Trachinotus ovatus growth trait related QTL positioning method based on 2b-RAD technology and application

Abstract

The invention discloses a positioning method of trachinotus ovatus growth trait related QTL (quantitative trait loci) based on 2b-RAD technology and application, the method uses 2b-RAD technology to perform sequencing on 300 trachinotus ovatus full-sib F1 generation and male and female parent individuals and develop SNP (single nucleotide polymorphism) markers, constructs a trachinotus ovatus high-density genetic linkage map, performs linkage positioning analysis in combination with 8 growth phenotype data, and finds that the trachinotus ovatus growth trait related QTL is found. 85 stable QTLs associated with the growth traits are screened out, and the stable QTLs contain 763 SNP sites. The invention also discloses an application of the method in a genetic map of trachinotus ovatus growth character positioning or molecular marker-assisted breeding of trachinotus ovatus, and the SNP molecular markers of trachinotus ovatus can be applied in genetic map construction and growth character positioning. Particularly, the method has a good application prospect in trachinotus ovatus growth trait molecular marker assisted breeding.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of fish molecular marker development, and particularly relates to a method for locating QTLs related to growth traits of Trachinotus ovatus based on 2b-RAD technology and application. BACKGROUND

[0002] Trachinotus ovatus belongs to Perciformes, Carangidae and Trachinotus, is also known as gold pompano, yellow pompano, etc., is a warm water upper-middle layer fish, and is widely distributed in the southern East China Sea, the South China Sea to Southeast Asia. Because of its tender meat, simple diet, fast growth rate, strong disease resistance and other characteristics, it is deeply loved by consumers and southern aquaculture enterprises, and has become one of the main cage culture varieties in Guangdong, Fujian, Taiwan, Hainan and Guangxi provinces, as well as Hong Kong and Macau regions. However, with the continuous expansion of the aquaculture scale, the slow artificial breeding process and inbreeding recession caused by the biological characteristics of the species (such as reproductive maturity, difficulty in distinguishing between male and female individuals) have become increasingly prominent, which greatly hinders the stable and sustainable development of Trachinotus ovatus culture industry, and it is urgent to carry out related molecular genetic breeding research to analyze the genetic mechanism of important economic traits. In recent years, the research content of the academic circle is mainly concentrated in the aspects of artificial breeding and culture, physiological ecology, population genetics, genomics and other aspects of Trachinotus ovatus, and there are few reports on the development and application of molecular genetic markers.

[0003] Constructing a genetic linkage map based on molecular marker technology is a key method to realize QTL (quantitative trait locus) positioning of important economic traits and to carry out molecular marker-assisted breeding. The application of high-throughput sequencing technology not only simplifies the genotyping process of genetic markers, but also significantly reduces the experimental cost. Therefore, at present, many fish have constructed high-density genetic linkage maps by means of reduced genome sequencing technology to realize QTL positioning research of economic traits. Growth, as one of the important economic traits, not only directly affects the efficiency and economic benefit of aquaculture, but is also widely recognized as one of the core goals in genetic improvement of aquatic products. Many studies have shown that growth-related indicators such as body weight and body length are usually controlled by multiple QTLs, and are ideal candidate traits for implementing molecular marker-assisted breeding (MAS). Researchers have successfully identified major QTLs controlling multiple growth traits, and found that they often have a synergistic effect on body length, body weight and other traits, providing a strong molecular basis for precision breeding. Therefore, it is of important application and economic value to include growth traits in the genetic linkage map and QTL positioning research of Trachinotus ovatus. SUMMARY

[0004] The purpose of the present application is to provide a method for locating QTLs related to growth traits of Trachinotus ovatus based on 2b-RAD technology.

[0005] The application also aims to provide application of the above method in genetic map of growth traits of Trachurus japonicus or molecular marker assisted breeding of Trachurus japonicus.

