Molecular targets for rapid identification of five bacillus cereus group species and application thereof

Abstract

The application discloses a kind of molecular targets for rapidly identifying five kinds of Bacillus cereus group bacteria and application thereof.The molecular targets are shown as SEQ ID NO.1-5.By analyzing the authenticity of the existing strain classification information, the whole genome sequences of Bacillus anthracis, B.mycoides, B.weihenstephanensis, B megaterium and B.cereus standard strains are sliced according to the recognition requirement of CRISPR / Cas12a, and by comparison, highly conserved and specific target sequences SEQ ID NO.1-5 are screened out, and the experimental strains are verified and screened, including primer design and screening, and PCR-CRISPR / Cas12a fluorescence method experiment is carried out with Bacillus anthracis, B.mycoides, B.weihenstephanensis, B megaterium and B.cereus as templates, to realize accurate identification of five kinds of Bacillus cereus group bacteria.

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of microorganism detection, and particularly relates to a molecular target for rapidly identifying five Bacillus cereus group bacterial species and application thereof. BACKGROUND

[0002] The Bacillus cereus group, also known as Bacillus cereus sensu lato (s.l.), is currently classified as a species complex in the genus Bacillus. The species complex is composed of many closely related intraspecific species, and some species in the group can cause anthrax and anthrax-like diseases, vomiting and diarrhea, and severe gastrointestinal infections. Some bacterial species also have important uses in agriculture and industry. Different bacterial species have different abilities to cause human and animal diseases, and incorrect identification of bacterial species can cause serious potential harm. Therefore, it is important to transform isolated strains into species-level taxonomic units for food safety and public health work. In the current international detection standard for the Bacillus cereus group, in addition to the common Bacillus cereus and Bacillus thuringiensis, five Bacillus species such as the human and animal pathogen Bacillus anthracis, the fungus-like colony-forming Bacillus mycoides, Bacillus weihenstephanensis, the large colony-forming Bacillus megaterium, and the emetic Bacillus cereus producing emetic toxin are also worth our attention.

[0003] The taxonomy of the Bacillus cereus group is complex. Confusion caused by taxonomic ambiguity existed before the widespread use of whole genome sequencing, and new insights generated in the omics era often conflict with each other in proposals for taxonomic changes in this group. Over the past 20 years, many new ideas have been proposed for the B. cereus group, making it difficult to keep up with the conflicting taxonomic issues. Genes that determine part of the phenotype of the B. cereus group are mediated by plasmids, such as anthrax toxin / capsular protein synthesis, biopesticidal crystal protein, and emetic toxin synthesis protein. These features may be lost, acquired, or different within a species, or present in multiple species. According to relevant literature, virulence genes such as anthrax toxin genes and emetic toxin genes are transferred between B. cereus group species, and B. cereus group bacteria may carry related virulence genes but not express them. Therefore, simply identifying the B. cereus group based on whether it carries virulence genes and phenotypes has loopholes, making the identification results incorrect and posing a serious safety hazard. The current authoritative method for typing the B. cereus group is still the traditional biochemical method, which is the national standard method for food microbiological safety testing in China and the United States. However, traditional culture methods are time-consuming and labor-intensive, and are greatly affected by subjective judgments, making them prone to misjudgment and not time-efficient or easy to operate in actual testing. Currently, bacterial taxonomy largely relies on ANI-based methods, with a 0.95 ANI threshold for determining whether it is the same species, which has become the gold standard for species description in the high-throughput sequencing era. However, the past definition of species has led to overlapping gene species clusters, such as emetic B. cereus, which is currently classified as B. cereus. Due to the high consistency of these two bacteria in biochemical phenotypes such as morphological characteristics and ecological habits, emetic B. cereus is determined to be a type of B. cereus with toxin-producing ability. However, in reality, emetic B. cereus and B. cereus have a low average nucleotide similarity, and the ANI value is only close to 0.921 when excluding the influence of plasmids, and should be classified as two different species. In 2017, Liu Yang et al. used phenotypic and phylogenetic data to discover 9 new species of B. cereus s.l., among which B. paranthracis is more similar to emetic B. cereus. Therefore, emetic B. cereus (Bacillus cereulide) is replaced by emetic B. cereus.

[0004] Due to the lack of rapid detection methods for effectively distinguishing Bacillus anthracis, B. mycoides, B. weihenstephanensis, B. megaterium and B. vomitcus worldwide, misjudgment may occur, which brings great security risks to food safety and industry. Therefore, it is urgent to establish an accurate method for distinguishing Bacillus anthracis / B. mycoides / B. weihenstephanensis / B. megaterium / B. vomitcus. With the continuous development of high-throughput sequencing technology, the current genomics-based typing and alignment can achieve the identification of Bacillus anthracis, B. mycoides, B. weihenstephanensis, B. megaterium and B. vomitcus, but this method still needs DNA extraction, second-generation sequencing, downstream bioinformatics analysis, etc., which is time-consuming, high-cost and high-operation requirement, and cannot meet the needs of laboratory routine use and grassroots high-throughput rapid detection.

