Salt stress positive regulation gene bc crk35 and application thereof

By constructing recombinant vectors to overexpress or silence the BcCRK35 gene, the salt tolerance of yeast and non-heading Chinese cabbage was regulated, solving the problem of the complex genetic mechanism of salt tolerance in non-heading Chinese cabbage. This achieved positive regulation under salt stress, improved salt tolerance, and laid a theoretical foundation for the breeding of new varieties.

CN120888575BActive Publication Date: 2025-12-26VEGETABLE RES INST OF HAINAN ACAD OF AGRI SCI
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202511299150.1
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-09-11
Publication Date
2025-12-26
Estimated Expiration
2045-09-11

AI Technical Summary

Technical Problem

Existing technologies are insufficient to effectively elucidate the salt tolerance genetic mechanism of non-heading Chinese cabbage. The multi-gene synergistic regulatory network has not yet been systematically elucidated, resulting in limited single-gene improvement effects and difficulty in enhancing crop stress resistance.

Method used

This invention provides a positive regulatory gene for salt stress, BcCRK35, and its application. By constructing a recombinant vector to overexpress or silence the BcCRK35 gene, the salt tolerance of yeast and non-heading Chinese cabbage can be regulated. The positive regulatory effect of the BcCRK35 gene under salt stress conditions can be used to enhance or reduce their salt tolerance.

Benefits of technology

Positive regulation of the BcCRK35 gene significantly enhances the salt stress tolerance of yeast and non-heading Chinese cabbage, providing a theoretical basis for studying the salt stress response mechanism and offering gene resources for breeding salt-tolerant new varieties.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120888575B_ABST
    Figure CN120888575B_ABST
Patent Text Reader

Abstract

The application belongs to the technical field of genetic engineering, and particularly relates to a salt stress positive regulation gene BcCRK35 and application thereof. The nucleotide sequence of the BcCRK35 gene is shown as SEQ ID NO. 1, and the amino acid sequence is shown as SEQ ID NO. 2. The gene can be used for regulating salt tolerance of yeast and Chinese cabbage. Overexpression of the gene in yeast enhances the salt stress tolerance of the yeast. Knockout or silencing of the gene reduces the salt tolerance of Chinese cabbage. The yeast overexpression of the constructed BcCRK35 proves that the gene plays a positive regulation role in salt stress. Meanwhile, silencing of the BcCRK35 gene leads to reduction of the salt stress tolerance of the silencing plant. The application lays a theoretical foundation for research on a plant salt stress response mechanism, provides a gene resource for breeding of a new salt-tolerant Chinese cabbage variety, and has good potential application value.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of genetic engineering, and particularly relates to a salt stress positive regulation gene BcCRK35 and application thereof. BACKGROUND

[0002] Salt stress is one of the important abiotic stress factors restricting global crop production. With the global climate change and the continuous development of irrigation agriculture, the problem of soil salinization is increasingly serious. The area of saline soil in the world has reached about 9.5x10 6 km 2 , and the area of saline soil in China is about 7.5x10 5 km 2 , which seriously restricts the sustainable development of agricultural production. Pakchoi (Brassica rapa ssp. chinensis, also known as small cabbage or green vegetable) as an important leafy vegetable crop, is originated from China, has strong adaptability, short growth cycle and high nutritional value, is a popular vegetable in southern China, and plays an important role in the "vegetable basket" project and is increasingly becoming a world vegetable. However, the yield and quality of pakchoi are easily affected by salt stress, which shows growth inhibition, ion toxicity and oxidative damage.

[0003] The influence of salt stress on pakchoi runs through its entire growth cycle. Studies have shown that with the increase of salt stress, the germination rate, root length, dry and fresh weight of root, cotyledon and hypocotyl, and respiration intensity of pakchoi seeds are significantly reduced. Under salt stress, the Mg 2+ , Ca 2+ and K + contents in the leaves of pakchoi decrease, while the Na + and Cl- contents increase, leading to ion imbalance. In addition, salt stress also affects photosynthetic characteristics, reduces photosynthetic rate and pigment content, destroys the stability of photosystem II, and affects the fluorescence characteristics of pigments. Oxidative damage caused by salt stress shows the disorder of antioxidant enzyme system, abnormal activities of superoxide dismutase (SOD), peroxidase (POD) and catalase (CAT).

