Use of bacillus thuringiensis in preparing biocontrol and trapping agent for controlling galleria mellonella

Abstract

The application discloses an application of Bacillus thuringiensis in preparing a biocontrol and trapping agent for preventing and treating galleria mellonella. The Bacillus thuringiensis is named Bacillus thuringiensis BiotG03, and has a preservation number of CGMCC No. 26127 in the China General Microbiological Culture Collection Center. The application further discloses a biocontrol and trapping agent for preventing and treating galleria mellonella, which comprises the Bacillus thuringiensis BiotG03 and an attractant. The application of the Bacillus thuringiensis in preventing and treating galleria mellonella has a very important practical significance in guaranteeing the quality of bee products, reducing economic losses in beekeeping production and protecting Apis cerana.

Description

Technical Field

[0001] This invention relates to the field of microbiology, and mainly to the application of Bacillus thuringiensis in the control of the large wax moth. Background Technology

[0002] Bees not only provide products such as honey, bee pollen, royal jelly, propolis, and beeswax, but they are also the primary pollinators of most crops and wild plants, playing an irreplaceable role in maintaining the stability of natural ecosystems. The large wax moth (Galeria melonela), belonging to the order Lepidoptera, family Pyralidae, and genus Galeria, is one of the major pests of the Chinese honeybee (Apiscerana cerana Fabricius), and is the most serious pest damaging the honeycomb storage of both Chinese and Western honeybees (Apismelifera). Currently, there are approximately 6 million colonies of Chinese honeybees in my country, accounting for about half of the total number of bee colonies in the country. The large wax moth is one of their major pests, occurring in most areas where Chinese honeybees are raised, causing serious economic losses to my country's beekeeping industry. However, research on the control of the large wax moth is limited. By 2016, the giant wax moth had been confirmed to have been found in bee colonies in more than 60 countries across North America, Australia, Europe, Asia, and Africa, indicating that it has become a significant pest threatening the global beekeeping industry. However, there is still a lack of green, safe, and efficient methods and technologies for controlling the giant wax moth.

[0003] Bacillus thuringiensis (Bt) is a ubiquitous Gram-positive bacterium that produces various forms of insecticidal crystal protein (ICP) or delta-endotoxin in its later stable growth stages. These are the main insecticidal active substances of Bt, including Cry and Cyt proteins. Bt is known to have insecticidal activity against more than 600 insect species, including Lepidoptera, Diptera, and Coleoptera. Its applications are mainly concentrated in Bt insecticides and Bt transgenic crops. Unlike broad-spectrum chemical pesticides, Bt has specific insecticidal activity, is safe for humans and animals, and is environmentally friendly and friendly to non-target insects. Since its discovery, it has been widely used for the control of agricultural and forestry pests and mosquitoes. As one of the most widely used pest management tools, Bt has great potential for controlling the wax moth during the live bee stage. Research on the use of Bt to control the wax moth can be traced back to the 1960s, and existing research shows that some commercial Bt formulations used to control lepidopteran pests have certain insecticidal activity against wax moth larvae. This is mainly achieved by directly applying a suspension of Bt containing spores to bee honeycomb through spraying or immersion. However, due to some potential adverse factors, the current adoption rate of Bt for controlling the wax moth in beekeeping is extremely low. To reasonably explain this phenomenon, an analysis and summary of existing research reports revealed four main factors contributing to the low adoption rate: (1) the lack of standardized toxicity testing methods has prevented the toxicity and activity of Bt against wax moth larvae from being elucidated; (2) existing studies mostly involve directly using commercially available Bt formulations for controlling the wax moth, resulting in the current lack of screening for formulations with high toxicity (LC50) against the wax moth. 50 The Bt strains (<5ppm) are prone to developing high pest resistance, thus reducing the control efficacy; (3) Applying Bt to honeycomb for the control of wax moth by spraying or soaking is time-consuming, laborious, and costly. More importantly, it will lead to the presence of Bt spores in honey, pollen, and honeycomb, which may pose a risk to the safety of bees and their products; (4) There are no reports on the actual field control efficacy and practicality of using Bt to control wax moth. Therefore, the above factors indicate that the use of Bt to control wax moth in the bee colony environment is urgently needed for long-term trials compared to the application of Bt in the field to control other agricultural pests. Using Bt to achieve green, safe, easy-to-operate, low-cost, and efficient control of wax moth is a highly innovative challenge. In the future, some new technologies can be developed by combining it with Bt, which has high toxicity. Moreover, there are currently no reports on methods for Bacillus thuringiensis in bee colonies to effectively control wax moth without contact with bees. Summary of the Invention

[0004] Therefore, using Bacillus thuringiensis (Bt) to control the wax moth is the most promising biological control method. The purpose of this invention is to provide a Bacillus thuringiensis strain with highly effective toxic activity against wax moth larvae and a safe and effective control method for it that does not come into contact with bees within the bee colony.

[0005] This invention provides a Bacillus thuringiensis strain with high toxicity against the larvae of the large wax moth.

[0006] The Bacillus thuringiensis strain, named BiotG03 and classified as Bacillus thuringiensis, was deposited on November 11, 2022, at the China General Microbiological Culture Collection Center (address: No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing), with accession number CGMCC No. 26127.

[0007] This invention provides a method for preparing and applying a Bacillus thuringiensis formulation for controlling the large wax moth. Preferably, the Bacillus thuringiensis is Bacillus thuringiensis BiotG03. Specifically, the formulation is a biocontrol attractant for controlling the large wax moth.

[0008] This invention provides a biocontrol bait for controlling the large wax moth, comprising Bacillus thuringiensis BiotG03, a highly effective lure, and a contactless bee-based baiting device for controlling the large wax moth.

[0009] Specifically, the biocontrol attractant contains Bacillus thuringiensis at a weight percentage of 0.001% to 0.01%.