[0005] Clustered regularly interspaced short palindromic repeats (CRISPR) / CRISPR-associated (Cas) system is an acquired immune system. CRISPR / Cas has the advantages of simple synthesis, easy use and strong specificity. In addition to gene editing, it is currently a hot topic in the field of biosensing. Through the non-specific trans-cleavage function of Cas protein, the CRISPR / Cas system can be easily integrated with various nucleic acid signal amplification technologies, which greatly improves the sensitivity and specificity of the entire detection system. DETECTR based on CRISPR / Cas12a and SHERLOCK based on CRISPR / Cas13a nucleic acid detection methods have been developed, and some long-standing biosensing problems such as poor sensitivity and specificity have been solved. The CRISRP / Cas system has excellent sensitivity for SNP differences compared to other methods. In the past, the differentiation work that often needed to be completed by high-throughput sequencing can now be quickly detected and identified using PCR-CRISPR / Cas fluorescence method, and in recent years, it has been widely used in the ultra-sensitive and rapid detection of pathogens such as the new coronavirus. With the mature development of this strategy in the detection field, it has also been gradually used for ultra-high sensitive detection of foodborne pathogens. SUMMARY

[0006] The first object of the present application is to provide the application of molecular targets HP-BA, HP-BMY, gabR, yloA and NC-3 in the identification of Bacillus anthracis, Bacillus mycoides, Bacillus weihenstephanensis, Bacillus megaterium and Bacillus vomitus for non-disease diagnosis and treatment purposes, the nucleotide sequence of HP-BA is shown as SEQ ID NO. 1, which is used for identifying Bacillus anthracis; the nucleotide sequence of HP-BMY is shown as SEQ ID NO. 2, which is used for identifying Bacillus mycoides; the nucleotide sequence of gabR is shown as SEQ ID NO. 3, which is used for identifying Bacillus weihenstephanensis; the nucleotide sequence of yloA is shown as SEQ ID NO. 4, which is used for identifying Bacillus megaterium; and the nucleotide sequence of NC-3 is shown as SEQ ID NO. 5, which is used for identifying Bacillus vomitus.

[0007] HP-BA, HP-BMY, gabR, yloA and NC-3 are respectively annotated as hypothetical protein, hypothetical protein, HTH-type transcriptional regulatory protein GabR, putative protein YloA and exist in non-coding region. The target sequences are applied to distinguish Bacillus anthracis, Bacillus mycoides, Bacillus weihenstephanensis, Bacillus megaterium and Bacillus vomitus, and the application can effectively distinguish the above five strains in the fields of environment, food and its production chain, clinic and the like.

[0008] The second object of the present application is to provide a primer set for identifying Bacillus anthracis, Bacillus mycoides, Bacillus weihenstephanensis, Bacillus megaterium and Bacillus vomitus for non-disease diagnosis and treatment purposes, and the sequences are as follows:

[0009] HP-BA_F1: 5'-TGTAACCAATATAAAAACGAAACCCAAAGC-3';

[0010] HP-BA_R1: 5'-TCCTTCATATGAGCTATTATAGAACGTTCG-3';

[0011] HP-BMY_F1: 5'-TATCTGTATTTAGGTCTTTATTCAGTAGGG-3';

[0012] HP-BMY_R1: 5'-ACTCGATTAGATGAATTTAGAACGCATCCG-3';

[0013] gabR_F1: 5'-AAATGCGTGTTGTGTACCGAAAGAAGAGAG-3';

[0014] gabR_R1: 5'-ATCCAAGCAATACTGTACTTTTGGGAGAAG-3';

[0015] yloA_F1: 5'-TAAGGATGTGAGCACTATGTCATTTGATGG-3';

[0016] yloA_R1: 5'-ATCCAAGCTGATACACGTGTTCAATAATGC-3';

[0017] NC-3_F2: 5'-TCATAAGGGGGATGTATTGAACAACTATAG-3';

[0018] NC-3_R2: 5'-GCTGGAATCTCAACAATTTAATTACCTTGT-3'.

[0019] The primer set is designed according to the nucleotide sequences shown in SEQ ID NO. 1, SEQ ID NO. 2, SEQ ID NO. 3, SEQ ID NO. 4 and SEQ ID NO. 5, and based on the PCR amplification reaction system and the CRISPR / Cas12a detection system, they can effectively distinguish whether the amplicon containing the molecular target exists or not.

[0020] A third object of the present application is to provide a nucleic acid detection method for rapidly identifying Bacillus anthracis, B. mycoides, B. weihenstephanensis, B. megaterium and B. vomitcus, which comprises the following steps: extracting the genomic DNA of the sample to be tested, using the genomic DNA as a template, using the primer set described above as PCR amplification primers, and using the PCR-CRISPR / Cas12a fluorescence method to rapidly identify whether the amplicon containing the molecular target exists or not, if it exists, the trans-cleavage activity is activated, the reporter probe is cut to produce a fluorescence signal, and B. anthracis, B. mycoides, B. weihenstephanensis, B. megaterium and B. vomitcus are effectively distinguished.

[0021] Preferably, the amplicon containing the molecular target is: an amplicon containing the molecular target HP-BA as shown in SEQ ID NO. 6; an amplicon containing the molecular target HP-BMY as shown in SEQ ID NO. 7; an amplicon containing the molecular target gabR as shown in SEQ ID NO. 8; an amplicon containing the molecular target yloA as shown in SEQ ID NO. 9; an amplicon containing the molecular target NC-3 as shown in SEQ ID NO. 10.

