An SNP molecular marker, detection primer, kit, detection method and application related to the tall and short leg traits of Leizhou goats
By using SNP molecular markers and PCR-RFLP analysis related to high-blank traits in Leizhou goat breeding, the problem of difficult to quickly screen and identify high-blank traits in the prior art is solved, early screening and identification are achieved, and breeding efficiency is improved.
Patent Information
- Application Number
- CN202410916922.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-07-09
- Publication Date
- 2025-07-25
- Estimated Expiration
- 2044-07-09
AI Technical Summary
The prior art is difficult to quickly and effectively screen and identify high-blank traits in Leizhou goat breeding, resulting in low breeding efficiency.
Using SNP molecular markers related to the high-blank traits of Leizhou goats, PCR-RFLP analysis was performed through detection primer pairs and restriction endonuclease HpaI to achieve early screening and identification of Leizhou goat genotype.
Early screening and identification of high-blank traits in Leizhou goats was achieved, shortening the breeding generation interval and improving breeding efficiency.
Smart Images

Figure CN118638939B_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of goat breeding, and specifically relates to an SNP molecular marker, a detection primer, a kit, a detection method and an application related to the tall and short leg traits of Leizhou goats. Background Art
[0002] Leg length is one of the important traits affecting the production performance and economic benefits of goats. Leg length is not only related to the locomotor ability and adaptability of goats, but also closely related to aspects such as their meat quality and fecundity. Therefore, exploring the genetic basis of the leg length trait in goats is of great significance for optimizing goat breeding and improving breeding efficiency. In the Leizhou goat population, there are tall leg groups and short leg groups. The tall leg groups are larger in size, good at walking and jumping, mostly produce single lambs, like to eat shrub branches and leaves, and are suitable for grazing. The short leg groups are smaller in size, mostly produce twin lambs, and are suitable for stall feeding. Therefore, in Leizhou goats, the short leg groups have more advantages than the tall leg groups. They are suitable for stall feeding, and with the increase of the selection intensity, the twin lamb rate shows an increasing trend, and the survival rate of twin lambs can reach more than 90%, which is deeply welcomed by breeders and the public. Breeders also consciously choose short leg Leizhou goats to meet the production needs. It can be seen that the tall or short body type of Leizhou goats is one of the important traits affecting their economic value, and breeding short leg Leizhou goats has greater economic benefits. The breeding technology with molecular marker-assisted selection as the core can directly select the genotypes of leg length traits at the molecular level, thereby overcoming the disadvantages of conventional breeding, such as long time consumption and poor effect, and can quickly improve breeding efficiency. Therefore, using molecular marker-assisted selection technology to screen can conduct early selection on leg length traits, thereby shortening the generation interval and accelerating the breeding progress. Therefore, mining molecular markers related to the tall and short legs of Leizhou goats is of great significance for the breeding of Leizhou goat breeds. Summary of the Invention
[0003] The purpose of the present invention is to provide an SNP molecular marker, a detection primer, a kit, a detection method and an application related to the tall and short leg traits of Leizhou goats. By using the SNP molecular marker, the identification of the tall and short leg traits of Leizhou goats can be realized, and the breeding of Leizhou goat breeds can be realized.
[0004] The present invention provides an SNP molecular marker related to the tall and short leg traits of Leizhou goats, and the sequence of the SNP molecular marker is as shown in SEQ ID NO.1, wherein the 260th base is T or C.
[0005] Preferably, the SNP molecular marker of the CC mutation homozygous type corresponds to the short leg trait of Leizhou goats, and the SNP molecular marker of the TT wild homozygous type corresponds to the tall leg trait of Leizhou goats.
[0006] The present invention also provides a primer pair for amplifying the SNP molecular marker described in the above technical solution, and the nucleotide sequences of the primer pair are shown in SEQ ID NO.2 and SEQ ID NO.3 respectively.
[0007] The present invention also provides a kit containing the primer pair described in the above technical solution.
[0008] Preferably, when the kit is a restriction fragment length polymorphism polymerase chain reaction kit, the kit further includes a restriction endonuclease, and the restriction endonuclease is HpaI.
[0009] The present invention also provides the application of the reagent for detecting the SNP molecular marker described in the above technical solution in the early screening or identification of the tall or short leg traits of Leizhou goats.
[0010] Preferably, the reagent includes the primer pair described in the above technical solution, or the kit described in the above technical solution.
[0011] The present invention also provides a method for detecting the tall and short leg traits of Leizhou goats, including the following steps: using the genome of Leizhou goats as a template, amplifying with the reagent for detecting the SNP molecular marker described in the above technical solution, and detecting the genotype.
