Application of HVEM inhibitors in the preparation of drugs for the treatment of acute lymphoblastic leukemia

By knocking out the HVEM gene in tumor cells through CRISPR/Cas9 and combining it with doxorubicin chemotherapy, the treatment difficulties of acute lymphoblastic leukemia have been solved, and efficient, low-cost tumor-free survival and long-term immune protection have been achieved.

CN118649235BActive Publication Date: 2025-09-16SUN YAT SEN UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202410583986.3
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-05-11
Publication Date
2025-09-16
Estimated Expiration
2044-05-11

AI Technical Summary

Technical Problem

Existing methods for treating acute lymphoblastic leukemia have problems such as severe side effects, high recurrence rate, and high cost. In particular, chemotherapy, hematopoietic stem cell transplantation, and targeted drug therapy have limited effects, and immunotherapy such as chimeric antigen receptor T cell therapy is ineffective for patients with acute T lymphoblastic leukemia.

Method used

CRISPR/Cas9 gene editing technology is used to knock out the HVEM gene in tumor cells, combined with doxorubicin chemotherapy to enhance the anti-tumor effect of immune cells, especially the anti-tumor response of CD8+T cells, and form immune memory.

Benefits of technology

Significantly inhibit the progression of tumor cells, achieve tumor-free survival, establish long-term immune protection, prevent disease recurrence, and reduce treatment costs.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN118649235B_ABST
    Figure CN118649235B_ABST
Patent Text Reader

Abstract

The present invention relates to the field of tumor treatment technology, and specifically discloses the use of an HVEM inhibitor in the preparation of a drug for treating acute lymphoblastic leukemia. The present invention utilizes CRISPR / Cas9 gene editing technology to knock out the HVEM gene on tumor cells, thereby enhancing the body's anti-tumor immune response and significantly inhibiting tumor growth. Mechanistically, the present invention demonstrates that the anti-tumor immune response mediated by HVEM deficiency depends on CD8 + T cells, and HVEM, through its CRD1 domain, enables tumor cells to escape the body's immune surveillance, thereby promoting tumor progression. Furthermore, by knocking out the HVEM gene on tumor cells and combining it with doxorubicin chemotherapy, mice inoculated with acute lymphoblastic leukemia can achieve disease-free survival and induce immune memory in the body, effectively preventing tumor recurrence. This provides a new drug target for immunotherapy combined with chemotherapy for acute lymphoblastic leukemia.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of tumor treatment, and more particularly to the use of an HVEM inhibitor in the preparation of a drug for treating acute lymphoblastic leukemia. Background Art

[0002] Leukemia is the most common pediatric cancer, of which acute lymphoblastic leukemia is the most common subtype. Although various leukemia treatment options have effectively improved the survival of leukemia patients after years of development, each therapy has certain drawbacks. The side effects of chemotherapy are very serious. A considerable number of patients experience relapse after hematopoietic stem cell transplantation and targeted drug therapy. Although immunotherapy such as chimeric antigen receptor T cell therapy has excellent therapeutic effects, its cost is very high and it is ineffective for patients with acute T lymphoblastic leukemia. Therefore, there is an urgent need to explore new targets for acute lymphoblastic leukemia and develop efficient, time-saving, and low-cost treatment strategies to optimize current leukemia treatments.

[0003] Herpes simplex virus entry mediator (HVEM, also known as TNFRSF14, CD270), a member of the tumor necrosis factor receptor family, is expressed on T cells, B cells, natural killer cells, monocytes, and dendritic cells. Current research indicates that HVEM regulates multiple biological activities in immune cells, exhibiting bidirectional immunomodulatory functions. As a ligand, HVEM binds to BTLA or CD160, transducing inhibitory signals into T cells and other immune cells, thereby inhibiting target cell proliferation and activation. Conversely, when HVEM binds to LIGHT or LTα, it transmits co-stimulatory signals to T cells, exerting a positive feedback loop on T cell activation. As a receptor, HVEM can transmit pro-inflammatory and pro-survival signals through BTLA or LIGHT. Recent clinical trial results have demonstrated that anti-BTLA antibodies exhibit potent anti-tumor efficacy in the treatment of solid tumors (NCT04137900, NCT03856411). Furthermore, activating LIGHT or targeting CD160 to activate immune cells can also enhance anti-tumor responses.