[0022] Preferably, the PCR-CRISPR / Cas12a fluorescence method, the PCR reaction system comprises: Taq DNA Polymerase, sample DNA to be detected, primer pair, sterilized double distilled water; the CRISPR / Cas12a detection system comprises Cas12a buffer, Cas12a protein, crRNA, FQ-ssDNA and PCR amplification product.

[0023] Preferably, the PCR reaction system is 2x Taq DNA Polymerase 10 μL, 50 ng of sample DNA to be detected, 1 μL of 10 μM upper and lower primers, and sterilized double distilled water to make up the volume to 20 μL; the CRISPR / Cas12a detection system is 10x Cas12a buffer 2 μL, amplification product 1 μL, 10 μM Cas12a protein 0.2 μL, 10 μM crRNA 0.6 μL, 10 μM FQ-ssDNA 1.2 μL, DEPC water to make up the volume to 20 μL.

[0024] Preferably, the PCR-CRISPR / Cas12a fluorescence method first uses a three-step method for PCR on a Thermal Cycler, and the reaction program is: 95℃ pre-denaturation for 5min; 95℃ denaturation for 10s; 55℃ annealing for 20s, 72℃ extension for 10s, a total of 30 cycles; then constant temperature reaction on a LightCycler96, and the CRISPR / Cas12a detection reaction program is: 37℃ incubation for 40s; 37℃ incubation and real-time monitoring of FAM fluorescence signal for 40s, a total of 30 cycles.

[0025] A fourth object of the present application is to provide a kit for identifying Bacillus anthracis, Bacillus mycoides, Bacillus weihenstephanensis, Bacillus megaterium and Bacillus vomitus for non-disease diagnosis and treatment purposes, which comprises the primer set described above.

[0026] A fifth object of the present application is to provide the use of the primer set described above, the nucleic acid detection method described above, or the kit described above in the identification of Bacillus anthracis, B. mycoides, B. weihenstephanensis, B. megaterium and B. vomitcus for non-disease diagnosis and treatment purposes.

[0027] A sixth object of the present application is to provide a method for accurately screening and distinguishing new molecular targets of Bacillus anthracis, B. mycoides, B. weihenstephanensis, B. megaterium and B. vomitcus, comprising the following steps:

[0028] (1) Database of B. cereus group strains including B. anthracis, B. mycoides, B. weihenstephanensis, B. megaterium and B. vomitcus genome download, de-redundancy and genome annotation using Prokka software;

[0029] (2) Verification analysis of the authenticity of the classification information of B. cereus group strain genomes: average nucleotide homology analysis, using existing international reference strains of B. cereus group or closely related species as standard strains of B. cereus group, comparing the whole genome similarity of unknown strains with standard strains, selecting the highest similarity with the above standard strains, and preliminarily considering the unknown strain as the species; ribosomal protein multilocus sequence typing analysis using PhyloSuite software, extracting ribosomal protein genes and concatenating them, constructing a maximum likelihood tree, confirming the strain species identity, and constructing a real identity verification B. cereus local alignment library using whole genome sequences;

[0030] (3) Screening of new molecular targets for distinguishing B. anthracis, B. mycoides, B. weihenstephanensis, B. megaterium and B. vomitcus: slicing the whole genome sequence of the obtained authentic B. anthracis, B. mycoides, B. weihenstephanensis, B. megaterium and B. vomitcus reference strain according to the requirement of Cas12a protein recognizing PAM sequence, extracting nucleic acid sequences of 27 nt continuous starting with TTN or TTTV, performing Blast of all extracted sequences with the local alignment library, screening out sequences that only match B. anthracis, B. mycoides, B. weihenstephanensis, B. megaterium and B. vomitcus through scripts, and finally verifying through intra-group species experiments.

[0031] The application collects a large number of public databases and previous research Bacillus cereus group strain genomes, and carries out authenticity confirmation analysis on existing strain classification information, slices Bacillus anthracis, Bacillus mycoides, Bacillus weihenstephanensis, Bacillus megaterium and Bacillus cereulide through the CRISPR / Cas12a recognition requirement of the whole genome sequence, and obtains a target sequence fragment completely specific to the corresponding bacterial species through comparative genomics, then carries out primer pair design and screening, and finally carries out PCR-CRISPR / Cas12a fluorescence method experiment with the whole genome of Bacillus anthracis, Bacillus mycoides, Bacillus weihenstephanensis, Bacillus megaterium and Bacillus cereulide as a template, so as to realize accurate identification of Bacillus anthracis, Bacillus mycoides, Bacillus weihenstephanensis, Bacillus megaterium and Bacillus cereulide.