[0006] The above first purpose of the application can be realized by the following technical scheme: a method for locating QTLs related to growth traits of Trachurus japonicus based on 2b-RAD technology, comprising the following steps:

[0007] (1) selecting sexually mature Trachurus japonicus individuals as parents, and hybridizing the parents to produce F1 full-sib families, and extracting genomic DNA of each sample;

[0008] (2) performing genotyping on the parents and 300 F1 individuals by using 2b-RAD technology, and filtering SNP markers, and obtaining 15015 polymorphic SNP sites, and then taking a known chromosome level reference genome as a reference, and merging the markers into corresponding linkage groups according to the genotyping information of the markers and the calculated genetic distance, and removing markers on non-chromosomes, and taking the marker with the highest integrity, i.e., the lowest missing rate, as a mapping marker in each genetic position, and finally obtaining 4248 SNP markers for constructing an integrated map;

[0009] (3) constructing a genetic map by using the 4248 SNP markers screened in step (2) in a double pseudo-test cross strategy;

[0010] (4) measuring growth trait phenotypes of the parents and the F1 full-sib families in step (1), determining whether the distribution mode of the growth trait phenotypic values is normally distributed by using Kolmogorov-Smirnov test, calculating Pearson correlation coefficients r between the growth traits, and finally selecting 8 growth traits with the highest correlation for subsequent QTL location;

[0011] (5) Analyzing the genetic map constructed in step (3) and the growth trait phenotype identification results of step (4), using MapQTL6.0 to perform interval mapping on the eight growth traits, a total of 85 QTLs related to growth traits are obtained, which are distributed on LG1, LG3, LG4, LG5, LG6, LG7, LG8, LG9, LG11, LG12, LG14, LG15, LG18, LG19, LG20, LG21, LG23, LG24 linkage groups, and are named as qBW-1, qBW-2, qBW-3, qBW-4, qBW-5, qBW-6, qBW-7, qBW-8, qBW-9, qBW-10, qBW-11, qBW-12, qBW-13, qBW-14, qBW-15, qBW-16, qBW-17, qBW-18, qBW-19, qBWH-1, qBWH-2, qBWH-3, qTL-1, qTL-2, qTL-3, qTL-4, qTL-5, qTL-6, qTL-7, qTL-8, qTL-9, qBL-1, qBL-2, qBL-3, qBL-4, qBL-5, qBL-6, qBL-7, qBL-8, qBL-9, qBL-10, qBL-11, qBL-12, qBL-13, qBL-14, qHH-1, qHH-2, qHH-3, qHH-4, qHH-5, qHH-6, qHH-7, qHH-8, qHH-9, qHH-10, qHH-11, qHH-12, qHH-13, qHH-14, qHH-15, qHH-16, qHH-17, qBH-1, qBH-2, qBH-3, qBH-4, qBH-5, qBH-6, qBH-7, qBH-8, qBH-9, qBH-10, qCPL-1, qCPL-2, qCPL-3, qCPL-4, qCPL-5, qCPH-1, qCPH-2, qCPH-3, qCPH-4, qCPH-5, qCPH-6, qCPH-7 and qCPH-8.

[0012] In the above method for locating QTLs related to growth traits of Trachurus japonicus based on 2b-RAD technology:

[0013] Preferably, in step (2), the SNP markers are filtered by removing sites without mutant alleles, removing sites with N bases in the genome, removing tags with more than 3 SNPs in a tag, removing sites with two types of typing at the same position (due to overlap between a few tags), performing chi-square test on the genotype proportion of the marker sites, and retaining markers with lmxll, nnxnp and hkxhk segregation types, a total of 15015 polymorphic SNP sites are obtained.

[0014] Preferably, the 4248 molecular markers obtained in step (2) are distributed in 24 linkage groups, wherein the distribution of SNP molecular markers, polymorphic tags and linkage groups is shown in Table 1 below.

[0015] Further, the 4248 SNP markers in step (2) have the polymorphic tags and the distribution on the linkage groups as shown in Table 1 in the detailed description.