[0004] Although some salt-tolerant genes of B. rapa have been identified, such as S44 gene (helping to enhance plant salt tolerance), BrTLP gene family (especially BrTLP14 has the strongest response to salt stress), and BrNAC transcription factor gene (related to cold resistance and possibly involved in salt response), the genetic mechanism of salt tolerance of B. rapa is extremely complex and is controlled by multiple genes, which is the result of the synergistic effect of multiple genes. At present, the molecular mechanism of the response of each cell type of B. rapa to salt stress is still poorly understood. For example, studies have shown that root hairs are the most sensitive cell group to high salt stress, and salt stress inhibits the development of root hairs, leading to a decrease in the expression of mature root hair-specific gene BcIRT2, and a decrease in the iron absorption capacity of the root system. Studies at the single-cell level have found that high salt and osmotic stress inhibit the transition of differentiating root hairs to mature root hairs in a similar way, resulting in a non-adaptive response of root hairs to environmental response and ion absorption.

[0005] In recent years, researchers have explored various strategies to improve crop salt tolerance, including multi-omics methods, microbial-mediated strategies, and genetic engineering. However, the improvement effect of individual functional genes introduced by molecular breeding on plant stress resistance is very limited, and even if multiple genes are introduced, the problem of coordination between genes is difficult to solve. Some protein factors that play a regulatory role in the signal transduction network, especially kinase proteins, can initiate the signal transduction network through the expression of a single gene, activate the transcription and expression of numerous functional genes downstream, and activate functional proteins, thereby achieving the effect of comprehensive improvement of crop stress resistance. However, the genetic mechanism of salt tolerance of B. rapa is complex, and the synergistic regulation network of multiple genes has not been systematically analyzed; therefore, it is urgent to systematically mine key genes of B. rapa for salt tolerance, analyze their molecular regulation network, and develop effective molecular breeding techniques to provide gene resources and theoretical basis for breeding new salt-tolerant B. rapa varieties. SUMMARY

[0006] The purpose of the present application is to overcome the shortcomings of the prior art and provide a salt stress positive regulation gene BcCRK35 and its application.

[0007] The purpose of the present application is achieved by the following technical solution: a salt stress positive regulation gene, the gene is BcCRK35, the nucleotide sequence is shown as SEQ ID NO. 1.

[0008] As a preferred technical solution, the amino acid sequence of the BcCRK35 gene is shown as SEQ ID NO. 2.

[0009] As a preferred technical solution, overexpression of the BcCRK35 gene enhances the tolerance of yeast to salt stress.

[0010] The BcCRK35 gene described above is used in the regulation of salt tolerance of B. rapa.

[0011] As a preferred technical solution, the BcCRK35 gene is knocked out or silenced to reduce the salt tolerance of Brassica chinensis.

[0012] The primer pair for amplifying the BcCRK35 gene comprises a forward primer and a reverse primer, the nucleotide sequence of the forward primer is shown in SEQ ID NO. 3; and the nucleotide sequence of the reverse primer is shown in SEQ ID NO. 4.

[0013] The biological material capable of regulating the expression amount of the BcCRK35 gene comprises a biological material overexpressing the BcCRK35 gene and a biological material knocking out or silencing the BcCRK35 gene; and the nucleotide sequence of the BcCRK35 gene is shown in SEQ ID NO. 1.

[0014] As a preferred technical solution, the biological material overexpressing the BcCRK35 gene is one or more of a recombinant expression vector containing the BcCRK35 gene or a transgenic cell line containing the BcCRK35 gene, and the basic skeleton of the recombinant expression vector is a pYES2-NTB vector.

[0015] As a preferred technical solution, the biological material knocking out or silencing the BcCRK35 gene is one or more of a recombinant vector knocking out or silencing the BcCRK35 gene or a transgenic cell line knocking out or silencing the BcCRK35 gene, and the basic skeleton of the recombinant expression vector is a pK7GWIWG2 vector (I).

[0016] The primer pair or the biological material described above is applied to regulating the salt tolerance of Brassica chinensis.

[0017] The present application has the following advantages: the present application provides a salt stress positive regulation gene BcCRK35 and an application thereof, the BcCRK35 gene is a salt stress positive regulation gene, and the BcCRK35 gene can be used to regulate the salt tolerance of yeast and the salt tolerance of Brassica chinensis. It is proved that the gene plays a positive regulation role in salt stress through the constructed BcCRK35 yeast overexpression. After the BcCRK35 gene is silenced, the salt stress tolerance of the silenced plant is reduced. The BcCRK35 gene obtained by the present application lays a theoretical foundation for studying the plant salt stress response mechanism, provides a gene resource for breeding new varieties of salt-tolerant Brassica chinensis, and has good potential application value. BRIEF DESCRIPTION OF DRAWINGS

[0018] Figure 1 Analysis diagram of cis-acting elements of the BcCRK35 gene.