[0010] The biocontrol attractant is a biocontrol attractant containing BiotG03 that can be used to control the large wax moth. Specifically, it can be made into Bacillus thuringiensis BiotG03 wettable powder. The Bacillus thuringiensis BiotG03 wettable powder is prepared by placing the prepared spore crystal mixture in a -80℃ ultra-low temperature freezer for 3 hours, taking it out, and then placing it in a vacuum freeze dryer (-60℃, 100Pa) for freeze-drying for 72 hours to make the spore crystal mixture freeze-dried powder, which is the wettable powder.

[0011] The present invention also provides the preparation of a lure with a high attraction rate for the larvae of the large wax moth.

[0012] Specifically, the lure core includes lure core A, which is mainly composed of old honeycomb, and lure core B, which is mainly composed of beeswax.

[0013] The lure A consists of 400 parts by weight of old comb powder and 200 parts by weight of pollen.

[0014] The lure core B consists of 150 parts beeswax, 9 parts old comb powder, 3 parts pollen, 3 parts milk powder, and 7.5 parts honey.

[0015] Furthermore, developing corresponding control technologies based on the actual needs of beekeeping production for controlling the wax moth can provide a feasible approach to achieve green, safe, and efficient control of the wax moth. Utilizing Bacillus thuringiensis to control the wax moth is of great practical significance for ensuring the quality of bee products, reducing economic losses in beekeeping production, and protecting the Chinese honeybee.

[0016] Instruction manual illustrations

[0017] Figure 1 Results of crystal morphology observation of Bt strain;

[0018] Figure 2 To detect the insecticidal gene of Bt strain by PCR;

[0019] Figure 3 To determine the attraction rates of four common honeycomb products (old honeycomb, beeswax, pollen, and honey), lure A, and lure B to 1st-2nd instar larvae of the wax moth using a Y-type olfactometer;

[0020] Figure 4 The results show the attraction rates of old combs, beeswax, pollen, and honey to the larvae of the large wax moth. Columns with the same letter indicate no significant difference (p≥0.05).

[0021] Figure 5 The results show the attraction rates of lure A and lure B to the larvae of the large wax moth. Columns with the same letter indicate no significant difference (p≥0.05).

[0022] Figure 6 A schematic diagram of a trapping device with a built-in lure A or lure B, and an indoor test to determine the activity of biocontrol lure A and biocontrol lure B against the large wax moth;

[0023] Figure 7 The old nest combs were damaged by the larvae of the large wax moth in the 15-day, 30-day, and 120-day natural anti-attractant treatment group, the lure control group, and the blank control group. The red arrows indicate the net-like material produced by the large wax moth larvae after feeding on the old nest combs, and the red boxes indicate the areas of the old nest combs destroyed by the large wax moth larvae.

[0024] Figure 8 The trapping effect was compared between the biological control bait treatment group and the lure control group.

[0025] Instructions for the Preservation of Biological Materials

[0026] Bacillus thuringiensis BiotG03 was deposited on November 11, 2022, at the China General Microbiological Culture Collection Center (address: No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing), with accession number CGMCCNo.26127 and taxonomic name Bacillus thuringiensis. Detailed Implementation

[0027] To better understand the present invention, it will be further described in detail below with reference to the accompanying drawings and embodiments. It should be understood that the embodiments described herein are for illustrative purposes only and do not limit the scope of protection of the present invention.

[0028] Example 1: Obtaining Bacillus thuringiensis BiotG03, which has highly effective toxic activity against the large wax moth.

[0029] I. Isolation of Bacillus thuringiensis

[0030] Multiple strains of Bacillus thuringiensis were isolated from soil collected in Baoding, Hebei Province. The isolation method is described below:

[0031] Soil samples were screened and isolated for Bacillus spores using LB agar (10 g / L tryptone, 5 g / L yeast extract, 10 g / L sodium chloride, 15 g / L agar powder, pH 7.0, autoclaved at 121°C for 20 min). First, the soil samples were serially diluted with sterile water. Then, each diluted sample was placed in a 70°C water bath for 10 minutes. Under aseptic conditions, 100 μL of each dilution was spread onto LB agar plates and incubated at 30°C for 16–48 hours. Colonies exhibiting a non-slippery, moist, thick morphology with slightly diffused and irregular outer edges were purified. The purified single colonies were then preserved for subsequent identification and bioactivity analysis.

[0032] Purified single colonies were cultured on LB medium at 30℃, and samples were taken at different time points for microscopic observation of colony morphology and crystal characteristics. The results observed at different stages of culture on LB medium are as follows: Vegetative cells: rod-shaped, with blunt ends, approximately 1.0 × 0.5 μm to 1.5 × 0.5 μm in size; occurring singly or in chains of two or more. Spores: oval, approximately 1.0 × 0.5 μm to 1.3 × 0.5 μm in size, dormant; exhibiting strong resistance to adverse environments such as high temperature or dryness. Parasporal crystals: spherical, rhomboid, and square, etc. These morphological characteristics are basically consistent with the description of Bacillus thuringiensis in the *Handbook of Systematic Identification of Common Bacteria* (edited by Dong Xiuzhu et al., Science Press, 2001). Therefore, strains exhibiting this morphological colony belong to *Bacillus thuringiensis*.

[0033] II. Screening of Bacillus thuringiensis with highly effective toxic activity against the larvae of the large wax moth.

[0034] The larvae of the large wax moth (Galeriamelonela) used in the experiment were all taken from the large wax moth population raised by the Resource Insect Conservation Innovation Team of the Institute of Apiculture, Chinese Academy of Agricultural Sciences.

[0035] Toxicity test of the larvae of the large wax moth: artificial feed formula: 25 parts beeswax, 25 parts honey, 10 parts yeast powder, 25 parts milk powder, 50 parts wheat flour, 50 parts corn flour, 50 parts wheat bran, 30 parts glycerin, 26 parts casein, 2 parts ascorbic acid, 21 parts agar, and 960 parts water.