[0016] As a preferred embodiment of the present application, the molecular markers of the present application are a total of 4248, which are distributed in 24 linkage groups, and the SNP molecular markers are obtained by the following method: selecting good individuals of the same sex as parents, crossing the parents to produce F1 full-sibling families, extracting the genomic DNA of each sample; using 2b-RAD five-tag technology to genotype the parents and F1 individuals respectively; then filtering the SNP markers, removing sites without mutant alleles, removing sites with N bases in the genome, removing tags with more than 3 SNPs in one tag, removing sites with two types of genotypes at the same position (due to overlap between tags), performing chi-square test according to the theoretical proportion of marker site genotypes, removing severely biased separation sites, and retaining markers with separation types of lmxll, nnxnp and hkxhk; a total of 15015 polymorphic SNP sites are obtained; using the known chromosome level genome as a reference, the markers are merged into corresponding linkage groups according to the physical position information of the markers, removing markers on non-chromosomes, and taking the marker with the highest completeness (lowest missing rate) in each genetic position as the mapping marker, finally obtaining 4248 SNP markers for constructing a genetic map.

[0017] These Trachurus ovatus SNP molecular markers can be further applied in constructing a Trachurus ovatus genetic linkage map and sex trait positioning. In particular, they have good application prospects in Trachurus ovatus growth trait marker-assisted breeding.

[0018] Preferably, the growth trait phenotypes of the parents and F1 full-sibling families in step (1) are measured in step (2), and the growth trait phenotypes are 11 growth trait phenotypes, including body weight BW, body width BWH, total length TL, body length BL, head length HL, head height HH, body height BH, snout length SL, eye diameter ED, caudal peduncle length CPL, and caudal peduncle height CPH.

[0019] Preferably, the 8 growth traits in step (2) are body weight BW, body width BWH, total length TL, body length BL, head height HH, body height BH, caudal peduncle length CPL, and caudal peduncle height CPH.

[0020] Preferably, in step (5), interval mapping (scan step 1 cM) is used for 8 growth traits, the highest LOD value on the linkage group or the closely linked marker site in the region is determined and set as a cofactor for multiple QTL model (MQM) mapping, the scan step is 1 cM, and LOD = 3.0 is used as a threshold to screen QTL.

[0021] Preferably, in step (5), the intervals of each QTL are as shown in Table 2 in the detailed description.

[0022] The above second object of the present application can be achieved by the following technical solution: the application of the above method in the genetic map of the growth traits of Trachinotus ovatus or the molecular marker assisted breeding of Trachinotus ovatus.

[0023] In the above application, the 85 growth trait related QTLs collectively contain 763 SNP sites, each SNP site contains two different alleles, the allelic variation of the site is detected, the physical position of the 763 SNP sites is determined based on the sequence alignment of the Trachinotus ovatus reference genome GCA_022709315.2, the variation information of the 763 SNP sites is represented in the form of chromosome number_ physical position_ reference genotype / allele genotype, and the variation information of the 763 SNP sites is shown in Table 3 in the specification.

[0024] The SNP sites (763) in the 85 growth trait related QTLs can be combined to make a chip, and then primers are designed by using a conventional method, and the method of detecting the combination of the SNP sites in the 85 growth trait related QTLs by using primers is used to screen Trachinotus ovatus with good growth traits as parents for use in the molecular marker assisted breeding of Trachinotus ovatus growth traits.

[0025] The method of the present application uses the obtained SNP molecular markers with gene sequences to construct a high-density genetic linkage map, realizes QTL positioning of the growth traits of Trachinotus ovatus, has good stability of the positioning site, has a wide range of applications, and has a good application prospect in the molecular marker assisted breeding of the growth traits of Trachinotus ovatus.

[0026] The present application has the following beneficial effects: the present application locates the QTLs related to the growth traits of Trachinotus ovatus based on the 2b-RAD technology, screens a large number of SNP markers with gene sequences, uses these marker sites to construct the first high-density genetic linkage map of Trachinotus ovatus, locates the growth traits of Trachinotus ovatus, obtains molecular markers associated with the gender traits of Trachinotus ovatus, has good stability of the positioning site, has a wide range of applications, and has a good application prospect in the molecular marker assisted breeding of the growth traits of Trachinotus ovatus. Attached Figure Description

[0027] Figure 1 This is the high-density SNP molecular genetic linkage map of the oval pomfret constructed in Example 1;

[0028] Figure 2 Pearson correlation coefficients for all paired combinations of 11 growth-related traits of oval pomfret in Example 1 (P<0.001);

[0029] Figure 3 This is a graph showing the LOD value of the growth trait QTL mapping in the genetic linkage map of oval pomfret in Example 1. Detailed Implementation

[0030] The present invention will now be described in detail with reference to the accompanying drawings and specific embodiments, but this should not be construed as limiting the invention. Unless otherwise specified, the experimental methods in the following embodiments are conventional methods, and the materials and reagents used in the following embodiments are commercially available unless otherwise specified.