[0012] The present invention also provides a method for detecting the tall and short leg traits of Leizhou goats based on restriction fragment length polymorphism polymerase chain reaction, including the following steps: using the genome of Leizhou goats as a template, amplifying with the primer pair described in the above technical solution to obtain a gene containing a mutation site;
[0013] Using the gene containing the mutation site as a template, performing enzyme digestion with the restriction endonuclease HpaI, and performing electrophoresis to obtain a genotype result.
[0014] Preferably, each 30 μL of the reaction system for the enzyme digestion includes: 2 μL of 10×FuniCut@Buffer, 1 μL of FuniCut@HpaI, 10 μL of the gene template containing the mutation site, and 17 μL of ddH2O; the reaction conditions for the enzyme digestion are: 37°C, 30 min.
[0015] The present invention provides an SNP molecular marker related to the tall and short leg traits of Leizhou goats. By detecting the SNP molecular marker related to the tall and short leg traits of Leizhou goats and obtaining the genotype, the early screening or identification of the tall and short leg traits of Leizhou goats can be realized, and the breeding of Leizhou goat varieties can be realized. Description of the Drawings
[0016] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the accompanying drawings required for use in the embodiments. Obviously, the accompanying drawings in the following description are only some embodiments of the present invention. For those of ordinary skill in the art, without creative efforts, other accompanying drawings can be obtained based on these drawings.
[0017] Figure 1 It is the gel electrophoresis detection result diagram of Leizhou goat genomic DNA provided by the present invention;
[0018] Figure 2 It is the gel electrophoresis diagram of the PCR amplification product of the SNP molecular marker g.53666634T>C site provided by the present invention;
[0019] Figure 3 It is the gel electrophoresis diagram of PCR - RFLP of the SNP molecular marker g.53666634T>C site provided by the present invention;
[0020] Figure 4 It is the sequencing result diagram of the mutant homozygous CC genotype of Leizhou goat provided by the present invention;
[0021] Figure 5 It is the sequencing result diagram of the mutant heterozygous TC genotype of Leizhou goat provided by the present invention;
[0022] Figure 6 It is the sequencing result diagram of the wild homozygous TT genotype of Leizhou goat provided by the present invention. Detailed implementation manners
[0023] The present invention provides an SNP molecular marker related to the tall and short leg traits of Leizhou goats. The sequence of the SNP molecular marker is shown as SEQ ID NO.1: TCCCTCCCCCAAATGTGATGTTAATATATTTCAATGACCTTGAAGATTTACCTAAATGCAAATACAGTTAAATAAATGATCCTTTTAAGTTTTAACCTACTTACCAAGAGATTATGGTCAGTGACACATGCTTTAAAGGGAAAATGTTAAGGATGAGGTTTAGGGGGAAGAAAACATTAGAAAAAGTTTTAATTCTTTAGGCTATATAACAAATTGCATATTATCTTTGATCCTCAACAAGTTTGAACAGGTAAGATGTMAACTGCATCTGTGATACTTAGTCATATGTAGTGGTACCCACACAGAGGACCATGCTCACCCAGAATCATTAATGATGTCTTAGTCAGCGTGGGCTGTTATAACAAAGTACTGTAAACTGGGTGATGTAAACAATAGAAATCTATTTCTTACATTTCTTTGAGGAGAAGTGATTTATATCACATTCTAAATCCTCAACAAATCGGCTCCCACAAGATGA, where the 260th base (M) is T or C. In the present invention, the SNP molecular marker of the CC mutation homozygous type corresponds to the short leg trait of Leizhou goats, and the SNP molecular marker of the TT wild homozygous type corresponds to the tall leg trait of Leizhou goats. The molecular marker of the present invention comes from goat chromosome NC_030818.1. The present invention discovers that the mutation existing at the 53666634bp locus of this chromosome is related to the tall and short legs of Leizhou goats.
[0024] The present invention also provides a primer pair for amplifying the SNP molecular marker described in the above technical solution. The nucleotide sequences of the primer pair are shown as SEQ ID NO.2 (TCCCTCCCCCAAATGTGATG, upstream primer) and SEQ ID NO.3 (TCATCTTGTGGGAGCCGATT, downstream primer) respectively.
[0025] The present invention also provides a kit containing the primer pair described in the above technical solution. In the present invention, the kit preferably further includes related reagents required for PCR reaction. In the present invention, the kit preferably further includes Taq DNA polymerase. In the present invention, when the kit is a restriction fragment length polymorphism polymerase chain reaction kit, the kit preferably further includes a restriction endonuclease, and the restriction endonuclease is preferably HpaI.
