Agrobacterium-mediated transformation. The specific method is as follows:
[0137] A. Seed sterilization
[0138] 1) Take healthy, plump, uniform, and dry Jack soybean seeds that are free from pests, diseases, and spots, spread them evenly in a petri dish, and then place the petri dish in a desiccator.
[0139] 2) After completing step 1), place a 100ml beaker in the desiccator, pour 80ml of 12M sodium hypochlorite aqueous solution into the beaker, then slowly add 4ml of concentrated hydrochloric acid, and then quickly cover the desiccator, seal it with petroleum jelly, and place it for 16 hours for chlorine sterilization.
[0140] B. Preparation of infecting bacterial solution
[0141] 1) Incubate the EHA / GmZG2-sgRNA bacterial culture obtained in step 4 above at 28℃, resuspend it in liquid culture medium, and obtain OD. 600nm =0.6% of the infecting bacterial solution.
[0142] 2) Place the seeds treated in step A into a clean bench. Under a microscope, peel off the seed coat, separate the two cotyledons along the long axis, and keep the cotyledon with the complete hypocotyl. Make scratches at the junction of the hypocotyl and cotyledon, usually 3-5 scratches per cotyledon. Then, immerse the seeds in a 28℃ incubator for 2 hours.
[0143] 3) Place the cotyledons with the inner (smooth) side up on a co-culture medium lined with sterile filter paper, and incubate in the dark at 22°C for 5 days.
[0144] 4) After 5 days of co-culture, the hypocotyl of the explants elongated to 2 cm. Part of the hypocotyl was cut off, leaving 0.5 cm. The treated explants were then placed in recovery medium and cultured at 28°C under 16 h light / 8 h dark conditions for 7 days.
[0145] 5) Remove the explants from the recovery medium, remove the new shoots, cut off part of the hypocotyl, leaving 0.5 cm of the hypocotyl, and then transfer the trimmed explants into the selection medium and culture them at 28℃ for 21 days under 16h light / 8h dark conditions.
[0146] 6) After 21 days of selection and induction, the explants produced a large number of adventitious buds. The cotyledons and brown leaves were removed, and the remaining parts were transferred to elongation medium for culture at 28°C under 16h light / 8h dark conditions.
[0147] 7) In the elongation medium, when the clustered buds produce 5-8cm young stems, cut them off from the base of the adventitious buds; dip the stem base in 1mg / LIBA solution for 1min, and then transfer it to the rooting medium for culture. Culture at 28℃ under 16h light / 8h dark conditions for one week. After a large number of roots are produced at the base of the stem, transplant them into pots. The resulting plants are T0 generation transformed soybeans.
[0148] 6. Molecular detection of edited plants
[0149] DNA was extracted from the leaves of T0 generation transformed soybean obtained in step 5 and used as a template for PCR molecular detection, with wild-type soybean as a control.
[0150] PCR primers were designed near the target site of the GmZG2 gene for PCR amplification and sequencing. Specifically, primers GmZG2-F (5'-GTCACAACACACTTGAACAC-3') and GmZG2-R (5'-CTCTTTTTCTTTGGATCTGA-3') amplified the GmZG2 gene.
[0151] PCR reaction system: 12.5 μL 2×PhantaMax Buffer, 0.5 μL dNTP Mix (10 mM), 1 μL DNA (200 ng / μL), 1 μL F (10 pmol / μL), 1 μL R (10 pmol / μL), 0.5 μL Super-Fidelity DNA Polymerase, 8.5 μL ddH2O, total volume 25 μL. Amplification reaction system: 95℃ for 3 min; 95℃ for 30 sec, 58℃ for 30 sec, 72℃ for 1 min, 35 cycles; 72℃ for 5 min. PCR products were sent to the company for sequencing verification.
[0152] The plants exhibiting overlapping peaks near the target site were heterozygous edited plants, named T0 generation GmZG2 gene-edited soybeans.
[0153] T0 generation GmZG2 gene-edited soybeans were sown and then the seeds of T1 generation GmZG2 gene-edited soybeans were harvested to obtain T1 generation GmZG2 gene-edited soybeans.
[0154] PCR was used to detect the GmZG2 gene-edited soybean of generation T1. Sequencing results of the amplified products showed that in the T1 generation GmZG2 gene-edited soybean (zg2), compared with the genomic DNA of the soybean variety Jack (wild type, abbreviated as WT), the gene encoding the GmZG2 protein in both homologous chromosomes of the GmZG2 homozygous mutant underwent the following mutation: "nucleotide 'A' was inserted at positions 247-248 of SEQ ID No. 1 (corresponding to positions 34-35 of SEQ ID No. 2 (coding sequence CDS), thereby knocking out the gene encoding the GmZG2 protein. The sequencing results of this mutation site and its surrounding nucleotides are shown in..." Figure 1 .