[0036] The strains isolated in step one were streaked onto LB solid medium. Single colonies were picked and inoculated into 5 mL of LB liquid medium (tryptone 10 g / L, yeast extract 5 g / L, sodium chloride 10 g / L, pH 7.0, autoclaved at 121°C for 20 min), and cultured overnight at 30°C with shaking at 220 rpm. Then, the strains activated for 12 h were inoculated into sterilized liquid medium at a 1% inoculum rate and cultured at 30°C with shaking at 220 rpm until spore crystals were free (producing 80% abundant crystals). The mixture was centrifuged (4°C, 8000 g, 15 min), the supernatant was discarded, and the precipitate was collected to obtain the spore crystal mixture, which was stored at 4°C. The prepared spore crystal mixture was pre-cooled in an ultra-low temperature freezer at -80°C for 3 h, and then freeze-dried in a vacuum freeze dryer (-60°C, 100 Pa) for 72 h to obtain the freeze-dried spore crystal mixture powder, which is the wettable bacterial powder. The prepared bacterial powder was mixed with distilled water and diluted proportionally to prepare suspensions of the test samples with different concentration gradients.

[0037] Weigh 10g of artificial feed for the toxicity test of *Hemiberlesia lataniae* larvae into a sterile petri dish and crush it into a paste. Add 2mL of test sample suspension diluted at different concentrations, stir thoroughly, and place at room temperature. Use 2mL of distilled water as a blank control. After the excess water in the feed evaporates, evenly distribute all the feed into 12-well sterile *Hemiberlesia lataniae* larvae culture plates and press it to one side of the bottom of the well with a spatula. Then, use a brush to pick active 2nd-3rd instar larvae and transfer them from the feed-free side of the bottom of the well into the 12-well sterile *Hemiberlesia lataniae* larvae culture plate, one larva per well. After the larvae are attached, cover the plate with a top cover containing two layers of blown cardboard and one layer of nylon mesh, and secure it with a rubber band to prevent the larvae from escaping. Place the 12-well plate in an artificial climate chamber with a temperature of (30±1)℃, humidity of (60±5)%, and darkness. Each treatment has 4 replicates, with 12 larvae per replicate. Daily checks include temperature, humidity, and feed for mold and condensation. Investigate the number of dead and live insects. After 5 days, calculate the average mortality rate and corrected mortality rate. Use PoloPlus software to analyze mortality rate and LC. 50 value.

[0038] Based on the test results, a strain with highly effective toxic activity against the larvae of the large wax moth was obtained and named Bacillus thuringiensis BiotG03. The LC50 of Bacillus thuringiensis BiotG03 against the larvae of the large wax moth was determined. 50 The value was 1.772 μg / g, less than 5 ppm, indicating highly effective toxic activity against the larvae of the large wax moth. The results are shown in Table 1. It was named *Bacillus thuringiensis* BiotG03.

[0039] Table 1. Results of the toxic activity of Bacillus thuringiensis BiotG03 against the larvae of the large wax moth.

[0040]

[0041] III. Identification of Bacillus thuringiensis BiotG03

[0042] 1. Morphological and physiological-biochemical identification of Bt strains

[0043] 1% activated Bacillus thuringiensis (BtG03) bacterial suspension was inoculated into 1 / 2 LB liquid medium and cultured at 30°C for 2–3 days. A suitable amount of bacterial cells was picked and spread onto a glass slide containing ultrapure water, stained with alkaline carbolic acid fuchsin solution for approximately 3 minutes, and observed under an oil immersion microscope to examine the morphology of Bt spores and crystals. Optical microscopy revealed rhomboid crystals in the BiotG03 strain. Figure 1 ).

[0044] The colonies of *Bacillus thuringiensis* BiotG03 were round, milky white, moist and wrinkled, slightly raised in the center, and with relatively neat edges. Gram staining was positive; the spores were rod-shaped, terminal, or mesophyll-like, and contained irregular crystals. The colonies were positive for catalase, glucose fermentation, esterase, nitrate reduction, gelatin liquefaction, citrate utilization, fructose fermentation, mannitol hydrolysis, and maltose fermentation. They were negative for starch hydrolysis, VP test, protease reaction, MR test, sucrose fermentation, and lactose fermentation.

[0045] 2. Molecular identification

[0046] 16S rDNA sequence analysis: Bacterial DNA extraction was prepared using the protease-SDS method. Amplification primers: 27F: 5'-AGAGTTTGATCCTGGCTCAG-3', 1492R: 5'-TACGGYTACCTTGTTACGACTT-3'. Sequencing and homology analysis were performed by Shanghai Meiji Biopharmaceutical Technology Co., Ltd.

[0047] The 16S rDNA sequence of the strain (Sequence 1 in the sequence listing) was compared with NCBI data and multiple Bacillus thuringiensis strains were grouped into the same cluster, with homology ranging from 99% to 100%. Based on the comprehensive morphological characteristics, physiological and biochemical characteristics, and 16S rDNA molecular identification results, strain BiotG03 was identified as Bacillus thuringiensis.

[0048] Bacillus thuringiensis BiotG03 was deposited on November 11, 2022, at the China General Microbiological Culture Collection Center (address: No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing), with accession number CGMCCNo.26127 and taxonomic name Bacillus thuringiensis.

[0049] Example 2: Identification of the insecticidal genes cry1Aa1 and cry1Ca7 in Bacillus thuringiensis BiotG03 strain

[0050] (1) Scrape a small amount of Bacillus thuringiensis BiotG03 cells cultured on LB solid medium into a 2.0 mL EP tube;

[0051] (2) Add an appropriate amount of glass beads and quartz sand, 500 μL of guanidine isothiocyanate mixture (lysis, denaturation), and break it up on a tissue homogenizer for 3.5 min, followed by centrifugation at 12000×g for 3 min;

[0052] (3) Take the supernatant into another new 2.0 mL EP tube, and add 500 μL of guanidine isothiocyanate mixture to the original EP tube again; repeat step (2) and mix the supernatant with the previous supernatant;

[0053] (4) Column purification: Transfer the above supernatant mixture to a preparation tube, place it in a 2mL centrifuge tube, centrifuge at 12000×g for 1min, and discard the filtrate.