[0032] The application carries out sequence alignment screening on the slice candidate sequence, designs primers and carries out verification, carries out PCR-CRISPR / Cas12a fluorescence method experiment with the whole genome of Bacillus anthracis, Bacillus mycoides, Bacillus weihenstephanensis, Bacillus megaterium and Bacillus cereulide as a template, so as to realize effective identification of Bacillus anthracis, Bacillus mycoides, Bacillus weihenstephanensis, Bacillus megaterium and Bacillus cereulide. Based on the PCR-CRISPR / Cas12a fluorescence method, compared with qPCR, no sequence-specific probe is needed, the whole process is simple to operate, not only has the advantages of high sensitivity, good specificity, low cost, fast detection speed and the like, but also is convenient to operate. BRIEF DESCRIPTION OF DRAWINGS

[0033] Figure 1 For phylogenetic tree analysis of Bacillus anthracis / Bacillus mycoides / Bacillus weihenstephanensis / Bacillus megaterium / Bacillus cereulide based on rMLST.

[0034] Figure 2 For phylogenetic tree analysis of Bacillus anthracis, Bacillus mycoides, Bacillus weihenstephanensis, Bacillus megaterium and Bacillus cereulide based on HP-BA, HP-BMY, gabR, yloA and NC-3 target sequence.

[0035] Figure 3 For phylogenetic tree analysis of Bacillus anthracis, Bacillus mycoides, Bacillus weihenstephanensis, Bacillus megaterium and Bacillus cereulide based on HP-BA, HP-BMY, gabR, yloA and NC-3 target sequence.

[0036] Figure 4 For distinguishing B. anthracis, B. mycoides, B. weihenstephanensis, B. megaterium and B. vomerius based on PCR-agarose gel electrophoresis method, A, B, C, D and E are respectively amplified using HP-BA_F1 / R1, HP-BMY_F1 / R1, gabR_F1 / R1, yloA_F1 / R1 and NC-3_F2 / R2 primer pairs.

[0037] Figure 5 For specific identification of B. anthracis, B. mycoides, B. weihenstephanensis, B. megaterium and B. vomerius based on PCR-CRISPR / Cas12a fluorescence method, wherein A, B, C, D and E are respectively HP-BA, HP-BMY, gabR, yloA and NC-3 target sequences.

[0038] Figure 6 For sensitivity detection of B. anthracis based on PCR-CRISPR / Cas12a fluorescence method, Figure 6 A, B are respectively fluorescence intensity curve and correlation analysis of plasmid concentration carrying HP-BA and fluorescence intensity, C in the legend is 0 CFU / mL.

[0039] Figure 7 For sensitivity detection of B. mycoides, B. weihenstephanensis, B. megaterium and B. vomerius based on PCR-CRISPR / Cas12a fluorescence method, Figure 7 A, B, C and D are respectively correlation analysis of colony forming units and fluorescence intensity of B. mycoides, B. weihenstephanensis, B. megaterium and B. vomerius under pure culture mode, C in the legend is 0 CFU / mL. DETAILED DESCRIPTION

[0040] The present application will be described in detail below with specific examples and their accompanying drawings. The following examples are further illustrations of the present application, but are not limitations of the present application.

[0041] Example 1:

[0042] 1. Based on the GenBank Bacillus cereus group or related species genomes and existing Bacillus anthracis, B. mycoides, B. weihenstephanensis, B. megaterium and B. vomitius, genome download, remove redundant and non-compliant genomic data (contigs≥200) for analysis, modify the genome name, and use Prokka software for genome annotation. Bacillus cereus group strain genome classification information authenticity verification analysis: First, ANI analysis is performed, and 14 reference strains of Bacillus cereus group species that are recognized as new species and are considered valid publications by the International Prokaryote Nomenclature and have a certain sample size on the NCBI public data are selected as standard strains of the Bacillus cereus group (Table 1); the whole genome similarity of unknown strains and standard strains is compared and analyzed, and the highest similarity with the above standard strains is selected, and the unknown strain is preliminarily considered to be the species; ribosomal multilocus sequence typing (rMLST) analysis is performed using PhyloSuite software, 53 ribosomal protein genes (Table 2) are extracted and concatenated, and a maximum likelihood tree is constructed. The strains with consistent evolutionary relationships and ANI analysis results are the confirmed identity clear Bacillus anthracis / B. mycoides / B. weihenstephanensis / B. megaterium / B. vomitius. Figure 1 ). For example, Figure 1As shown, different colors represent different Bacillus, and based on the rMLST method, B. anthracis, B. mycoides, B. weihenstephanensis, B. megaterium and B. vomitcus strains can be effectively distinguished. Screening candidate target genes for distinguishing B. anthracis, B. mycoides, B. weihenstephanensis, B. megaterium and B. vomitcus: The obtained B. anthracis, B. mycoides, B. weihenstephanensis, B. megaterium and B. vomitcus with true identity information were subjected to pan-genome analysis using Roary software, and the threshold (Identity) was set to 95%. Screening new molecular target sequences for distinguishing B. anthracis, B. mycoides, B. weihenstephanensis, B. megaterium and B. vomitcus from candidate target genes: The obtained B. anthracis, B. mycoides, B. weihenstephanensis, B. megaterium and B. vomitcus whole genome sequences with true identity information were sliced according to the requirement of PAM sequence recognition by Cas12a protein, and nucleic acid sequences of 27 nt continuous starting with TTN or TTTV were extracted. All extracted sequences were subjected to Blast with local alignment library (based on strain genome identified with true identity on NCBI), and sequences only matching B. anthracis, B. mycoides, B. weihenstephanensis, B. megaterium and B. vomitcus were screened out by script, and verified by intragroup experiment with bacteria. The nucleotide sequences are as follows, SEQ ID NO. 1 is the HP-BA nucleotide sequence of B. anthracis (such as B. anthracis Ames), SEQ ID NO. 2 is the HP-BMY nucleotide sequence of B. mycoides (such as B. mycoides DSM 2048), SEQ ID NO. 3 is the gabR nucleotide sequence of B. weihenstephanensis (such as B. weihenstephanensis WSBC 10204), SEQ ID NO. 4 is the yloA nucleotide sequence of B. megaterium (such as B. megaterium ATCC 14581), and SEQ ID NO. 5 is the NC-3 nucleotide sequence of B. vomitcus (such as B. vomitcus F4810 / 72).