[0031] Example 1

[0032] The method for locating QTLs related to growth traits in oval pomfret based on 2b-RAD technology provided in this embodiment includes the following steps:

[0033] (1) Select sexually mature male and female individuals with good body shape as parents. Cross the parents to produce the F1 generation full-sib family. Extract genomic DNA from each sample using a standard kit.

[0034] The experiment was conducted at the Lanliang Aquaculture Base on Xidao Island, Sanya, Hainan. Sexually mature males and females of good body shape were selected as parents, and full-sib families were established through one-to-one breeding. Artificial breeding was carried out in April 2023, and the hatched fry were then transferred to indoor cement tanks for rearing. In October 2023, 300 F1 generation full-sib family fry and their parents were selected for constructing a genetic map; simultaneously, 11 growth traits of the F1 generation fry were measured. In November 2023, fin rays from the selected 300 F1 generation individuals and their parents were collected, and genomic DNA was extracted. DNA quality was analyzed using a NanoDrop2000 spectrophotometer.

[0035] (2) Genotyping of parents and 300 F1 individuals by 2b-RAD technology, filtering SNP markers, removing sites without mutant alleles, removing sites with N bases in the genome, removing tags with more than 3 SNPs in a tag, removing sites with two types of genotyping at the same position (due to overlap between a few tags), performing chi-square test on the proportion of genotypes of the marker sites according to the theoretical alignment, retaining markers with segregation types of lmxll, nnxnp and hkxhk, and obtaining 15015 polymorphic SNP sites; then taking the reference genome at the chromosome level as a reference, merging the markers into corresponding linkage groups according to the physical location information of the markers, removing markers on non-chromosomes, and taking the marker with the highest completeness (lowest missing rate) in each genetic position as the mapping marker, finally obtaining 4248 SNP markers for constructing the integrated map.

[0036] The specific operation is as follows:

[0037] Two parents and 300 offspring are sequenced by 2b-RAD five-tag concatenation technology, the qualified genomic DNA is digested by type II restriction endonuclease (eg: BsaXI / BcgI / FalI / BaeI), the enzyme digestion products are added with 5 different adaptors respectively, then T4 DNA Ligase is used for ligation, the ligation products are amplified by PCR, the five tags are concatenated in order according to the information of the five adaptors, the ligation products are introduced with barcode sequences, the libraries with different barcode numbers are mixed according to the data amount for submission, and the mixed library is sequenced by using Illumina Novaseq PE150 sequencing platform.

[0038] The raw data (Raw data) after sequencing is spliced and quality controlled, and the filtering standards are as follows: 1) remove reads containing unknown nucleotides (N) ≥10%; 2) remove reads with phred quality score ≤20 and bases ≥50%; 3) delete reads containing adaptors. Extract Clean Reads containing enzyme digestion recognition sites for subsequent assembly analysis. The statistical results show that the average Clean data of the two parents after filtering is 359.25Mbp, and the average Clean data of each individual in the 300 offspring samples is 294.72Mbp, the sequencing quality is high (Q20≥99.63%, Q30%≥98.13%), and the sample GC distribution is normal (average 50.72%). Align the sequencing data with the reference genome, and the alignment results show that the average alignment rate of all reads with the reference genome GCA_022709315.2 is more than 85.51%, which can be used for subsequent variant detection and related analysis.