[0054] (5) Add 500 μL of 70% ethanol to the preparation tube to wash the precipitate, and centrifuge at 12000×g for 3 min;

[0055] (6) Place the preparation tube into another new EP tube, add 50 μL of sterile water, let stand for 1 min, and centrifuge at 12000×g for 1 min to elute the DNA;

[0056] (7) The quality of the extracted genomic DNA was detected by 0.7% agarose gel electrophoresis and stored at -20℃ for later use.

[0057] 3. PCR Identification: PCR reaction system (20 μL): 2 μL genomic DNA, 1 μL mixed primers, 10 μL 2×Taq mix, and ultrapure water to 20 μL. PCR amplification conditions: 30 cycles of 94℃ for 3 min, then 94℃ for 1 min, 40℃ for 1 min, 72℃ for 1.5 min, and 72℃ for 5 min. Primer sequences: cry1AaF: AATTGTGCCAGGTACGGGTTC; cry1AaR: ATTCCCTAGTCTTGCGTGCC; cry1CaF: GGTGTCAATGCGGCCATTTT; cry1CaR: CCTGGACAGACACGAACCTC.

[0058] Results: PCR identification showed that specific primers for the cry1Aa1 and cry1Ca7 genes could amplify target bands of approximately 200 bp, indicating that the strain contains the cry1Aa1 and cry1Ca7 genes. Figure 2 ).

[0059] Example 3: Safety assessment of BiotG03, which has highly effective toxic activity against the large wax moth, on bees.

[0060] This invention evaluated the safety of BiotG03 for bees through a series of experiments, laying the foundation for further development of Bacillus thuringiensis preparations for the control of the wax moth. More importantly, it provides a basis and technical support for the safety of applying BiotG03 to control the wax moth in beekeeping production.

[0061] Both larvae and adults of the Western honeybee (Apis melifera) were collected from the experimental apiary of the Institute of Apiculture, Chinese Academy of Agricultural Sciences. Adults of the Chinese honeybee (Apis cerana cerana Fabricius) were collected from the experimental apiary of the Resource Insect Conservation Team of the Institute of Apiculture, Chinese Academy of Agricultural Sciences, Shijingshan District, Beijing. All bee samples were healthy.

[0062] I. Determining the maximum residue that direct application of BiotG03 to honeycomb for the control of the wax moth may cause in honey and pollen.

[0063] Three uncapped honeycombs and three uncapped pollen combs were randomly selected from bee colonies at the experimental apiary of the Institute of Apiculture, Chinese Academy of Agricultural Sciences, and brought back to the laboratory. The uncapped honeycombs and pollen combs were sprayed with a 4000 μg / mL BiotG03 suspension, spraying each side 3 to 4 times (approximately 30 mL). The sprayed honeycombs and pollen combs were then placed at room temperature to dry excess moisture. Honey and pollen samples were then collected for the detection of BiotG03 mycelial residues, with three replicates for each sample. Since BiotG03 residues in honey and pollen exist in the form of spores, the detection method for BiotG03 spore residues can refer to GB4789.2—2010 "National Food Safety Standard - Microbiological Examination of Food - Determination of Total Colony Count". Specific methods are shown in Table 5-1. BiotG03 residue in bees or pollen (μg / g) = ((Number of BiotG03 spores detected in honey or pollen (cfu) × dilution factor) ÷ Initial number of spores in BiotG03 (cfu / g)) × 10 6 .

[0064] Table 3 shows that after spraying uncapped honeycombs and pollen combs with a BiotG03 suspension at a concentration of 4000 μg / mL, BiotG03 residues were detected in both the collected honey and pollen samples. The highest residue level detected in the honey sample was 8.1 × 10⁻⁶. 6 The highest residual amount detected in pollen samples was 4.73 × 10⁻⁶ CFU / g or 3.86 μg / g. 7 cfu / g or 22.52μg / g.

[0065] Table 2. Residue detection methods after BiotG03 suspension spraying onto honeycomb.

[0066]

[0067]

[0068] Table 3. Maximum residue levels of BiotG03 in honey and pollen

[0069]

[0070] II. Chronic toxicity test of BiotG03 on Western honeybee larvae

[0071] (1) Larval Acquisition and Artificial Feed Preparation

[0072] In a Western honeybee apiary, at least five healthy colonies without any pathological symptoms were randomly selected, with the queen bee being a sister queen. The queen was confined to empty combs to lay eggs using a queen cage. After 24 hours of confinement, the queen was released and the egg-laying status was checked. Combs containing eggs were then placed back into the colony for further rearing. 72 hours after queen release, brood combs containing one-day-old larvae were removed from the colony and transferred to the laboratory for larval transfer. Before larval transfer, the temperature of the larval rearing chamber was adjusted to 35°C and the humidity to 94% (saturated K₂SO₄ solution). Sterilized queen cell bases were embedded in sterile 48-well cell culture plates. Simultaneously, the corresponding feed was prepared according to the formula shown in Table 4. During larval transfer, 20 μL of preheated feed A (preheated for 1 hour) was pipetted into the center of the bottom of the queen cell base using an electronic pipette in a clean bench. Then, a sterilized transfer needle was used to quickly transfer the one-day-old larvae from the brood comb to the feed at the bottom of the queen cell base. After transplantation, the larvae were quickly transferred to a larval incubator. The test larvae were given different types and dosages of feed as they grew. No feeding was required on the first day after transplantation, while on the 3rd, 4th, 5th and 6th days, they were fed 20 μL of feed B, 30 μL, 40 μL and 50 μL of feed C, respectively.