[0004] While the molecular mechanisms of HVEM in immune cells have been extensively explored, few studies have examined the functional mechanisms of endogenous HVEM in tumors. Previous studies have revealed a positive correlation between HVEM expression and tumor progression in various solid tumors, including melanoma, glioblastoma, and hepatocellular carcinoma. HVEM is also a marker of poor prognosis in follicular lymphoma and chronic lymphocytic leukemia. However, within the field of oncology research, few researchers have focused on the association between HVEM and hematologic malignancies, including leukemia, leaving room for further exploration. Summary of the Invention

[0005] The present invention aims to overcome at least one of the deficiencies of the above-mentioned prior art and provides an application of an HVEM inhibitor in the preparation of a drug for treating acute lymphoblastic leukemia. The HVEM gene, protein and / or protein intermediate of tumor cells is used as an inhibition target, which can inhibit the progression of acute lymphoblastic leukemia and enhance the anti-tumor effect of immune cells.

[0006] One object of the present invention is to provide a use of an HVEM inhibitor in the preparation of a drug for treating acute lymphoblastic leukemia. In one or more embodiments of the present invention, it was found that knocking out HVEM in acute lymphoblastic leukemia tumor cells can significantly inhibit the progression of tumor cells.

[0007] Existing research indicates that HVEM regulates multiple biological activities in immune cells and exhibits bidirectional immunomodulatory functions. Based on this, existing technologies have applied HVEM as a tumor tissue target in the treatment of solid cancers, such as colon and prostate cancer. However, few researchers have focused on the relationship between HVEM and hematological malignancies, including leukemia. This application, however, creatively addresses acute lymphoblastic leukemia tumor tissue and, in more than one example, demonstrates that knocking out HVEM in acute lymphoblastic leukemia tumor cells significantly inhibits tumor cell progression. This suggests that HVEM inhibitors are promising for the preparation of drugs for the treatment of acute lymphoblastic leukemia, providing a new therapeutic strategy.

[0008] Furthermore, HVEM inhibitors target and knock down or eliminate HVEM expression in tumor cells.

[0009] Furthermore, HVEM inhibitors include CRISPR / Cas9 agents that inhibit HVEM expression.

[0010] Furthermore, the CRISPR / Cas9 formulation includes sgRNA; the sgRNA sequences are shown in SEQ ID NO. 1 and SEQ ID NO. 2; SEQ ID NO. 1 is CACCGCATGGGC CTGCTGACCTGGC, and SEQ ID NO. 2 is AAACGCCAGGTCAGCAGGCCCATGC. In one or more embodiments of the present invention, the sgRNA can be used to successfully construct a tumor cell line in which the HVEM gene is knocked out.

[0011] Furthermore, the acute lymphoblastic leukemia treatment drug includes doxorubicin. In one or more embodiments of the present invention, it was found that when HVEM knockout tumor cells were combined with the chemotherapy drug doxorubicin, tumor-free survival was achieved in the subjects and immune memory was formed. The tumor was acute lymphoblastic leukemia.

[0012] Another object of the present invention is to provide the use of the HVEM gene, its protein, or its protein intermediate as a tumor tissue target in the preparation of a tumor immunotherapy drug. The tumor is acute lymphoblastic leukemia. In one or more embodiments of the present invention, it was found that knocking out HVEM in tumor cells, but not immune cells, has an anti-tumor effect.

[0013] Another object of the present invention is to provide an HVEM inhibitor targeting tumor cell HVEM for use in the preparation of a drug for enhancing the anti-tumor effect of immune cells. In one or more embodiments of the present invention, it was found that knocking out HVEM in tumor cells had an anti-tumor effect, and the anti-tumor effect was mainly dependent on CD8 + T cells actually enhance the anti-tumor effect of corresponding immune cells.