[0043] SEQ ID NO. 1

[0044] ttataccgttatgaactattgaac

[0045] SEQ ID NO. 2

[0046] tttcaccttaagggatggtcgtgaaa

[0047] SEQ ID NO. 3

[0048] ttccggcctacatattttattaaaag

[0049] SEQ ID NO. 4

[0050] tttaatctcagctcaccctaactatt

[0051] SEQ ID NO. 5

[0052] tttggatattccgaaaaatttatatat

[0053] Table 1. 14 reference strains of international current B. cereus group and related species

[0054]

[0055]

[0056] 2. According to the gene sequences of B. anthracis, B. mycoides, B. weihenstephanensis, B. megaterium and B. vomitcus provided on GenBank and the existing sequencing completed, the difference target fragments HP-BA, HP-BMY, gabR, yloA, NC-3 are mined by slice alignment screening of whole genome sequence, and the primers are designed and screened based on the target sequence.

[0057] The specific primers are as follows:

[0058] HP-BA_F1: 5'-TGTAACCAATATAAAAACGAAACCCAAAGC-3' (SEQ ID NO. 11);

[0059] HP-BA_R1: 5'-TCCTTCATATGAGCTATTATAGAACGTTCG-3' (SEQ ID NO. 12);

[0060] HP-BMY_F1: 5'-TATCTGTATTTAGGTCTTTATTCAGTAGGG-3' (SEQ ID NO. 13);

[0061] HP-BMY_R1: 5'-ACTCGATTAGATGAATTTAGAACGCATCCG-3' (SEQ ID NO. 14);

[0062] gabR_F1: 5'-AAATGCGTGTTGTGTACCGAAAGAAGAGAG-3' (SEQ ID NO. 15);

[0063] gabR_R1: 5'-ATCCAAGCAATACTGTACTTTTGGGAGAAG-3' (SEQ ID NO. 16);

[0064] yloA_F1 : 5'-TAAGGATGTGAGCACTATGTCATTTGATGG-3' (SEQ ID NO. 17);

[0065] yloA_R1 : 5'-ATCCAAGCTGATACACGTGTTCAATAATGC-3' (SEQ ID NO. 18);

[0066] NC-3_F2: 5'-TCATAAGGGGGATGTATTGAACAACTATAG-3' (SEQ ID NO. 19);

[0067] NC-3_R2: 5'-GCTGGAATCTCAACAATTTAATTACCTTGT-3' (SEQ ID NO. 20).

[0068] The amplification product is the nucleotide sequence shown as SEQ ID NO. 6 in Bacillus anthracis, the nucleotide sequence shown as SEQ ID NO. 7 in B. mycoides, the nucleotide sequence shown as SEQ ID NO. 8 in B. weihenstephanensis, the nucleotide sequence shown as SEQ ID NO. 9 in B. megaterium, and the nucleotide sequence shown as SEQ ID NO. 10 in B. vomerius by using this primer pair.

[0069] SEQ ID NO. 6

[0070] tgtaaccaatataaaaacgaaacccaaagcttacccatttgtcagcaagcccatgaaaagaatcttcaataaattaatcaagttgaatgaaaactttaccgaatccgattctatgagcttatcaatgctaacaaaaagtttataccgttatgaactattgaacactgagttggaagagctagagatattcgacgagctttctgtggatctggaaaaacgtattcatgcttacgaacgttctataatagctcatatgaagga

[0071] SEQ ID NO. 7

[0072] TATCTGTATT TAGGTCTTT ATT CAGTAGGGA ACTTATTGTTTTTGTATTT GAAGGTTATAAATATGTATAGCAATAGCAAT AAAATGAAATGTGAATT TAAATATT TAGGAGAGTGTATGATGGGATATCTAAGAGTTTTCACCTTAAGGGATGGTCGTGAAAAAGCAATAATAGTAGAGCCATGGCGTTATT TAAAGAAGAAATGAATGTTTTAGGAATCAAAGATT CGGATGC GTCTAAATTCATCTAATCGAGT

[0073] SEQ ID NO. 8

[0074] AAATGC GTGTGTGTACC GAAAGAAGAGAGACC GTCTT GTTTT CGGTATTAGAAAAATATTTTTCTAATCGCATTGAAGTAATAGGGGAAGATTC CGGCCTACATATT TTATT AAAAGTGCATAATGGGATGGAAGAGAAAGAATTAATGGAAGCTGCAGCTGAAAGGA GTATTAAAGTGTATCCTGCTTCGATATATTATAAGGAAGGGACTTCTCCCAAAGTACAGTATTGCTTGGAT