[0073] (2) Chronic toxicity assay

[0074] Based on the maximum residue levels of BiotG03 in honey and pollen, and the results of multiple preliminary tests, a concentration of 100 μg / mL (approximately four times the maximum residue levels of BiotG03 in honey and pollen) was selected as the experimental concentration. On days 3, 4, 5, and 6, each larva was fed 20, 30, 40, and 50 μL of feed containing 100 μg / mL BiotG03, respectively. Feed without any other treatments was used as a negative control, and feed containing 45 mg / L dimethoate was used as a positive control. Each treatment was repeated in five replicates, with 12 larvae per replicate, for a total of 60 healthy larvae. Four days after exposure (day 6 post-transplantation), each larva was rapidly transferred to a new disposable 48-well sterile cell culture plate (STCPs) and placed in an incubator at 35°C, 75% (saturated NaCl solution), and in darkness. Larval mortality was checked and recorded daily from the start of exposure until day 18. The survival status of larvae could be assessed by observing spiracular movement (opening / closing) using a dissecting microscope. Dead larvae should be promptly removed from the culture plate to prevent cross-contamination. After transfer to another plate, the survival status of pupae could be visually assessed. Finally, the number of dead larvae per replicate in each treatment group was counted, and the mortality rate and corrected mortality rate were calculated. Kaplan-Meier analysis was performed, and log-rank tests were used to assess differences between groups.

[0075] The results showed that larvae fed with diets containing 100 μg / mL BiotG03 and the negative control (without any other treatment) continuously from day 3 to day 6 post-transplantation had an average survival rate greater than 90% after day 18. In contrast, the average survival rate of larvae fed with the positive control (45 mg / L dimethoate) was only 10%. There was no significant difference in survival rate between larvae fed with 100 μg / mL BiotG03 and the negative control (P>0.05). However, the survival rates of larvae fed with 100 μg / mL BiotG03 and the negative control were significantly higher than those of the positive control (45 mg / L dimethoate) (P<0.0001). In conclusion, 100 μg / mL BiotG03 had no effect on Western honeybee larvae (Table 5).

[0076] Table 4. Feed formulation for feeding Western honeybee larvae in vitro

[0077]

[0078] Table 5. Chronic exposure of Western honeybee larvae to 100% chlorine during days 2 to 5 of the larval developmental period.

[0079] Survival rates in μg / mL BiotG03 feed; survival rates with the same letter indicate no significant difference.

[0080] (p≥0.05).

[0081] deal with Survival rate (%) BiotG03 (100μg / mL) 95(a) negative control 95(a) Positive control (45 mg / L) 0(b)

[0082] III. Chronic toxicity test of BiotG03 on adult Western honeybees

[0083] Worker brood combs sealed for 9 days were collected from 5 healthy bee colonies and brought back to the laboratory. They were then placed in an artificial climate chamber at 35℃, 75% RH, and darkness for 2 days to await emergence. Within 24 hours of emergence, 20 healthy adult bees were randomly selected and placed in a 9×9×10cm wooden beekeeping cage with mesh on both sides. These cages were then placed in an artificial climate chamber at 30±1℃, 60±10% RH, and darkness for 2 days to acclimatize them to the external rearing environment. Each cage contained two feeders, one containing sucrose syrup and the other containing pollen.

[0084] Based on the maximum residue levels of BiotG03 in honey and pollen, and the results of multiple preliminary experiments, a concentration of 100 μg / mL was used for the experiment. A negative control (syrup without any other treatments) and two positive controls (1 mg / L and 45 mg / L dimethoate) were also included. All treatments were thoroughly mixed with the syrup (50% sucrose solution) and fed to bees daily for chronic exposure. Each treatment had five replicates (cages), with 20 healthy adults per replicate (cage). The feeders containing the syrup and pollen paste were changed at midday each day, and dead adults were removed. Mortality data were recorded until 12 days of feeding. Finally, the number of dead bees per replicate for each treatment was counted, and the mortality rate was calculated. Kaplan-Meier analysis was used, and log-rank tests were used to assess differences between groups.

[0085] The results showed that in testing the chronic toxicity of BiotG03 to adult Western honeybees, the survival rate of adults fed with syrup containing 100 μg / mL BiotG03 and the negative control for 12 days was greater than 97%. In contrast, all adults exposed to 1 or 45 mg / L dimethoate died on days 2 and 11, respectively. There was no significant difference in the survival rate of adults fed with syrup containing 100 μg / mL BiotG03 for 12 days compared to the negative control group (P = 0.6048). Therefore, a concentration of 100 μg / mL BiotG03 has no effect on adult Western honeybees (Table 6).

[0086] Table 6. Survival rate of adult Western honeybees after continuous exposure to 100 μg / mL BiotG03 syrup for 12 days. Survival rates with the same letter indicate no significant difference (p≥0.05).

[0087] deal with Survival rate (%) BiotG03 (100μg / mL) 98.17(a) negative control 97.12(a) Dimethoate (1 mg / L) 0(b) Dimethoate (45mg / L) 0(b)

[0088] IV. Chronic toxicity test of BiotG03 on adult Chinese honeybees

[0089] The method for determining the chronic toxicity of BiotG03 to adult Chinese honeybees is consistent with that for determining the chronic toxicity of BiotG03 to adult Western honeybees.

[0090] Chronic toxicity results showed that the survival rate of adult Chinese honeybees was greater than 93% after 12 days of feeding with syrup containing 100 μg / mL BiotG03 and the negative control. In contrast, all adults exposed to 1 or 45 mg / L dimethoate died on days 2 and 8, respectively. There was no significant difference in survival rate between the adult honeybee fed with syrup containing 100 μg / mL BiotG03 and the negative control group after 12 days (P = 0.0900). Therefore, a concentration of 100 μg / mL BiotG03 has no effect on adult Chinese honeybees (Table 7).