[0014] Furthermore, the knockout of the HVEM gene is achieved by gene mutation, RNA-mediated inhibition, RNA editing, DNA gene editing and / or base editing.

[0015] Further, gene editing involves the use of Cas enzymes.

[0016] Furthermore, tumor cells obtained according to the above-mentioned gene editing method are provided.

[0017] Another object of the present invention is to provide an HVEM inhibitor, comprising sgRNA; the sgRNA sequences are shown in SEQ ID NO.1 and SEQ ID NO.2; the SEQ ID NO.1 is CACCGCATGGGC CTGCTGACCTGGC, and the SEQ ID NO.2 is AAACGCCAGGTCAGCAGGCCCATGC.

[0018] Compared with the prior art, the present invention has the following beneficial effects:

[0019] The present invention uses CRISPR / Cas9 gene editing technology to knock out the HVEM gene on tumor cells, thereby enhancing the body's anti-tumor immune response and significantly inhibiting tumor growth. Mechanistically, the present invention proves that the anti-tumor immune response mediated by HVEM deletion depends on CD8 + HVEM activates T cells, and through its CRD1 domain, it enables tumor cells to escape the body's immune surveillance, thereby promoting tumor progression. Furthermore, by knocking out the HVEM gene on tumor cells, combined with doxorubicin chemotherapy, mice inoculated with acute lymphoblastic leukemia can achieve disease-free survival and induce strong and long-term immune protection in their bodies, effectively preventing tumor recurrence.

[0020] Current therapies for treating acute lymphoblastic leukemia each have their drawbacks. Both hematopoietic stem cell transplantation and targeted drug therapy result in relapse in a significant proportion of patients. While immunotherapies such as chimeric antigen receptor T-cell therapy offer superior therapeutic effects, they are very expensive and ineffective for patients with acute T-lymphocytic leukemia. The present invention, through targeted HVEM combined with doxorubicin therapy, can completely regress tumors in individuals with acute lymphoblastic leukemia and establish long-term immune protection against tumors. This is of great significance for the treatment of acute lymphoblastic leukemia and the effective prevention of disease recurrence, providing a new drug target for immunotherapy combined with chemotherapy. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 Shown is flow cytometry validation of HVEM expression in EL4-Vec and HVEM KO EL4 cell lines.

[0022] Figure 2 a shows that HVEM knockout significantly inhibits the growth of acute lymphoblastic leukemia subcutaneous tumors, Figure 2 b shows that HVEM knockout can significantly delay the survival of subcutaneous tumor-bearing mice with acute lymphoblastic leukemia.

[0023] Figure 3 a shows that HVEM knockout increases the infiltration of immune cells in the tumor microenvironment, Figure 3 b shows that HVEM knockout increases the infiltration of CD8+ T cells in the tumor microenvironment.

[0024] Figure 4 a shows that HVEM knockout significantly inhibits the growth of subcutaneous acute lymphoblastic leukemia tumors in a CD8-dependent manner + T cells, Figure 4 b shows that the effect of HVEM knockout in delaying the survival of subcutaneous acute lymphoblastic leukemia tumor-bearing mice depends on CD8+ T cells.

[0025] Figure 5 a shows that HVEM knockout significantly inhibits the growth of subcutaneous acute lymphoblastic leukemia tumors in a CD8-dependent manner + T cells, Figure 5 b shows that the effect of HVEM knockout in delaying the survival of subcutaneous acute lymphoblastic leukemia tumor-bearing mice is dependent on CD8 + T cells.

[0026] Figure 6 It was shown that HVEM knockout combined with doxorubicin treatment completely eliminated subcutaneous tumors in acute lymphoblastic leukemia.

[0027] Figure 7 It was shown that HVEM knockout combined with doxorubicin treatment can trigger long-term immune memory. DETAILED DESCRIPTION

[0028] It should be noted that the following detailed descriptions are illustrative and intended to provide further explanation of the present application. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art to which the present application belongs.