[0075] SEQ ID NO. 9

[0076] TAAGGATGTGAGC ACTATGTCATTTGATGGTATTTTTACATATGGCATT TTACAAGAATTATCTGAGACCTTGGTTTCAGGACGAATTTCAAAAATATATCAGCCGTTTCCAAACGAGTTGATTTTACAAGTACGCGCTAAAGGTGAAAACCGCAA CTTTT AATCTCAGCTCACCCTA ACTATT CACGC GTTCATTTTACAAATGAGCCCTATGAAAATCCATCTGAGCCTCCTATGTTTTGTATGCTGCTTCGCA AACATTTAGAAGGAAGCATTATTGAACACGTGTATCAGCTTGGAT

[0077] SEQ ID NO. 10

[0078] tcataagggggatgtattgaacaactatagttataaagggttaggtatttggatattccgaaaaatttatatatagatcatagagaataaaggtgcagtcttttcttataataggaagcatatttggagaggataggtaaattttcacatgaagaagaggatttttatgatggttaagcttataatttgaattttacaaggtaattaaattgttgagattccagc

[0079] 3. Construct pUC19 derived plasmid containing B. anthracis target gene group 8826 by conventional method (prepared by Huada Gene, enzyme cutting sites are BamH I and EcoR I respectively) and transfer into E. coli DH5a, extract pUC19 derived plasmid carrying B. anthracis target gene group 8826 from 1 mL E. coli DH5a by using plasmid rapid extraction kit (Guangzhou Meibio Biotechnology Co., Ltd.) according to the instruction, extract whole genome DNA from 1 mL B. mycoides LMG 7128 culture solution, 1 mL B. weihenstephanensis LMG 18989 culture solution, 1 mL B. megaterium MCCC 1A14811 and 1 mL B. vomerius F4810 / 72 culture solution respectively by using HiPure Bacterial DNA Kit D3146-03 (Guangzhou Meibio Biotechnology Co., Ltd.) according to the instruction, and use Thermo Scientific GeneJET PCR Purification Kit (K0701) to purify the PCR products according to the instruction. TM NanoDrop TM One super-micro ultraviolet-visible spectrophotometer is used to detect the concentration and purity of the genomic DNA.

[0080] The nucleotide sequence of group_8826 is as follows (SEQ ID NO. 21):

[0081] atgggaaatgcggttaaatcagtcgctcaagtgaaacaaaagatgtcaaaagatactcgtgaagcaagaattgaagcggaaaaacaagttgtaaccaatataaaaacgaaacccaaagcttacccatttgtcagcaagcccatgaaaagaatcttcaataaattaatcaagttgaatgaaaactttaccgaatccgattctatgagcttatcaatgctaacaaaaagtttataccgttatgaactattgaacactgagttggaagagctagagatattcgacgagctttctgtggatctggaaaaacgtattcatgcttacgaacgttctataatagctcatatgaaggacttgtgtattccattatctcaacgtttacgattaagtaacgatatagctaaattgatgattgaagagaaaaaactggaacagatgaatcaacaaaataatcaagctatcaatccactgatggcattactggaggaggatgacgatgaataa

[0082] 4. To preliminarily explore the effect of the designed primers on the identification of Bacillus anthracis / Bacillus mycoides / Bacillus weihenstephanensis / Bacillus megaterium / Bacillus cereus, phylogenetic tree analysis was performed based on the HP-BA, HP-BMY, gabR, yloA and NC-3 sequences (SEQ ID NO. 1-5) and their amplicons (SEQ ID NO. 6-10) Figure 2 and Figure 3 According to the neighbor-joining method, the phylogenetic tree analysis was performed from Figure 2 and Figure 3 The difference sequences HP-BA, HP-BMY, gabR, yloA and NC-3 can effectively distinguish Bacillus anthracis / Bacillus mycoides / Bacillus weihenstephanensis / Bacillus megaterium / Bacillus cereus.

[0083] 5. After accurately identifying Bacillus anthracis / Bacillus mycoides / Bacillus weihenstephanensis / Bacillus megaterium / Bacillus cereus, PCR-CIRSPR / Cas12a specific detection was performed based on the target sequences HP-BA, HP-BMY, gabR, yloA and NC-3 and other standard strains (Table 3) according to the following steps:

[0084] The concentration of the gene forward primer solution and the reverse primer solution is 10 μM, and the PCR tube is added with 2 × Taq DNA Polymerase 10 μL, HP-BA_F1, HP-BMY_F1, gabR_F1, yloA_F1 or NC-3_F2 target sequence forward primer 1 μL, HP-BA_R1, HP-BMY_R1, gabR_R1, yloA_R1 or NC-3_R2 reverse primer 1 μL, 10 ng of plasmid or 50 ng of genomic DNA in step 3 in different reaction wells, and sterile water as a negative control, and each reaction well is supplemented with sterile water to 20 μL; PCR is carried out on Bio-Rad Thermal Cyclers by three-step method, and the reaction program is as follows: 95 ℃ pre-denaturation for 5 min, one cycle; 95 ℃ denaturation for 10 s; 55 ℃ annealing for 20 s, 72 ℃ extension for 10 s, a total of 30 cycles; 1 g of agarose powder is weighed and added into 50 mL of 1 × TBE buffer, heated and dissolved, and then cooled, and electrophoresis is carried out at 140 V for 25 min, and ChemiDoc MP gel imaging system is used for shooting, which proves that the target sequence primer pair can effectively realize the amplification of the fragments of Bacillus anthracis, B. mycoides, B. weihenstephanensis, B. megaterium and B. vomeris ( Figure 4