[0091] Table 7. Survival rate of adult Chinese honeybees after continuous exposure to 100 μg / mL BiotG03 syrup for 12 days. Survival rates with the same letter indicate no significant difference (p≥0.05).

[0092] deal with Survival rate (%) BiotG03 (100μg / mL) 93.02(a) negative control 98.08(a) Dimethoate (1 mg / L) 0(b) Dimethoate (45mg / L) 0(b)

[0093] Example 4: Preparation and efficacy verification of Bacillus thuringiensis biocontrol attractant for controlling the large wax moth.

[0094] This invention developed a biocontrol and attractant agent of Bacillus thuringiensis to control the wax moth through a series of experiments. The experiments also proved that the biocontrol and attractant agent of Bacillus thuringiensis has excellent indoor activity and field control efficacy against the wax moth. Based on this, a method for controlling the wax moth using Bacillus thuringiensis without contact with bees was proposed, which can achieve green, safe and efficient control of the wax moth.

[0095] I. Determination of the attraction rate of old honeycomb, beeswax, pollen, and honey to larvae of the large wax moth.

[0096] Based on the observation that old honeycomb is more susceptible to invasion by the wax moth and the damaging habits of the wax moth, four common honeycomb products—old honeycomb, beeswax, pollen, and honey—were paired in pairs. A Y-type olfactory analyzer was then used to determine the attraction rates of these four honeycomb products to 1st-2nd instar wax moth larvae. Figure 3 First, old honeycomb and pollen were pulverized into powder, beeswax was crushed into small fragments, and honey was left untreated. Six experimental groups were established: old honeycomb vs. beeswax, old honeycomb vs. honey, old honeycomb vs. pollen, beeswax vs. honey, beeswax vs. pollen, and pollen vs. honey. Then, two honeycomb products from each experimental group were randomly placed at points a and b of a Y-type olfactory meter, respectively. Point c of the Y-type olfactory meter, where no honeycomb products were placed, served as a blank control group. Figure 3Finally, after placing the honeycomb products to be tested, an open circular mesh dish containing 48 active 1st-2nd instar wax moth larvae was placed at the center point d of the Y-type olfactometer. The Y-type olfactometer was then sealed and placed in a climate chamber at 30±1℃, 60±5% humidity, and in darkness. After 30 minutes, the number of wax moth larvae at points a, b, and c of the Y-type olfactometer was checked, and the attraction rate was calculated. To ensure the accuracy of the results, the distance from the center point d of the Y-type olfactometer to points a, b, and c was the same. In all six experimental groups, the weight of all honeycomb products to be tested was 0.4g, and each experimental group was repeated three times. The attraction rate was calculated using the formula A = I / B × 100%, where A is the attraction rate, I is the number of larvae in the circular mesh dish, and B is the number of wax moth larvae at points a, b (containing different honeycomb products), and c (blank control group) of the Y-type olfactometer. After substituting the attraction rate data with the arcsine square root (sqrt), normality and homogeneity of variance tests were performed. One-way ANOVA and Tukey's HSD test were used to analyze significant differences. All statistical analyses were performed using SAS 9.4 software (SAS Institute Inc, Cary, NC, USA), and data visualization was performed using Origin 2021 software (Origin Labs, USA).

[0097] Key results showed that the attraction rates of four common honeycomb products for 1st-2nd instar larvae of the wax moth were in the following order: old honeycomb > beeswax > pollen > honey. Figure 4 Compared to pollen and honey, the larvae of the large wax moth are more easily attracted to old combs and beeswax. However, when faced with both old combs and beeswax simultaneously, the larvae are more likely to be attracted to the old combs. Figure 4 ).

[0098] II. Preparation of lures with high attraction rates for larvae of the large wax moth

[0099] Based on the results of attracting large wax moth larvae using old combs, beeswax, pollen, and honey, as well as the biological characteristics and artificial rearing techniques of the large wax moth, two types of lures were developed.

[0100] The preparation process of lure A is as follows: 400 parts of old nest powder and 200 parts of pollen powder are mixed evenly.

[0101] The preparation process of lure core B is as follows: First, mix 9 parts old honeycomb powder, 3 parts pollen powder and 3 parts milk powder evenly, then add 150 parts of completely melted beeswax solution, then add 7.5 parts honey and stir evenly, then pour into a hand-pressed foundation press to press into sheets.

[0102] After preparing lure A and lure B, the attraction rates of the two lures to 1-2 instar larvae of the large wax moth were determined using a Y-type olfactory instrument. The determination method used was the same as that used to determine the attraction rates of old comb, beeswax, pollen, and honey to 1-2 instar larvae of the large wax moth.

[0103] In addition, to improve the reliability of the results and further determine the attraction rates of lure A and lure B for larvae of the large wax moth, a nutrient-rich artificial diet of large wax moth larvae was placed at point c of the Y-type olfactory instrument as a blank control group. This assay established three experimental groups: lure A vs. artificial diet, lure B vs. artificial diet, and lure A vs. lure B. Each experimental group was repeated three times.

[0104] The results showed that lure A had a significantly higher attraction rate for 1st-2nd instar larvae of the large wax moth than lure B and artificial feed (all P < 0.005). Figure 5 However, there was no significant difference in the attraction rates of lure B and artificial feed for 1st-2nd instar larvae of the large wax moth (P = 0.922). Figure 5 The results above indicate that combining BiotG03, which has highly effective insecticidal activity, with lure A or lure B to control the wax moth is feasible and has great application potential.