[0026] The present invention also provides the use of a reagent for detecting the SNP molecular marker described in the above technical solution in the early screening or identification of the tall or short leg traits of Leizhou goats. In the present invention, the reagent preferably includes the primer pair described in the above technical solution, or the kit described in the above technical solution. The definitions of the primer pair and the kit in the present invention are preferably the same as those described above.
[0027] The present invention also provides a method for detecting the tall and short leg traits of Leizhou goats, including the following steps: using the genome of Leizhou goats as a template, amplifying with a reagent for detecting the SNP molecular marker described in the above technical solution, and detecting the genotype. In the present invention, when the SNP molecular marker is the CC mutation homozygous type, it corresponds to the short leg trait of Leizhou goats, and when the SNP molecular marker is the TT wild homozygous type, it corresponds to the tall leg trait of Leizhou goats. The present invention has no special limitation on the method for extracting the genome, and it can be extracted using a conventional genome extraction kit. In the present invention, the concentration of the genome is preferably not less than 30 ng / μL, and the OD 260 / 280 value is preferably between 1.8 and 2.0.
[0028] The present invention also provides a method for detecting the tall and short leg traits of Leizhou goats based on restriction fragment length polymorphism polymerase chain reaction, including the following steps: using the genome of Leizhou goats as a template, amplifying with the primer pair described in the above technical solution to obtain a gene containing the mutation site; using the restriction endonuclease HpaI to digest the gene containing the mutation site as a template, and performing electrophoresis to obtain the genotype result. In the present invention, the mutation heterozygous type TC corresponds to three bands (478 bp, 260 bp, and 218 bp), the mutation homozygous type CC corresponds to one band (478 bp), and the wild homozygous type TT corresponds to two bands (260 bp and 218 bp). In the present invention, when the SNP molecular marker is the CC mutation homozygous type, it corresponds to the short leg trait of Leizhou goats, and when the SNP molecular marker is the TT wild homozygous type, it corresponds to the tall leg trait of Leizhou goats. The method of the present invention is simple and has a short genotyping time.
[0029] In the present invention, the amplification reaction system preferably includes 1 μL of genomic DNA, 0.4 μL of each primer, 10 μL of Taq DNA polymerase, and 8.2 μL of ddH2O per 20 μL; the amplification reaction program is preferably: pre-denaturation at 95°C for 2 min; denaturation at 95°C for 15 s, annealing at 60°C for 15 s, extension at 72°C for 10 s, for 35 cycles; post-extension at 72°C for 5 min.
[0030] In the present invention, the digestion reaction system preferably includes: 2 μL of 10×FuniCut@Buffer, 1 μL of FuniCut@HpaI, 10 μL of gene template containing mutation sites, and 17 μL of ddH2O per 30 μL; the digestion reaction conditions are: 37°C, 30 min.
[0031] To further illustrate the present invention, a SNP molecular marker, detection primers, kit, detection method, and application related to the tall and short leg traits of Leizhou goats provided by the present invention will be described in detail below in conjunction with the accompanying drawings and examples, but they should not be construed as limiting the protection scope of the present invention.
[0032] Example 1
[0033] Sample collection
[0034] A total of 249 blood samples were used in this experiment, among which 136 blood samples were collected from Leizhou City Zhuangyuan Black Goat Breeding Co., Ltd., and 113 blood samples were collected from Leading Goat Agricultural Smart Agriculture Co., Ltd. 5 mL of blood was collected from the jugular vein, anticoagulated with EDTAK2, stored in a -20°C refrigerator for later use, and the ear tag number and body measurement data of each individual were marked and recorded.
[0035] Extraction and quality detection of blood genomic DNA
[0036] The Hipure Universal DNAKit D3018 kit from Meiji Bio was used to extract blood genomic DNA. The concentration and purity of the extracted DNA fragments were detected using a nanodrop spectrophotometer, and Buffer AE was used as a blank control to ensure that the concentration of the extracted DNA sample was not less than 30 ng / μL, and the OD 260 / 280 value was between 1.8 and 2.0. Then, the quality of the extracted DNA was detected by 1% agarose gel electrophoresis.