[0085] In each reaction well of the eight-tube tube, 10 × Cas12a buffer (500 mM NaCl, 100 Mm Tris-HCl, 100 mM MgCl2, 100 μg / mL BSA, pH 7.9) 2 μL, 10 μM Cas12a protein 0.2 μL, 10 μM crRNA 0.6 μL, 10 μM FQ-ssDNA (5'-FAM-TTATT-BHQ2-3') 1.2 μL, DEPC water to 19 μL, and in different reaction wells, 1 μL of the amplification product of the previous step PCR (with no amplification product, and 1 μL of DEPC water as a negative control) is added; the reaction is carried out on LightCycler96 at constant temperature, and the CRISPR / Cas12a detection reaction program is as follows: 37 ℃ incubation for 40 s; 37 ℃ incubation and real-time monitoring of FAM fluorescence signal for 40 s, a total of 30 cycles.

[0086] The crRNA is synthesized by Shanghai Genechem Co., Ltd., and the specific sequence is as follows:

[0087] HP-BA_crRNA: UAAUUUCUACUAAGUGUAGAUUACCGUUAUGAACUAUUGAAC;

[0088] ​​HP-BMY_crRNA: UAAUUUCUACUAAGUGUAGAUACCUUAAGGGAUGGUCGUGAA; gabR_crRNA: UAAUUUCUACUAAGUGUAGAUCGGCCUACAUAUUUUAUUAAA;

[0089] yloA_crRNA: UAAUUUCUACUAAGUGUAGAUAUCUCAGCUCACCCUAACUAU;

[0090] NC-3_crRNA: UAAUUUCUACUAAGUGUAGAUGAUAUUCCGAAAAAUUUAUAU;

[0091] Table 3 introduces the standard strains used in the experiment. The FAM fluorescence signal read for 20 min proves that the identification of Bacillus anthracis, B. mycoides, B. weihenstephanensis, B. megaterium and B. vomitcus can be effectively realized ( Figure 5 ) with good specificity.

[0092] Table 3 PCR-CRISPR / Cas12a fluorescence method fluorescence curve experiment standard strain information

[0093]

[0094] 6. After accurately identifying Bacillus anthracis, B. mycoides, B. weihenstephanensis, B. megaterium and B. vomitcus, the sensitivity detection is carried out based on HP-BA according to the PCR-CRISPR / Cas12a detection method of step 5. When detecting the pUC19 derived plasmid carrying the target gene group 8826 of Bacillus anthracis with different gradient dilutions, the linear detection range of this method for Bacillus anthracis is 1.03x10 -15 mol / L to 1.03x10 -11 mol / L ( Figure 6 ); based on the sensitivity detection of HP-BMY, gabR, yloA and NC-3 target sequences, the standard strains of B. mycoides LMG 7128, B. weihenstephanensis LMG18989, B. megaterium MCCC 1A14811 or B. vomitcus F4810 / 72 are diluted by 10 times, and the amount of colony DNA template in different unit volumes is detected. The linear detection range of this method for B. mycoides is 1.6x10 1 CFU / mL to 1.6x10 7 CFU / mL, for B. weihenstephanensis bacillus, the linear detection range is 1.1x10 3 CFU / mL to 1.1x10​​7 CFU / mL, the linear detection range for B. megaterium was 1.8 x 10 1 CFU / mL ~ 1.8 x 10 7 CFU / mL, the linear detection range for B. emeticus was 2.5 x 10 2 CFU / mL ~ 2.5 x 10 7 CFU / mL( Figure 7 ).

Claims

1. Molecular targets HP-BA, HP-BMY gabR , yloA The identification of Bacillus anthracis (Bacillus anthracis) and NC-3 for non-disease diagnostic and / or therapeutic purposes. Bacillus anthracis ), Bacillus mycosisviridae ( Bacillus mycoides ), Bacillus velutipes ( Bacillus weihenstephanensis ), Bacillus megaterium ( Bacillus megaterium ) and emetic Bacillus cereus Bacillus cereus Its application in ) is characterized by, The nucleotide sequence of HP-BA is shown in SEQ ID NO. 1, and it is used to identify Bacillus anthracis (…). Bacillus anthracis The nucleotide sequence of HP-BMY is shown in SEQ ID NO.2 and is used to identify Bacillus mycoides ( ). Bacillus mycoides ); gabR The nucleotide sequence is shown in SEQ ID NO. 3 and is used to identify Bacillus velutipes (Bacillus verrucosa). Bacillus weihenstephanensis ); yloA The nucleotide sequence is shown in SEQ ID NO.4 and is used to identify Bacillus megaterium (Bacillus megaterium). Bacillus megaterium The nucleotide sequence of NC-3 is shown in SEQ ID NO.5 and is used to identify *Bacillus cereus*, a bacterium that causes vomiting. Bacillus cereus ).