[0105] III. Preparation and Application of Biocontrol Plugs for Controlling the Large Wax Moth

[0106] After mating, the female of the large wax moth hides on the outer wall of the hive or in nearby grass and bushes during the day, and enters the hive through the entrance at night to lay eggs mainly in the gaps between the inside and outside of the hive bottom or in the gaps between the partitions. The large wax moth primarily damages the larvae. Newly hatched larvae feed on wax debris at the bottom of the hive, while 1st and 2nd instar larvae climb onto the combs using the ear flaps of the frame. Killing newly hatched larvae at the bottom of the hive from the beginning can fundamentally solve the problem of large wax moth damage and achieve good prevention. Based on the important discovery that old combs and beeswax have a high attraction effect on large wax moth larvae, and considering the biological characteristics of the large wax moth, a biocontrol bait for controlling the large wax moth has been developed. This bait consists of a highly toxic BiotG03, a highly effective lure A, and a contactless bee-trapping device (specifically, the large wax moth trapping device described in the patent document CN215913022U).

[0107] Biological control bait A: Spray 300 mL of BiotG03 suspension with a concentration of 20-200 μg / mL onto lure A, which consists of 400 parts of old honeycomb powder and 200 parts of pollen. Stir thoroughly and let stand overnight at room temperature to allow excess moisture to evaporate, so that the final concentration of BiotG03 in lure A is 10-100 μg / g. Then place lure A containing BiotG03 in a contactless bee trap to complete the preparation of biological control bait A.

[0108] Preparation of biocontrol attractant B: 0.001725-0.01725g of BiotG03 bacterial powder (Bacillus thuringiensis BiotG03 wettable powder is prepared by pre-cooling the prepared spore crystal mixture in an ultra-low temperature freezer at -80℃ for 3 hours, then freeze-drying it in a vacuum freeze dryer (-60℃, 100Pa) for 72 hours to obtain the spore crystal mixture freeze-dried powder, which is the wettable powder) was added to the attractant core B, which was prepared by 150 parts beeswax, 9 parts old honeycomb powder, 3 parts pollen, 3 parts milk powder, and 7.5 parts honey. The core was then pressed into wax sheets (12×5×0.2cm) with a final BiotG03 concentration of 10-100μg / g. The wax sheets were then placed in a contactless bee trapping device to complete the preparation of biocontrol attractant B.

[0109] To preliminarily determine the control efficacy of biocontrol baits A and B against the large wax moth, an environment was simulated under indoor conditions where 1st-2nd instar large wax moth larvae invaded the honeycomb from the bottom of the hive. Biocontrol baits A and B were randomly placed at points a and b at the bottom of the pollination box, respectively, as treatment groups. Baiting devices containing untreated lures A and B were randomly placed at points a and b at the bottom of the pollination box, respectively, as lure control groups, to further determine the attraction rates of lures A and B to the large wax moth. A pollination box without a baiting device at the bottom served as a control group. Three old honeycombs containing a small amount of pollen and honey, after being weighed and treated, were placed in each pollination box of each group. Then, an open petri dish (90mm) containing 48 active 1st-2nd instar large wax moth larvae was placed at the center point c at the bottom of the pollination box. Figure 6To improve the accuracy of the experimental results, all old honeycombs were subjected to a -40°C cryogenic treatment before being placed in the pollination boxes to kill any existing wax moth larvae. The 1st and 2nd instar wax moth larvae used in the experiment were not starved. All pollination boxes were placed in a climate chamber at 30±1°C, 60±5% humidity, and in darkness. Because the 1st and 2nd instar wax moth larvae used in the experiment were relatively small, after successfully invading the honeycomb, they would burrow into the base of the honeycomb to feed, forming tunnels at the base and spinning webs above the cells. Furthermore, daily opening of the hive for inspection could have adverse effects, making it difficult to accurately count the number of surviving or dead wax moth larvae in each group in the early stages. Therefore, based on the developmental stage of the large wax moth larvae, the 30th day was selected as the time point to check the number of surviving large wax moth larvae in all pollination boxes and calculate the larval survival rate of each group. At this time, most of the large wax moth larvae used in the experiment had developed to the final instar or pupated, which could more significantly determine the activity effect of the developed biocontrol attractant on the large wax moth. To obtain more obvious and accurate results, the experimental time was extended to 120 days, and the weight of the old combs in each pollination box of each group was weighed to calculate the loss rate of the old combs in each group. Before weighing, all large wax moth larvae, their excrement, and the silk webs they produced were removed from all combs. Each group was repeated with 3 pollination boxes.

[0110] Based on the indoor activity results of biocontrol baits A and B against the large wax moth, and to achieve the goal of efficient, easy-to-use, and low-cost control of the large wax moth, highly active biocontrol bait A was selected as the test subject for a field efficacy trial against the large wax moth. First, 14 field test sites were selected in the main honeybee-breeding areas of my country. Then, in May 2022, the materials and instructions for preparing biocontrol bait B were mailed to beekeepers at the 14 test sites for trial use. Finally, from November to December 2022, feedback information on the efficacy of biocontrol bait A in controlling the large wax moth was collected from honeybee colonies at the 14 test sites. The collected information was then analyzed to determine the actual field efficacy of the developed biocontrol bait A against the large wax moth.