[0037] The results of the quality detection of goat genomic DNA are as Figure 1 shown. The genomic DNA samples of Leizhou goats were detected by a nucleic acid detector, and it was found that OD 260 / OD 280The values are all between 1.8 and 2.0, and the concentrations are all between 50 and 200 ng / μL. After detection by 1% agarose gel electrophoresis, the electrophoresis bands are clear and show dense bright bands, indicating that the extracted goat genomic DNA samples are of good quality, and both the purity and concentration meet the experimental requirements and can be used for subsequent experiments.
[0038] Synthesis of candidate gene primers
[0039] Based on the candidate gene sequences published on GenBank, primers were designed for the 53666634bp site of goat chromosome NC_030818.1. The following primers were obtained using Primer Premier 5.0 software and synthesized by Sangon Biotech Co., Ltd. The primer sequences are F: TCCCTCCCCCAAATGTGATG (SEQ ID NO.2), R: TCATCTTGTGGGAGCCGATT (SEQ ID NO.3), and the product length is 478bp.
[0040] PCR amplification
[0041] PCR reaction system: In a 20μL system, it contains 1μL of genomic DNA template, 0.4μL of each upstream and downstream primer, 10μL of Taq DNA polymerase, and is supplemented with deionized double-distilled water to the final volume.
[0042] PCR reaction procedure: Pre-denaturation at 95℃ for 2min; denaturation at 95℃ for 15s, annealing at 60℃ for 15s, extension at 72℃ for 10s, for 35 cycles; final extension at 72℃ for 5min; stored at 4℃.
[0043] After the reaction is completed, 5μL of the reaction product is taken and detected for its length and integrity by 2% agarose gel electrophoresis.
[0044] The PCR amplification results of the mutation site genes are as Figure 2 shown. Specific primers were designed according to the SNP mutation site at 53666634bp of goat chromosome NC_030818.1, and PCR amplification was carried out using the genomic DNA of Leizhou goats as the template. After PCR electrophoresis, the target bands are clear and bright, without miscellaneous bands, and the size of the target fragment is consistent with the expected result, which is 478bp.
[0045] RELP detection
[0046] Use the SnapGene software to find the corresponding restriction endonuclease for the screened SNP sites. The restriction endonuclease corresponding to the SNP mutation site at 53,666,634 bp on chromosome NC_030818.1 of goats was found to be HpaI. The enzyme digestion system was (30 μL): 2 μL of 10×FuniCut@Buffer, 1 μL of FuniCut@HpaI, 10 μL of substrate DNA, and 17 μL of ddH2O. After thoroughly mixing by vortexing, it was placed in a 37°C constant temperature water bath for enzyme digestion for 30 minutes. After digestion was completed, the sample was taken out, and 2% agarose gel electrophoresis was used to analyze the genotypes presented in each lane according to the gel imaging results.
[0047] The PCR-RFLP analysis results of the mutant site gene are as Figure 3 shown. In this invention, DNA samples of 20 and 50 different Leizhou goat individuals were respectively extracted, and two DNA pools were made according to the principle of equal mixing, and PCR amplification was carried out using these as templates, and the PCR products were sequenced. The sequencing results were sorted out using DNAMAN software and compared with the genomic sequences on NCBI. It was found that a T→C mutation existed at the 260th bp of the amplified sequence, which was the said SNP site. After the amplified product was digested with the HpaI restriction endonuclease and detected by 2% agarose gel electrophoresis (110 V, 30 minutes), the results showed three genotypes: mutant heterozygous type TC (478 bp, 260 bp, and 218 bp), mutant homozygous type CC (478 bp), and wild homozygous type TT (260 bp and 218 bp).
[0048] Determination of sequencing results of different genotypes: Sequencing was carried out at Sangon Biotech Co., Ltd. The gene fragments were sequenced bidirectionally, and the PCR products of the three different genotypes at the molecular marker g.53666634T>C locus were sent for sequencing. The results are as Figure 4 、 Figure 5 and Figure 6 shown.
[0049] Data statistics and analysis
[0050] The data was statistically analyzed for the said molecular marker locus using the unit point effect model constructed with the GLM (General Linear Model) program in the SPSS 26.0 statistical analysis software. The LSD and Dunnett’s T3 methods were used for multiple comparisons between means to study the effect of genotypes on the foot length of Leizhou goats. The results were presented in the form of "mean ± standard deviation (Mean ± SD)". The linear model used for statistical analysis was as follows:
[0051] y jkl =μ+G k +ejkl
[0052] Where: y jkl is the foot length value of Leizhou goats; μ is the population mean; G k is the fixed effect of the k-th genotype; e jkl is the random residual effect.