2. A rapid identification method for non-disease diagnostic and / or therapeutic purposes of Bacillus anthracis (Bacillus anthracis) Bacillus anthracis ), Bacillus mycosisviridae ( Bacillus mycoides ), Bacillus velutipes ( Bacillus weihenstephanensis ), Bacillus megaterium ( Bacillus megaterium ) and emetic Bacillus cereus Bacillus cereus The nucleic acid detection method of ) is characterized by, Includes the following steps: Genomic DNA was extracted from the sample to be tested. Using the genomic DNA as a template and the primer set as PCR amplification primers, the presence of an amplicon containing the molecular target was rapidly identified using the PCR-CRISPR / Cas12a fluorescence method. If present, the trans-cleavage activity was activated, cleaving the reporter probe and generating a fluorescent signal, which was effective against Bacillus anthracis (Bacillus). Bacillus anthracis ), Bacillus mycosisviridae ( Bacillus mycoides ), Bacillus velutipes ( Bacillus weihenstephanensis ), Bacillus megaterium ( Bacillus megaterium ) and emetic Bacillus cereus Bacillus cereus To effectively distinguish, The primer sequence is as follows: HP-BA_F1: 5'-TGTAACCAATATAAAAACGAAACCCAAAGC-3'; HP-BA_R1: 5'-TCCTTCATATGAGCTATTATAGAACGTTCG-3'; HP-BMY_F1: 5'-TATCTGTATTTAGGTCTTTATTCAGTAGGG-3'; HP-BMY_R1: 5'-ACTCGATTAGATGAATTTAGAACGCATCCG-3'; gabR _F1: 5'-AAATGCGTGTTGTGTACCGAAAGAAGAGAG-3'; gabR _R1:5’-ATCCAAGCAATACTGTACTTTTGGGAGAAG-3’; yloA _F1:5’-TAAGGATGTGAGCACTATGTCATTTGATGG-3’; yloA _R1:5’-ATCCAAGCTGATACACGTGTTCAATAATGC-3’; NC-3_F2: 5'-TCATAAGGGGGATGTATTGAACAACTATAG-3'; NC-3_R2: 5'-GCTGGAATCTCAACAATTTAATTACCTTGT-3'; The molecular targets are HP-BA and HP-BMY. gabR , yloA The nucleotide sequences of NC-3 and HP-BA are shown in SEQ ID NO.1, and the nucleotide sequence of HP-BMY is shown in SEQ ID NO.

2. gabR The nucleotide sequence is shown in SEQ ID NO.

3. yloA The nucleotide sequence of NC-3 is shown in SEQ ID NO.4, and the nucleotide sequence of NC-3 is shown in SEQ ID NO.

5.

3. The nucleic acid detection method according to claim 2, characterized in that, The amplicon containing the molecular target is as follows: an amplicon containing the molecular target HP-BA, as shown in SEQ ID NO. 6; an amplicon containing the molecular target HP-BMY, as shown in SEQ ID NO. 7; and an amplicon containing the molecular target... gabR The amplicon is shown in SEQ ID NO. 8; it contains a molecular target. yloA The amplicon containing the molecular target NC-3 is shown in SEQ ID NO.9; the amplicon containing the molecular target NC-3 is shown in SEQ ID NO.

10.

4. The nucleic acid detection method according to claim 2, characterized in that, The PCR-CRISPR / Cas12a fluorescence method comprises the following PCR reaction system: Taq DNA Polymerase, DNA of the sample to be tested, primer pairs, and sterile double-distilled water; and the CRISPR / Cas12a detection system comprises Cas12a buffer, Cas12a protein, crRNA, FQ-ssDNA, and PCR amplification products.

5. The nucleic acid detection method according to claim 4, characterized in that, The PCR reaction system consisted of 10 μL of 2×TaqDNA Polymerase, 50 ng of sample DNA, 1 μL each of 10 μM upstream and downstream primers, and sterile double-distilled water to a final volume of 20 μL. The CRISPR / Cas12a detection system consisted of 2 μL of 10×Cas12a buffer, 1 μL of amplification product, 0.2 μL of 10 μM Cas12a protein, 0.6 μL of 10 μM crRNA, 1.2 μL of 10 μM FQ-ssDNA, and DEPC water to a final volume of 20 μL.

6. The nucleic acid detection method according to claim 2, characterized in that, The PCR-CRISPR / Cas12a fluorescence method described above first involves a three-step PCR process on a Thermal Cyclers device. The reaction program is as follows: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 10 s; annealing at 55°C for 20 s; and extension at 72°C for 10 s, for a total of 30 cycles. The reaction is then carried out at a constant temperature on a LightCycler96 device.

7. The nucleic acid detection method according to any one of claims 2-6 for the identification of Bacillus anthracis (Bacillus) for non-disease diagnosis and / or treatment purposes. Bacillus anthracis ), Bacillus mycosisviridae ( Bacillus mycoides ), Bacillus velutipes ( Bacillus weihenstephanensis ), Bacillus megaterium ( Bacillus megaterium ) and emetic Bacillus cereus Bacillus cereus Applications in ).

Images