[0111] To achieve green, safe, and efficient control of the Chinese wax moth, a trapping device was developed based on the moth's damaging habits and beehive structure. This device prevents bees from accessing lure A or lure B containing BiotG03. A biocontrol bait composed of lure A or lure B, BiotG03, and the trapping device was proposed for controlling the Chinese wax moth. To determine whether this biocontrol bait can be applied to beekeeping to control the Chinese wax moth, we simulated an indoor environment where Chinese wax moth larvae invaded a bee colony to measure its activity against the moth. The results showed that 30 days after the invasion of 1st-2nd instar larvae of the large wax moth, the survival rate of the large wax moth in the biocontrol bait treatment group was 2.78%, which was significantly lower than that in the lure control group and the blank control group (which only contained old combs in the pollination box) (all P < 0.001). However, there was no significant difference in the survival rate of the large wax moth in the lure control group and the blank control group, both exceeding 40% (P = 0.3164) (Table 8). In addition, after 120 days, the old comb loss rate in the biocontrol bait treatment group was much lower than that in the lure control group and the blank control group (all P < 0.001) (Table 9); the old comb loss rate in the lure control group was also significantly lower than that in the control group (P = 0.0279) (Table 9). The results clearly showed that the order of old comb loss rate among the groups was: blank control group > lure control group > biocontrol bait treatment group (Table 9; Figure 7 In addition, by Figure 8 It can be seen that in the biocontrol bait treatment group, there were no webs or excrement produced by the larvae of the large wax moth during feeding at the bottom of the baiting device of the two biocontrol baits. This indicates that when the 1st and 2nd instar larvae are attracted by lure A or lure B containing BiotG03 at a concentration of 10-100 μg / g, all larvae will be killed in a very short time, which is a highly efficient baiting effect. In contrast, in the control group containing lures A and B respectively, the bottom of both traps contained silk webs or excrement produced by the larvae of the large wax moth during feeding. Furthermore, the amount of silk webs or excrement remaining at the bottom of the trap containing lure A was significantly greater than that remaining at the bottom of the trap containing lure B. This indicates that lure A is more effective at trapping large wax moths than lure B, which is consistent with the results of using a Y-type olfactory instrument to measure the attraction rates of lures A and B for large wax moth larvae.

[0112] Table 8. Survival rates of the large wax moth in each treatment group after 30 days. Survival rates with the same letter indicate no significant difference (p≥0.05).

[0113] deal with Survival rate of the large wax moth (%) Blank control 61.11(a) Core control 43.06(a) Biological control bait 2.78(b)

[0114] Table 9. Loss rate of old combs in each treatment group after 120 days. Loss rates of old combs with the same letter indicate no significant difference (p≥0.05).

[0115] deal with Old comb loss rate (%) Blank control 48.55(a) Core control 12.21(b) Biological control bait 3.27(c)

[0116] In summary, in a simulated environment of large wax moth larvae infestation in bee colonies, the biocontrol bait A, composed of lure A, BiotG03, and a trapping device, exhibits excellent trapping effects on young large wax moth larvae active at the bottom of the hive but not yet invading the comb. Based on these results, we selected 14 field trial sites in China where Chinese honeybees are raised to determine the actual field control effect of biocontrol bait A on large wax moths. The results show that no feedback regarding large wax moth damage was received from the Chinese honeybee colonies at the 14 field trial sites where biocontrol bait A was used, indicating that our developed biocontrol bait A can effectively control the occurrence of large wax moth damage.

[0117] Summarize

[0118] The large wax moth (Galeriamelonela) is a significant global bee pest, severely hindering the healthy development of beekeeping and bee conservation. While effective control of the large wax moth is urgent, a green, safe, and efficient control strategy is currently lacking. Although we have demonstrated the high insecticidal activity of BiotG03 against large wax moth larvae using a self-developed method for determining drug toxicity, direct application of BiotG03 to honeycomb via spraying or immersion methods as described in previous studies may pose risks to bee safety, contaminate bee products, and easily lead to high levels of pest resistance. Therefore, a new strategy must be developed to achieve green, safe, and efficient control of the large wax moth. Therefore, based on the observation that old honeycomb is more susceptible to attack by wax moth larvae and the damaging habits of the wax moth, we first used a Y-type olfactory instrument to determine the attraction rates of four common honeycomb products—old honeycomb, beeswax, pollen, and honey—to young wax moth larvae. The results showed that old honeycomb and beeswax had a strong attraction effect on wax moth larvae. Then, based on this key discovery, we developed two lures, A and B, which have a high attraction effect on wax moth larvae. Finally, combining the biological characteristics and damaging habits of the wax moth, we developed a biocontrol bait for controlling the wax moth, consisting of highly toxic BiotG03, highly effective lure A, and a contactless bee trapping device. Indoor and field trials showed that the developed biocontrol bait for controlling the wax moth has excellent indoor activity and field efficacy, and can protect bees from the damage caused by the wax moth. In summary, the biocontrol attractant we developed for the large wax moth is a safe and efficient method for controlling the large wax moth using Bacillus thuringiensis. It is also an original new technology with great application potential, which can provide new ideas for the application of Bacillus thuringiensis BiotG03 to control other agricultural pests, reduce pest resistance, and promote green control of bee diseases and pests.

Claims

1. A strain of Bacillus thuringiensis, named Bacillus thuringiensis BiotG03, has the accession number CGMCC No.26127 at the China General Microbiological Culture Collection Center.

2. Application of Bacillus thuringiensis in the preparation of biocontrol attractants for the control of the large wax moth; the Bacillus thuringiensis is Bacillus thuringiensis BiotG03, whose accession number at the China General Microbiological Culture Collection Center is CGMCC No. 26127.

3. A biocontrol attractant for controlling the large wax moth, characterized in that, The device includes a lure made from Bacillus thuringiensis BiotG03 as described in claim 1 and an attractant, and a contactless bee trapping device for placing the lure; the lure is as shown in 1) or 2) below: 1) Lure A: It is made by mixing Bacillus thuringiensis BiotG03 as described in claim 1 and attractant A, wherein attractant A is composed of the following components in the following weight ratio: 400 parts old comb and 200 parts pollen; 2) It consists of lure core A and lure core B; Lure B is prepared by mixing Bacillus thuringiensis BiotG03 as described in claim 1 with attractant B, wherein attractant B is composed of the following components in the following weight ratio: 150 parts beeswax, 9 parts old honeycomb powder, 3 parts pollen, 3 parts milk powder, and 7.5 parts honey.

4. The biocontrol attractant for controlling the large wax moth according to claim 3, characterized in that, The Bacillus thuringiensis BiotG03 accounts for 10~100 µg / g of the inducing core.

5. The biocontrol attractant for controlling the large wax moth according to claim 4, characterized in that, The Bacillus thuringiensis BiotG03 was first prepared into a lyophilized spore-crystal mixture and then mixed with an attractant to form a lure core.

Images