[0019] Figure 2Figure 1 is a diagram of the expression analysis of BcCRK35 gene under salt stress.

[0020] Figure 3 Figure 2 is a diagram of the phenotype of BcCRK35 gene overexpression yeast under salt stress.

[0021] Figure 4 Figure 3 is a diagram of the expression detection results of BcCRK35 gene in BcCRK35 gene silenced plants under salt stress.

[0022] Figure 5 Figure 4 is a diagram of the growth phenotype of negative control and BcCRK35 gene silenced Brassica chinensis under salt stress.

[0023] Figure 6 Figure 5 is a diagram of the single plant fresh weight and root volume of negative control and BcCRK35 gene silenced Brassica chinensis under salt stress.

[0024] Figure 7 Figure 6 is a diagram of the relative conductivity and malondialdehyde content of negative control and BcCRK35 gene silenced Brassica chinensis under salt stress.

[0025] Figure 8 Figure 7 is a diagram of the Na + and K + content of negative control and BcCRK35 gene silenced Brassica chinensis under salt stress. DETAILED DESCRIPTION

[0026] The present application will be further described below in conjunction with the accompanying drawings and examples, and the protection scope of the present application is not limited to the following description: the experimental materials and reagents used in the present application are all consumables and reagents that can be obtained from commercial channels, and if not specifically stated, are conventional.

[0027] Example 1: BcCRK35 gene cloning and bioinformatics analysis

[0028] The Unigene gene sequence obtained from the previous Brassica chinensis full-length transcriptome data was used as a reference sequence, and the full length of the gene was obtained by whole genome synthesis method. Then, by BLAST comparison in NCBI database and Arabidopsis genome website, combined with transcriptome annotation results, it was named as BcCRK35 gene. The open reading frame (ORF) of BcCRK35 is 777 bp, which can encode 258 amino acid residues, and the molecular formula of the protein is C 1249 H 1962 N 326 O 386 S 17, the total number of atoms is 3940, the relative molecular weight is 28.27 kDa, the theoretical isoelectric point is 5.05, the fatty coefficient is 78.22, the average hydrophobicity is -0.043, and the instability coefficient is 37.37. The cis-acting elements of the BcCRK35 gene were analyzed by using an online tool PlantCARE (http: / / bioinformatics.psb.ugent.be / webtools / plantcare / html / ), and it was found that the BcCRK35 gene contains multiple salt stress-related response elements such as DRE, MYB, MYC, W box, and the like, as shown in Table 1. Figure 1 The CDS sequence of the BcCRK35 gene is as follows:

[0029] ATGGTACGTTATTCCAACGTTTCCTTCTCCGGATCACTCCTCATGGAACCATCACAAGCTCTGTACAACACTGGAGATATCGGAGATACTGATGCTAATATGACGGTGTTCGATAGAGTCTATGATGAGTTAATGATCCGTACAATTACTGCAGCTTCAAACGGATCATCATCCTTTGAGCAAAAGTATTTCGCAGCTGAGGTCGCTTCGTTGACCAACTTAGAAACTATGTACGCAATGATGCAATGTACGCCTGATGTTTCTTCAGGGGACTGTGAGTTTTGTCTCGAGAAAAGCGTCGGCGAGTATTCTTCTTGTTGTCGCGGTAAACAAGGTGGTGCGGTTATAAGACCGAGTTGCTTTTTCCGGTGGGATTTGTATCCTTATGCTGGAGCTTTTGATAATGTTACATTGCCACCGGCTCGACCGCAGGCTTCATCTCCGCCACCGCCTTCTTTGAGTCCTCCCGTAAGCGATACGGCAAATACAACCGGCAAAGATCGAAAGATTATTTCAACAGGTATTATTGTGGCAATTGTTGTCCCTGCCGTCATTATGTTGGTACTACTAGTTGTAGGATTCATGGTTTGCAGGAAAAGGAAGTTATACCAAACAAATGAAGTTCGAGCTGGTGATGAGATCACAACAACACGCTCACTGCAATTTAGTTTTAAAATGATTAAAGATGCAACTGATACGTTTGCAGACAGTAATCTGATTGGCCGAGGTGGATTTGGTGAAGTTTACAAGGAACTCTTTCAACTGGAACTGAAGTAG SEQ ID NO. 1 Amino acid sequence:

[0030] MVRYSNVSFSGSLLMEPSQALYNTGDIGDTDANMTVFDRVYDELMIRTITAASNGSSSFEQKYFAAEVASLTNLETMYAMMQCTPDVSSGDCEFCLEKSVGEYSSCCRGKQGGAVIRPSCFFRWDLYPYAGAFDNVTLPPARPQASSPPPPSLSPPVSDTANTTGKDRKIISTGIIVAIVVPAVIMLVLLVVGFMVCRKRKLYQTNEVRAGDEITTTRSLQFSFKMIKDATDTFADSNLIGRGGFGEVYKELFQLELK SEQ ID NO.2

[0031] Example 2: Expression of BcCRK35 gene under salt stress condition

[0032] The used Brassica rosularis was commercially available four seasons dwarf black leaf sweet cabbage, and sponge block method was used for seedling raising. When the seedlings grew to three leaves and one heart, the uniform and healthy seedlings were selected and transplanted into the water culture box, and the seedlings were acclimated for 3 days before salt stress treatment. The used salt stress concentration was 120 mmol / L NO3 - The control concentration was 7.5 mmol / L NO3 - , wherein NO3 - was provided by Ca(NO3)2·4H2O and KNO3 each by 1 / 2. The same part of leaves was collected at 0 h, 0.5 h, 1 h, 3 h, 6 h, 12 h, 24 h and 48 h of salt stress treatment, total RNA was extracted, and TransScript one-step reverse transcription was used to prepare cDNA, and TB Premix Ex TaqTMII FASTqPCR reagent kit (TaKaRa) was used for qRT-PCR detection of gene relative expression, the reaction system was 20 μL: 2×TB GreenPremix Ex TaqⅡFast qPCR 10 μL, forward and reverse primers each 0.4 μL, cDNA template 2 μL, ddH2O 7.2 μL; reaction program: 95℃ pre-denaturation for 30 s, 95℃ denaturation for 10 s, 60℃ extension for 30 s, 40 cycles, using 2 -ΔΔCt The expression amount of differential genes was calculated by 2

[0033] F:5'-CCAACGTTTCCTTCTCCGGA-3'SEQ ID NO.3,

[0034] R:5'-TAACAACAGGGACGGCAGTA-3'SEQ ID NO.4.

[0035] Genetic testing results as follows Figure 2 As shown, the results indicate that the relative expression level of the BcCRK35 gene increased with the extension of salt stress treatment time, with a rapid increase at 3 h and a peak at 24 h, indicating that BcCRK35 is induced by high temperature stress and may be a potential salt stress response gene in non-heading Chinese cabbage.

[0036] Example 3: Construction of heterologous overexpression vector for BcCRK35 gene and salt tolerance analysis

[0037] The full-length CDS sequence of the target gene BcCRK35 was constructed into the pYES2-NTB vector (purchased from Nanjing Genscript Biotech Co., Ltd.), with BamHI and EcoRI restriction sites, to obtain the overexpression vector pYES2-NTB-BcCRK35. pYES2-NTB-BcCRK35 and the negative control pYES2-NTB were respectively transformed into yeast INVSC1. Following the manufacturer's instructions, the process included plate culture, liquid shaking culture, bacterial resuspension, centrifugation, water bath incubation, centrifugation for cell harvesting, suspension of the bacterial cells, mixing, and incubation at constant temperature. Positive clones of pYES2-NTB-BcCRK35 and the negative control pYES2-NTB were selected, resuspended in 2 mL of sterile water, and diluted to SG-U+0M NO3. - SG-U+0.5M NO3 - SG-U+1.0M NO3 - SG-U+1.3M NO3 - SG-U+1.5MNO3 - SG-U+2.0M NO3 - Place the plates on a 30°C incubator and incubate for 7 days. Observe the plates and take photos after 7 days. The results are as follows: Figure 3 As shown, the results revealed that the negative control was at SG-U+0M NO3. - SG-U+0.5M NO3 - SG-U+1.0M NO3 - It can grow on plates, in SG-U+1.3M NO3. - SG-U+1.5M NO3 - SG-U+2.0NO3 -The yeast cells could not grow on the plate. Compared with the negative control, pYES2-NTB-BcCRK35 showed more obvious growth and denser yeast cells, indicating that pYES2-NTB-BcCRK35 is salt-tolerant and can help yeast survive salt stress. This proves that the BcCRK35 gene plays a positive regulatory role in salt stress.