[0039] The Clean Reads were aligned to the constructed reference sequence using SOAP software. According to the alignment results, the markers were typed using the maximum likelihood method (ML) by the RADtyping software package. After the typing was completed, the typing results were further filtered, and the filtering criteria were as follows: removing sites without mutant alleles, removing sites with N bases in the genome, removing tags with more than 3 SNPs in a tag, removing sites with two types of typing at the same position (due to overlap between very few tags), and retaining markers with lmxll, nnxnp, and hkxhk separation types. Finally, 15015 polymorphic sites were obtained in this project. Then, using the reference genome at the chromosome level as a reference, the markers on non-chromosomes were removed, and the marker with the highest integrity (lowest deletion rate) was selected as the mapping marker in each genetic position, and finally 4248 SNP markers were obtained for constructing the integrated map.

[0040] (3) The 4248 SNP markers screened in step (2) were used to construct a genetic map using a "double pseudo-test cross" strategy. A total of 4248 molecular markers were distributed on 24 linkage groups, with a total length of 1718.27 cM and an average genetic distance of 0.39 cM (Table 1). For SNP sites with different separation modes, parent-specific markers (separation modes lm×ll and nn×np, with a separation ratio of 1:1) were used to construct maternal and paternal linkage maps, respectively. Parental shared markers (separation modes hk×hk, with separation ratios of 1:2:1 and 1:1:1:1, respectively) were used as anchor markers for the integration and construction of the paternal and maternal genetic linkage maps. Using JoinMap4.0 software, the recombination rate and correlation LOD value between SNP sites were calculated by selecting the CP population type, and the linear order of markers on the linkage group was calculated using the regression mapping algorithm when the grouping LOD threshold was 8.0. Finally, the female and male maps were integrated using MergeMap software. Figure 1

[0041] Table 1 Distribution of SNP polymorphic tags and linkage groups

[0042] Linkage group number Number of SNPs Genetic length (cM) Average genetic distance (cM) LG1 199 66.97 0.337 LG2 182 84.03 0.462 LG3 203 77.77 0.383 LG4 195 59.72 0.306 LG5 173 91.28 0.528 LG6 170 57.73 0.340 LG7 157 82.1 0.523 LG8 120 59.18 0.493 LG9 223 61.07 0.274 LG10 144 69 0.479 LG11 202 73.03 0.362 LG12 162 70.8 0.437 LG13 243 92.04 0.379 LG14 174 72.76 0.418 LG15 246 62.22 0.253 LG16 179 65.09 0.364 LG17 166 57.1 0.344 LG18 205 82.33 0.402 LG19 126 67.75 0.538 LG20 198 71.57 0.361 LG21 171 76.74 0.449 LG22 170 67.14 0.395 LG23 168 63.09 0.376 LG24 72 29.35 0.408 Total 4248 1659.86 0.391

[0043] (4) The phenotypes of 11 growth traits (body weight BW, body width BWH, total length TL, body length BL, head length HL, head height HH, body height BH, snout length SL, eye diameter ED, caudal peduncle length CPL, and caudal peduncle height CPH) of the parent and F1 full-sibling family hybrid population in step (1) were measured. The Kolmogorov-Smirnov test found that the distribution mode of the growth trait phenotype values was normally distributed. In addition, in order to study the relationship between growth-related traits, the Pearson correlation coefficients (r) between each growth trait were calculated, and the results are as follows​Figure 2 The correlation coefficients of the 8 growth traits were calculated and the results showed that the correlation coefficients of the 8 growth traits were significant (Pearson correlation coefficient P < 0.001). Finally, the 8 growth traits with the highest correlation (body weight, body width, total length, body length, head height, body height, tail handle length, and tail handle height) were selected for subsequent QTL mapping.