[0053] g.53666634T>C locus genetic parameter analysis
[0054] Genetic heterozygosity (He), genetic homozygosity (Ho), polymorphic information content (PIC), and effective number of alleles (Ne) are important parameters for evaluating population genetic variation. Different genetic parameters represent the essential genetic differences among populations. The genetic parameters of the 53666634T>C locus are shown in Table 1. It can be seen from Table 1 that the polymorphic information content is 0.33, between 0.25 and 0.5, so it shows moderate polymorphism. The homozygosity and heterozygosity are not very different, both around 0.5, indicating that the distribution of these two alleles is relatively uniform in the Leizhou goat population. The chi-square result shows that the genotype distribution conforms to the Hardy-Weinberg equilibrium state, which indicates that the 53666634T>C locus may not be affected by the current breeding measures, and their genetic changes are random during the breeding process.
[0055] Table 1 Genetic parameter analysis of the 634T>C locus
[0056]
[0057] g.53666634T>C locus and foot length trait association analysis
[0058] Using SPSS 26.0 software to conduct an association analysis between the g.53666634T>C variant locus and the foot length of Leizhou goats with different genotypes. There is a significant association between the g.53666634T>C variant locus and the foot length trait of Leizhou goats (P < 0.05). It can be seen from Table 2 that the mean foot length of Leizhou goats with the CC genotype is 24.056 cm, the mean foot length of Leizhou goats with the TC genotype is 28.278 cm, and the mean foot length of Leizhou goats with the TT genotype is 30.408 cm. In terms of the leg length of Leizhou goats, the leg length of the TT type is 6.352 cm longer than that of the CC type, with a significant difference (P < 0.05). The leg length of the TT type is 2.13 cm longer than that of the TC type, with a significant difference (P < 0.05), and the leg length of the TC type is 4.222 cm longer than that of the CC type, with a significant difference (P < 0.05)
[0059] Table 2 Association analysis between the g.53666634T>C locus and the foot length of Leizhou
[0060] Genotype Number of individuals Leg length CC 16 <![CDATA[24.156±1.080 a > TC 114 <![CDATA[28.278±0.404 b > TT 119 <![CDATA[30.408±0.396 c >
[0061] Note: Different letters indicate significant differences (P < 0.05).
[0062] Although the above embodiments have described the present invention in detail, they are only a part of the embodiments of the present invention, rather than all embodiments. People can also obtain other embodiments based on these embodiments without creative work, and these embodiments all fall within the protection scope of the present invention.
Claims
1. Use of a reagent for detecting SNP molecular markers related to the tall and short leg traits of Leizhou goats in the early screening or identification of the tall or short leg traits of Leizhou goats; the sequence of the SNP molecular marker is as shown in SEQ ID NO.1, where the 260th base is T or C; the CC mutant homozygous type of the SNP molecular marker corresponds to the short leg trait of Leizhou goats, and the TT wild homozygous type of the SNP molecular marker corresponds to the tall leg trait of Leizhou goats.
2. The application according to claim 1, wherein The reagent includes a primer pair for amplifying the SNP molecular marker related to the tall and short leg traits of Leizhou goats, or a kit containing the primer pair.
3. A method for detecting the tall and short leg traits of Leizhou goats, characterized in that, Comprising the following steps: Using the genome of Leizhou goats as a template, amplifying with a reagent for detecting SNP molecular markers related to the tall and short leg traits of Leizhou goats, and detecting the genotype; the sequence of the SNP molecular marker is as shown in SEQ ID NO.1, where the 260th base is T or C; the CC mutant homozygous type of the SNP molecular marker corresponds to the short leg trait of Leizhou goats, and the TT wild homozygous type of the SNP molecular marker corresponds to the tall leg trait of Leizhou goats.
4. A method for detecting the tall and short leg traits of Leizhou goats based on restriction fragment length polymorphism polymerase chain reaction, characterized in that, Comprising the following steps: Using the genome of Leizhou goats as a template, amplifying with a primer pair of SNP molecular markers related to the tall and short leg traits of Leizhou goats to obtain a gene containing a mutation site; Using the gene containing the mutation site as a template, a restriction endonuclease HpaI is used for digestion and electrophoresis to obtain the genotype result; The sequence of the SNP molecular marker is as shown in SEQ ID NO.1, where the 260th base is T or C; The CC mutant homozygous type of the SNP molecular marker corresponds to the short leg trait of Leizhou goats, and the TT wild homozygous type of the SNP molecular marker corresponds to the tall leg trait of Leizhou goats.
5. The method according to claim 4, wherein The nucleotide sequences of the primer pair are as shown in SEQ IDNO.2 and SEQ ID NO.3 respectively.