[0155] The T1 generation GmZG2 gene-edited soybean mutant plants gmzg2 with the above-mentioned GmZG2 gene mutation type were further cultivated to screen and obtain the T2 generation GmZG2 gene-edited soybean homozygous mutant gmzg2 without transgenic elements, and phenotypic identification was performed.
[0156] Example 2: Phenotypic Identification of GmZG2 Gene-Edited Soybean Mutants
[0157] The plants to be tested were soybean varieties Jack and GmZG2 gene-edited soybean gmzg2, grown in a net house under natural light conditions in Beijing during the summer. The planting conditions were: plant spacing 10cm and row spacing 50cm.
[0158] Plant morphological traits (plant height, number of nodes, number of branches, number of pods per plant, and number of grains per plant) of the wild-type soybean variety Jack (control plant) and the gmzg2 homozygous mutant were statistically analyzed. The experimental materials were replicated three times, with at least six plants from each line measured each time.
[0159] The results (Table 1) show that, in terms of plant type, compared with the control plant height of 148.3 cm, the average height of the gmzg2 homozygous mutant was 116.3 cm, indicating a significant decrease in plant height. Regarding branching phenotype, the control plant had 1.5 branches, while the gmzg2 homozygous mutant plant had 3.3 branches, showing a significant increase in branching. As for the number of nodes, the control plant had 25.0 nodes, while the gmzg2 homozygous mutant plant had an average of 25.3 nodes, indicating no significant change in the number of nodes between the two control plants.
[0160] In terms of yield per plant, the control plants had an average of 106.5 pods and 257.8 seeds per plant, while the gmzg2 homozygous mutant had an average of 161.0 pods and 391.3 seeds per plant. The number of pods and seeds per plant in the gmzg2 homozygous mutant was significantly increased compared to the wild type.
[0161] Table 1. Statistics on soybean plant type data
[0162]
[0163] The present invention has been described in detail above. Those skilled in the art will recognize that the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. While specific embodiments have been provided, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein.
Claims
1. The use of substances that inhibit, reduce, or silence the expression of protein-coding genes, or substances that inhibit, reduce, or silence protein activity or content, in any of the following: U1) Application in reducing soybean plant height and / or increasing soybean yield; U2) Application in the preparation of products that reduce soybean plant height and / or increase soybean yield; Application of U3 in the cultivation of dwarf soybeans and / or high-yield soybeans; U4) Application in the preparation of products that cultivate dwarf soybeans and / or high-yield soybeans; Application of U5 in breeding dwarf soybeans or high-yield soybeans; in, The protein is any one of the following: A1) a protein with an amino acid sequence as shown in SEQ ID No. 3; A2) is a fusion protein obtained by attaching a protein tag to the N-terminus and / or C-terminus of A1).
2. The application according to claim 1, characterized in that, The substance that inhibits, reduces, or silences the expression of the gene encoding the protein, or the substance that inhibits, reduces, or silences the activity or content of the protein, is a biological material related to the protein, and the biological material is any one of the following: C1) A nucleic acid molecule that inhibits, reduces, or silences the expression of the gene encoding the protein of claim 1; C2) expresses the gene encoding the nucleic acid molecule described in C1); C3) contains an expression cassette encoding the gene described in C2); C4) A recombinant vector containing the encoding gene described in C2), or a recombinant vector containing the expression cassette described in C3); C5) A recombinant microorganism containing the encoding gene described in C2), or a recombinant microorganism containing the expression cassette described in C3), or a recombinant microorganism containing the recombinant vector described in C4).
3. Methods for cultivating dwarf soybeans and high-yield soybeans include: Inhibiting, reducing, or silencing the expression level of the gene encoding the protein described in claim 1 in soybean, and / or inhibiting, reducing, or silencing the activity and / or content of the gene encoding the protein described in claim 1, yields dwarf soybeans and high-yield soybeans.
4. A method for reducing soybean plant height and increasing soybean yield, characterized in that, Soybean plant height and soybean yield can be reduced by inhibiting or reducing or silencing the activity and / or content of the protein described in claim 1 in soybean, or / and by inhibiting or reducing or silencing the expression level of the gene encoding the protein described in claim 1.
5. The method according to claim 4, characterized in that, The inhibition, reduction, or silencing of the activity and / or content of the protein described in claim 1 in soybean, or / and the inhibition, reduction, or silencing of the expression level of the gene encoding the protein described in claim 1, includes introducing a substance into the recipient soybean to inhibit, reduce, or silence the expression of the gene encoding the protein, resulting in a target soybean with a plant height lower than the recipient soybean and a yield higher than the recipient soybean; the gene encoding the protein described in claim 1.
Citation Information
Patent Citations
Surface application of polynucleotide molecules for improving yield traits in plants
CN115426873A