[0044] Interval mapping (IM) was performed on the 8 growth traits using MapQTL 6.0 software, the highest LOD value on the linkage group or the closely linked marker site in the region was determined and set as a cofactor for multiple QTL model (MQM) mapping, the scanning step was set to 1 cM, and LOD = 3.0 was used as the threshold to screen QTL. The LOD curve of the QTL related to the 8 growth traits on the genetic linkage map was obtained, and the stable QTL related to the growth traits were detected on the integrated genetic map of the parents, a total of 85 stable QTLs related to the growth traits were detected, as shown in Table 1. Figure 3 Figure 3 ​Figure 1 is a graph of the LOD value curve for the 8 growth trait QTLs located in the genetic linkage map of Trachurus japonicus in Example 1. A total of 19 QTLs related to body weight, 3 QTLs related to body width, 9 QTLs related to total length, 14 QTLs related to body length, 17 QTLs related to head height, 10 QTLs related to body height, 5 QTLs related to caudal peduncle length, and 8 QTLs related to caudal peduncle height were obtained, which were located on linkage groups LG1, LG3, LG4, LG5, LG6, LG7, LG8, LG9, LG11, LG12, LG14, LG15, LG18, LG19, LG20, LG21, LG23, and LG24, and were named qBW-1, qBW-2, qBW-3, qBW-4, qBW-5, qBW-6, qBW-7, qBW-8, qBW-9, qBW-10, qBW-11, qBW-12, qBW-13, qBW-14, qBW-15, qBW-16, qBW-17, qBW-18, qBW-19, qBWH-1, qBWH-2, qBWH-3, qTL-1, qTL-2, qTL-3, qTL-4, qTL-5, qTL-6, qTL-7, qTL-8, qTL-9, qBL-1, qBL-2, qBL-3, qBL-4, qBL-5, qBL-6, qBL-7, qBL-8, qBL-9, qBL-10, qBL-11, qBL-12, qBL-13, qBL-14, qHH-1, qHH-2, qHH-3, qHH-4, qHH-5, qHH-6, qHH-7, qHH-8, qHH-9, qHH-10, qHH-11, qHH-12, qHH-13, qHH-14, qHH-15, qHH-16, qHH-17, qBH-1, qBH-2, qBH-3, qBH-4, qBH-5, qBH-6, qBH-7, qBH-8, qBH-9, qBH-10, qCPL-1, qCPL-2, qCPL-3, qCPL-4, qCPL-5, qCPH-1, qCPH-2, qCPH-3, qCPH-4, qCPH-5, qCPH-6, qCPH-7, and qCPH-8, respectively. The intervals of each locus and the explained contribution rate are shown in Table 2.

[0045] Table 2 QTL information related to growth traits

[0046]

[0047]

[0048]

[0049]

[0050] Wherein " / " in Marker indicates that the peak is not above the marker.

[0051] The application is based on 2b-RAD five-label series technology to screen a large number of SNP markers with gene sequences, and a high-density genetic linkage map of Trachinotus ovatus is constructed by using these marker sites, and the growth traits of Trachinotus ovatus are located to obtain 8 growth traits including body weight, body width, total length, etc. The application has good application prospect in molecular marker assisted breeding of Trachinotus ovatus growth traits.

[0052] For example, the SNP sites (763) in the 85 growth trait related QTLs can be combined to make a chip, and then primers are designed by using conventional methods, and the SNP site combination in the 85 growth trait related QTLs is detected by using the primers to screen Trachinotus ovatus with good growth traits as parents for molecular marker assisted breeding of Trachinotus ovatus growth traits.

[0053] The 85 growth trait related QTLs contain 763 SNP sites, each SNP site contains two different base alleles, and the change of the alleles of the site is detected, the physical position of the 763 SNP sites is determined based on the sequence alignment of the Trachinotus ovatus reference genome GCA_022709315.2, and the variation information of the 763 SNP sites is represented in the form of chromosome number_ physical position_ reference genotype / allele genotype, and the variation information of the 763 SNP sites is shown in Table 3 as follows:

[0054] Table 3 Variation information of 763 SNP sites

[0055]

[0056]

[0057]

[0058]

[0059]

[0060]

[0061]

[0062]

[0063]

[0064] Example 2

[0065] Three major effective allelic markers related to growth traits were selected from Table 3 of Example 1, which were CM083680.1_19540159_C / T (M448 in Table 2), CM083687.1_12326739_C / T (M4069 in Table 2), and CM083693.1_7847719_G / A (M4446 in Table 2), respectively. The SNP molecular markers linked to the major effective QTL and the flanking 1000 bp sequences were extracted by using TBtools software, and the amplification primers were designed by using Primer 5 software (Table 4).