[0038] Example 4: Construction and Heat Resistance Analysis of BcCRK35 Gene Silent Vector

[0039] By recombination, a 273 bp non-conserved region of BcCRK35 (CDS505-777 bp) and its complementary fragment were used to replace the ccdB gene in the pK7GWIWG2(I) plasmid (purchased from Shanghai Zeye Biotechnology Co., Ltd.), resulting in the BcCRK35 silencing expression vector pK7GWIWG2(I)-BcCRK35. This vector was transformed into Agrobacterium GV3101, and after culturing, centrifugation, resuspending, and staining, BcCRK35-silencing expression plants were obtained and positive results were identified. Subsequently, the BcCRK35-silencing positive plants and their negative controls were treated with 120 mmol / L NO3. - The plants were treated for 21 days (nutrient solution was changed every 7 days). Phenotypic changes before and after treatment were photographed and recorded. Leaves were collected for growth and physiological index measurements. The control concentration was 7.5 mmol / L NO3. - Positive plant identification was performed using gene expression assays, following the same method as in "Example 2, Expression of BcCRK35 gene under salt stress conditions". Growth indicators were measured as follows: fresh weight was determined using an electronic balance, and root volume was measured using the water displacement method. Physiological indicators were measured as follows: relative conductivity was measured using a conductivity meter, malondialdehyde (MDA) content was determined using the thiobarbituric acid colorimetric method, and Na... + K + The content was determined using inductively coupled plasma mass spectrometry. All measurements were performed in triplicate.

[0040] Positive identification test results such as Figure 4 As shown, under salt stress, the expression level of the BcCRK35 gene in the silenced plants was significantly lower than that in the control plants, indicating that the BcCRK35 gene silencing system was successfully constructed. Phenotypic observation results are as follows... Figure 5 As shown, under salt stress treatment, compared with the control plants, the older leaves of the BcCRK35 gene-silenced plants first showed symptoms of mottled chlorosis, accompanied by leaf curling and drooping. In severe cases, the entire plant's leaves wilted and turned yellow. The negative-negative plants only showed mild growth inhibition and localized yellowing of leaf margins. The results of growth and physiological index measurements are as follows: Figure 6 and Figure 7As shown, the results indicated that under salt stress, the fresh weight and root volume of BcCRK35 gene-silenced plants were significantly lower than those of negative-positive plants. Under normal conditions, there was no significant difference in relative conductivity and MDA content between negative-positive plants and BcCRK35-silenced plants, while the relative conductivity and MDA content of both negative-positive plants and BcCRK35-silenced plants were significantly increased after salt treatment, with a greater increase in the BcCRK35-silenced plants. The results also showed that the relative conductivity and MDA content of salt-treated plants were significantly increased. + and K + The content was found, and the results were as follows: Figure 8 As shown, under normal growth conditions, the negative-affected plants and the BcCRK35 silent plants Na + and K + The Na content was basically the same, but after salt stress treatment, compared with the control treatment, the Na content in negative-negative plants and BcCRK35 silent plants was significantly higher. + Content and Na + / K + The ratios all increased significantly, while K + The content did not change significantly, and the Na content in BcCRK35 silent plants was also low. + / K + The ratio increased even more significantly.

[0041] The above results indicate that silencing the BcCRK35 gene leads to a decrease in the plant's tolerance to salt stress.

[0042] The above description is only a preferred embodiment of the present invention, but the scope of protection of the present invention is not limited thereto. Any equivalent substitutions or modifications made by those skilled in the art within the scope of the technology disclosed in the present invention, based on the technical solution and inventive concept of the present invention, are covered within the scope of protection of the present invention.

Claims

1. A salt stress positively regulated gene, characterized in that, The gene is BcCRK35, The nucleotide sequence is shown as SEQ ID NO.

1.

2. The salt stress positively regulated gene according to claim 1, wherein, BcCRK35 The amino acid sequence of the gene is shown in SEQ ID NO.

2.

3. The method of claim 1 BcCRK35 application of the gene in regulating salt tolerance of yeast, overexpression BcCRK35 the gene, enhancing the tolerance of yeast to salt stress.

4. A biomaterial capable of regulating the expression of a gene, characterized in that, BcCRK35 The biological material is a biological material overexpressing BcCRK35 a gene; the overexpression BcCRK35 of a gene is a recombinant expression vector containing BcCRK35 a nucleotide sequence of a gene or a transgenic yeast strain containing BcCRK35 the nucleotide sequence of a gene, the BcCRK35 nucleotide sequence of a gene being as shown in SEQ ID NO.

1. ​ 5. The biomaterial of claim 4, wherein, The basic skeleton of the recombinant expression vector is pYES2-NTB vector.

Citation Information

Patent Citations

  • CRK30 gene and application of its coding protein in regulation and control of plant stem and leaf growth

    CN109929018A

  • Wheat saline-alkaline tolerant protein kinase gene TaCRCK and application thereof

    CN120330223A