[0029] It should be noted that the terms used herein are only for describing specific embodiments and are not intended to limit the exemplary embodiments according to the present application. As used herein, unless the context clearly indicates otherwise, the singular form is also intended to include the plural form. In addition, it should be understood that when the terms "comprise" and / or "include" are used in this specification, they indicate the presence of features, steps, operations, devices, components and / or combinations thereof.

[0030] The present invention will now be further described with reference to specific examples. The following examples are intended only to illustrate the present invention and are not intended to limit the present invention. Experimental conditions not specified in the examples are generally based on conventional conditions or those recommended by the reagent company. Reagents and consumables used in the following examples, unless otherwise specified, are commercially available.

[0031] Example 1

[0032] 1. Construction of HVEM gene knockout EL4 cell line

[0033] In this example, the mouse acute T-lymphoblastic leukemia cell line EL4 was used as an acute T-lymphoblastic leukemia tumor model. The HVEM knockout EL4 cell line (HVEM KO EL4) was constructed using CRISPR-Cas9 technology, and EL4 cells transduced with an empty vector were used as a control (EL4-Vec). Flow cytometry was used to stain the knockout cell line to determine the knockout status of the HVEM gene ( Figure 1 The sgRNA sequences used to knock out the HVEM gene are as follows: 1F-CACCGCATGGGCCTGCTGACCTGGC (SEQ ID NO.1); 1R-AAACGCCAGGTCAGCAGGCCCATGC (SEQ ID NO.2).

[0034] II. Monitoring the in vivo growth of HVEM KO EL4

[0035] The above HVEM KO EL4 or EL4-Vec cell lines were subcutaneously inoculated into C57BL / 6 mice at an inoculation dose of 0.5×10 6 tumor cells / 50 μl PBS. Compared with the control group, Figure 2 a shows that the tumor volume of the knockout group was significantly reduced. Figure 2b shows that the survival time of the knockout group was significantly prolonged, proving that knocking out HVEM can significantly inhibit the occurrence and development of tumors in vivo.

[0036] III. Analysis of the Tumor Immune Microenvironment in HVEM KO EL4

[0037] The HVEM KO EL4 or EL4-Vec cell lines were subcutaneously inoculated into C57BL / 6 mice. On day 17, the intact tumors were dissected and removed. Single cell suspensions were prepared and flow cytometric analysis of the tumor immune microenvironment was performed. Figure 3 As shown, compared with the control group, the immune cells and CD8 + T cell infiltration was significantly increased, indicating that the loss of endogenous HVEM in tumors can reshape the tumor immune microenvironment and increase the number of immune cells, especially CD8 + T cell infiltration.

[0038] 4. Identification of key immune cell subsets in HVEM knockout-mediated anti-tumor immune responses through immune cell depletion

[0039] The above HVEM KO EL4 or EL4-Vec cell lines were subcutaneously inoculated into C57BL / 6 mice at an inoculation dose of 0.5×10 6 Tumor cells / 50 μl PBS, and CD8 was eliminated in mice using CD8 blocking antibody. + T cells. The results are as follows Figure 4 As shown, it can be observed that in the absence of CD8 + In the presence of T cells, the tumor growth rate and survival prognosis of HVEM knockout mice were similar to those of the control group, and compared with those without CD8 T cells + Tumors with HVEM knockout of T cells had significantly increased tumor volume and significantly shortened survival, demonstrating that the anti-tumor immune response mediated by HVEM knockout depends on CD8+ T cells.

[0040] 5. Determining the functional domains of HVEM molecules that exert immunosuppressive effects by constructing HVEM mutants

[0041] The extracellular portion of HVEM is composed of four cysteine-rich domains (CRDs). HVEM endogenous to immune cells exerts bidirectional immunomodulatory effects through distinct CRD domains, whereas the function of HVEM endogenous to tumor cells remains unclear. Therefore, the present invention constructed HVEM mutant EL4 cell lines, EL4 ΔCRD1 (CRD1 domain deleted) and EL4 ΔCRD3 (CRD3 domain deleted). The constructed ΔCRD1 sequence is shown in SEQ ID NO. 3.