[0066] Table 4: SNP molecular marker primers

[0067] Primer name Sequence Annealing temperature M448-F ACACCCCCAAAGAAAGATCC (as shown in SEQ NO: 1) 60℃ M448-R TGAAAAGGATGGGGTCCATA (as shown in SEQ NO: 2) 60℃ M4069-F TTCGGGAGCCACTACACTTC (as shown in SEQ NO: 3) 55℃ M4069-R TTACAGCCTGGTGACGTCTG (as shown in SEQ NO: 4) 55℃ M4446-F AAGCCTGACGGAAACAAAGA (as shown in SEQ NO: 5) 60℃ M4446-R CAAAAATTGTGTTCCCCAGTG (as shown in SEQ NO: 6) 60℃

[0068] F is the upstream primer, and R is the downstream primer;

[0069] Sixty Trachinotus ovatus were randomly selected to form a verification population, and eight growth traits of the Trachinotus ovatus were measured, and the tail fins were cut off and fixed in anhydrous ethanol for subsequent DNA extraction. The DNA of the tail fins of the verification population was extracted by using the phenol-chloroform method. The DNA of the 60 Trachinotus ovatus in the verification population was subjected to PCR amplification of the three SNP sites.

[0070] The size of the amplified product band was detected by using 1% agarose gel electrophoresis, and the PCR product was subjected to Sanger sequencing. The genotype information of the corresponding SNP sites was confirmed by using BioEdit software to align the Sanger sequencing results. The corresponding relationship between the different genotypes of the three SNP sites and the three growth phenotypes of body weight, total length, and body length is shown in Table 5. The average values of the growth phenotypes (body weight, total length, and body length) of the individuals carrying the dominant alleles were higher than those of the individuals carrying the non-dominant alleles, and the difference was significant (P<0.05) in the body weight phenotype.

[0071] Table 5: Corresponding relationship between SNP site genotypes and growth phenotypes in the verification population

[0072]

[0073]

[0074] Obviously, those skilled in the art can make various modifications and variations to the present application without departing from the spirit and scope of the present application. Thus, if these modifications and variations of the present application fall within the scope of the claims of the present application and their equivalent technologies, the present application also intends to include these modifications and variations.

Claims

1. A method for locating QTLs related to growth traits of Trachurus japonicus based on 2b-RAD technology, characterized in that, The method comprises the following steps: (1) selecting sexually mature Trachurus japonicus individuals as parents, hybridizing the parent individuals to generate F1 full-sibling families, and extracting genomic DNA of each sample; (2) performing genotyping on the parent individuals and 300 F1 individuals by using 2b-RAD technology, filtering SNP markers, obtaining 15015 polymorphic SNP sites in total, then taking a reference genome at a known chromosome level as a reference, merging the markers into corresponding linkage groups according to genotyping information of the markers and calculated genetic distances, removing markers on non-chromosomes, and taking a marker with the highest integrity, i.e., the lowest missing rate, in each genetic position as a mapping marker, and finally obtaining 4248 SNP markers for constructing an integrated map; (3) constructing a genetic map by using the 4248 screened SNP markers in step (2) in a double pseudo-test cross strategy; (4) measuring growth trait phenotypes of the parent individuals and the F1 full-sibling families in step (1), determining whether the distribution mode of the growth trait phenotypes is normally distributed by using Kolmogorov-Smirnov test, calculating Pearson correlation coefficients r between the growth traits, and finally selecting 8 growth traits with the highest correlation for subsequent QTL positioning. (5) Analyzing the genetic map constructed in step (3) and the growth trait phenotype identification results of step (4), using MapQTL6 to perform interval mapping on the 8 growth traits, obtaining a total of 85 QTLs related to the growth traits, which are distributed on the linkage groups LG1, LG3, LG4, LG5, LG6, LG7, LG8, LG9, LG11, LG12, LG14, LG15, LG18, LG19, LG20, LG21, LG23, LG24, and are named qBW-1, qBW-2, qBW-3, qBW-4, qBW-5, qBW-6, qBW-7, qBW-8, qBW-9, qBW-10, qBW-11, qBW-12, qBW-13, qBW-14, qBW-15, qBW-16, qBW-17, qBW-18, qBW-19, qBWH-1, qBWH-2, qBWH-3, qTL-1, qTL-2, qTL-3, qTL-4, qTL-5, qTL-6, qTL-7, qTL-8, qTL-9, qBL-1, qBL-2, qBL-3, qBL-4, qBL-5, qBL-6, qBL-7, qBL-8, qBL-9, qBL-10, qBL-11, qBL-12, qBL-13, qBL-14, qHH-1, qHH-2, qHH-3, qHH-4, qHH-5, qHH-6, qHH-7, qHH-8, qHH-9, qHH-10, qHH-11, qHH-12, qHH-13, qHH-14, qHH-15, qHH-16, qHH-17, qBH-1, qBH-2, qBH-3, qBH-4, qBH-5, qBH-6, qBH-7, qBH-8, qBH-9, qBH-10, qCPL-1, qCPL-2, qCPL-3, qCPL-4, qCPL-5, qCPH-1, qCPH-2, qCPH-3, qCPH-4, qCPH-5, qCPH-6, qCPH-7, and qCPH-8.

2. The method for locating the QTL related to the growth traits of Trachurus japonicus based on 2b-RAD technology according to claim 1, wherein, In step (2), the sites without mutant alleles are removed, the sites with N bases are removed, the tags with more than 3 SNPs in one tag are removed, the sites with two types of typing at the same position are removed, the genotype proportion of the marker sites is subjected to chi-square test, the markers with segregation types of lmxll, nnxnp and hkxhk are retained, and a total of 15015 polymorphic SNP sites are obtained.

3. The method for locating the QTL related to the growth traits of Trachurus japonicus based on 2b-RAD technology according to claim 1, wherein, In step (2), the 4248 SNP markers have the polymorphic tags and distributions on the linkage groups shown in Table 1 in the specification.

4. The method for locating the QTL related to the growth traits of Trachurus japonicus based on 2b-RAD technology according to claim 1, wherein, In step (2), the phenotypes of growth traits of the parental generation and the full-sib family population of F1 generation in step (1) are measured, and the growth traits are 11 growth traits, including body weight BW, body width BWH, total length TL, body length BL, head length HL, head height HH, body height BH, snout length SL, eye diameter ED, caudal peduncle length CPL, and caudal peduncle height CPH.

5. The method for locating the QTL related to the growth traits of Trachurus japonicus based on 2b-RAD technology according to claim 1, wherein, In step (2), the 8 growth traits are body weight BW, body width BWH, total length TL, body length BL, head height HH, body height BH, caudal peduncle length CPL, and caudal peduncle height CPH.

6. The method for locating the QTL related to the growth traits of Trachurus japonicus based on 2b-RAD technology according to claim 1, wherein, In step (5), interval mapping is performed on the 8 growth traits using MapQTL 6.0, the highest LOD value on the linkage group or the closely linked marker site in the region is determined and set as the cofactor for multiple QTL model mapping, the scanning step is 1 cM, and LOD = 3.0 is used as the threshold for screening QTL.

7. The method of locating the QTL related to the growth traits of Trachurus japonicus based on the 2b-RAD technology according to claim 1, wherein, In step (5), each QTL is as shown in Table 2 in the specification.

8. Use of the method of any one of claims 1-7 in the genetic map of the growth traits of Trachomus ovatus or in the molecular marker assisted breeding of Trachomus ovatus.

9. Use according to claim 8, characterized in that: The 763 SNP sites of the 85 growth trait-related QTLs each contain two different alleles, and the allelic variation of each SNP site is detected, the physical positions of the 763 SNP sites are determined based on the sequence alignment of the Trachomus ovatus reference genome GCA_022709315.2, the variation information of the 763 SNP sites is represented in the form of chromosome number_ physical position_reference genotype / allele genotype, and the variation information of the 763 SNP sites is shown in Table 3 in the specification.

Images