[0042] The above HVEM KO EL4 or EL4-Vec or EL4 ΔCRD1 or EL4 ΔCRD3 cell lines were subcutaneously inoculated into C57BL / 6 mice at an inoculation dose of 0.5×10 6 Tumor cells / 50 μl PBS. Figure 5 As shown, CRD1 deficiency significantly inhibited tumor growth and prolonged mouse survival, whereas CRD3 deficiency significantly accelerated tumor growth and shortened mouse survival, indicating that the CRD1 domain is crucial for HVEM to exert its immunosuppressive function. Therefore, tumor-resident HVEM promotes tumor progression through its CRD1 domain.

[0043] VI. Study on the efficacy of HVEM knockout combined with doxorubicin treatment

[0044] Doxorubicin (Dox) is an antimitotic cytotoxic drug commonly used in the treatment of acute leukemia. HVEMKO EL4 or EL4-Vec cell lines were subcutaneously inoculated into C57BL / 6 mice at a dose of 0.5×10 per mouse. 6 The mice were treated with 2.5 mg / kg dose of doxorubicin. Figure 6 As shown, mice vaccinated with HVEMKO EL4 achieved tumor-free survival when treated with doxorubicin, indicating that HVEM knockout combined with doxorubicin treatment can completely eliminate acute lymphoblastic leukemia and achieve a cure.

[0045] VII. Study on the Effect of HVEM Knockout Combined with Doxorubicin on Immune Memory Formation

[0046] The mice that were inoculated with HVEM KO EL4 and recovered after receiving doxorubicin treatment were re-inoculated with 2.5×10 6 EL4 cells. Figure 7 As shown, the tumors of most individuals will still completely regress or progress slowly, indicating that targeting HVEM and combining it with doxorubicin can enable the body to form systemic immune memory.

[0047] According to the latest statistics, acute lymphoblastic leukemia is the most common subtype of pediatric cancer, and the five-year survival rate for acute lymphoblastic leukemia patients over 50 years old is only 25%. Therefore, the discovery of new targets and new mechanisms for acute lymphoblastic leukemia is of great significance. As previously mentioned in this application regarding HVEM as a new target for acute lymphoblastic leukemia and the embodiments of this application, in one or more embodiments of the present invention, knockout of the tumor HVEM gene and combined treatment with doxorubicin can achieve disease-free survival in mice inoculated with acute lymphoblastic leukemia and induce the production of systemic immune memory in their bodies. These results indicate that knockout of the tumor HVEM gene and combination with doxorubicin have significant therapeutic effects and effectively prevent tumor recurrence, thereby providing a new drug target for combination therapy.

[0048] Obviously, the above embodiments of the present invention are merely examples for the purpose of clearly illustrating the technical solutions of the present invention, and are not intended to limit the specific implementation methods of the present invention. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the claims of the present invention shall be included within the scope of protection of the claims of the present invention.

Claims

1. Use of an HVEM inhibitor in the preparation of a drug for treating acute lymphoblastic leukemia, characterized in that: HVEM inhibitors target and knock down or eliminate HVEM expression in tumor cells; The HVEM inhibitor is a CRISPR / Cas9 preparation that inhibits HVEM expression; The CRISPR / Cas9 preparation is sgRNA; the sgRNA sequences are shown in SEQ ID NO.1 and SEQ ID NO.2; the SEQ ID NO.1 is CACCGCATGG GCCTGCTGAC CTGGC, and the SEQ ID NO.2 is AAACGCCAGGTCAGCAGGCC CATGC.

2. The use according to claim 1, characterized in that Doxorubicin is also used to treat acute lymphoblastic leukemia.

3. Use of an HVEM inhibitor according to claim 1 in combination with a chemotherapy drug in the preparation of a drug for treating acute lymphoblastic leukemia.

4. The use according to claim 3, characterized in that The chemotherapy drug comprises doxorubicin.