A gene CsWIN1 for regulating cucumber aphid resistance, its encoded protein, and applications thereof

Abstract

The present invention discloses a gene CsWIN1 for regulating cucumber aphid resistance, its encoded protein, and applications. The present invention has identified the gene CsWIN1, and its nucleotide sequence is as shown in SEQ ID NO.1. The present invention transfers the CsWIN1 gene into a target plant, and overexpression results in transgenic plants with improved aphid resistance. Compared with the "9930" line, in the lines overexpressing the CsWIN1 gene, on the 10th day after inoculating aphids, the number of aphids on the leaves of the CsWIN1 transgenic offspring plants decreases, and the fecundity of aphids declines; at the same time, the EPG measurement results show that aphids spend more time probing the overexpressing plants, indicating that the insect resistance of the overexpressing plants is improved, and the insect resistance of cucumber is enhanced by increasing the level of the CsWIN1 gene. Therefore, the CsWIN1 gene is of great significance for improving the insect resistance of cucumber, realizing the diversified development of the cucumber industry, and has broad application prospects.

Description

Technical Field

[0001] The present invention belongs to the field, and in particular relates to a gene CsWIN1 for regulating cucumber aphid resistance, its encoded protein and applications. Background Art

[0002] Cucumber (Cucumis sativus L.) is an annual climbing herbaceous plant of the genus Cucumis in the gourd family. It is one of the important economic vegetable crops globally. It can be planted almost throughout the year in some regions with warm climates and has become part of the agricultural systems around the world, providing a stable vegetable supply and playing an important role in the development of the vegetable economy in China.

[0003] Aphids (Aphididae) are a type of small, soft-bodied insects belonging to the Aphidoidea in the Hemiptera. They are widely distributed around the world and are one of the common pests in agriculture. Aphid infestations cause serious crop yield losses. Aphids carrying viruses can cause a yield reduction of up to 80% in crops. Aphids are one of the main biological stresses in cucumber high-yield cultivation. The commonly used method in production is spraying chemical pesticides. Once resistance occurs, it cannot be controlled, and aphid infestations are becoming increasingly severe. Therefore, exploring insect-resistant genes, analyzing the insect-resistant mechanism, and enhancing insect resistance from a genetic perspective through molecular breeding are of great significance in cucumber production. At the same time, promoting insect-resistant materials can reduce pesticide use, protect the environment, and increase yields, all of which play important roles.

[0004] Currently, there is no report on enhancing the aphid resistance of cucumber plants through genes. Therefore, discovering new genes for application in cucumber against aphid biological stress, creating new aphid-resistant germplasms in cucumber breeding, providing strong support for molecular breeding, and facilitating the diversified development of the cucumber industry. Summary of the Invention

[0005] Object of the Invention: To solve the above technical problems, the present invention aims to provide a gene CsWIN1 for regulating cucumber aphid resistance. The nucleotide sequence of the CsWIN1 gene is as shown in SEQ ID NO.1. By molecular means, new germplasms are created to enhance the insect resistance of cucumbers from a genetic perspective, solve the serious aphid infestation problem in cucumbers, reduce environmental pollution, increase cucumber yields, and promote industrial development.

[0006] The present invention also provides the applications of the gene CsWIN1 for regulating cucumber aphid resistance.

[0007] Technical Solution: To achieve the above object, the present invention provides a gene CsWIN1 for regulating cucumber aphid resistance. The nucleotide sequence of the CsWIN1 gene is as shown in SEQ ID NO.1.

[0008] Furthermore, the primer pair used for amplifying the gene CsWIN1 is CsWIN1-F: ATGCCAAAGTGTAAGAAATTTA,

[0009] CsWIN1-R: CTAAAGATAATTAATATCCTTTCCTTG.

[0010] Among them, the amino acid sequence of the protein encoded by the gene CsWIN1 that regulates cucumber aphid resistance is shown in SEQ ID NO.2.

[0011] Among them, the recombinant expression vector of the gene CsWIN1 that regulates cucumber aphid resistance.

[0012] Furthermore, the method for constructing the recombinant expression vector is as follows: The CsWIN1 gene sequence shown in SEQ ID NO.1 described in claim 1 is ligated to the pCE2 TA / Blunt-Zero vector, and then ligated to the vector pCAMBIA1301 (double digested with BamHⅠ and SalI) to construct the overexpression vector CsWIN1-pCAMBIA1301.

[0013] The transgenic cell of the gene CsWIN1 that regulates cucumber aphid resistance according to the present invention, and the cell uses Agrobacterium as the host cell.

[0014] The application of the gene CsWIN1, or its encoded protein, vector or transgenic cell according to the present invention in regulating cucumber aphid resistance.

[0015] Furthermore, the application of overexpressing the CsWIN1 gene in improving cucumber aphid resistance.

[0016] The application of the gene CsWIN1, or its encoded protein, vector or transgenic cell according to the present invention in cultivating aphid-resistant cucumber plants.

[0017] Furthermore, the application includes the following steps: Infecting the "9930" cucumber plants with the recombinant expression vector through Agrobacterium-mediated transformation, and obtaining aphid-resistant cucumber materials with stable inheritance through self-purification.

[0018] Furthermore, the process includes detecting the aphid resistance of the aphid-resistant cucumber materials with stable inheritance.

[0019] After overexpressing the CsWIN1 gene in cucumbers, the present invention obtained transgenic plants with improved aphid resistance. Specifically, compared with the "9930" plants, the lines overexpressing the CsWIN1 gene had fewer non-selective settlement numbers. After 10 days of aphid inoculation, the number of aphids on the leaves of the CsWIN1 transgenic progeny plants decreased, the fecundity of aphids decreased, and the insect resistance ability increased, indicating that the insect resistance ability of cucumbers was enhanced by increasing the expression level of CsWIN1. Therefore, the CsWIN1 gene has important theoretical and practical significance for improving the aphid resistance of cucumbers, will play an important role in cucumber insect-resistant breeding improvement, and has broad application prospects.

[0020] Beneficial effects: Compared with the prior art, the present invention has the following remarkable advantages:

[0021] The present invention constructed a cucumber CsWIN1 overexpression material by using transgenic technology to study the function of the CsWIN1 gene. The present invention proved through experiments that the aphid resistance of the lines overexpressing the CsWIN1 gene was significantly increased by 5000 times. It was observed that the leaf phenotype of the lines overexpressing the CsWIN1 gene was very bright. The aphid resistance of the "9930" and the overexpressing lines was identified, and the results showed that the number of aphids in the overexpressing lines decreased significantly and the fecundity of aphids decreased significantly, proving that the aphid resistance of the lines overexpressing the CsWIN1 gene was enhanced, which was beneficial to creating new cucumber germplasms and had important value for production development and the ecological environment. Brief description of the drawings

[0022] Figure 1 It is the recombinant vector map of the CsWIN1 gene;

[0023] Figure 2 The expression levels of the "9930" and the overexpressing line of the CsWIN1 gene;

[0024] Figure 3 The phenotypes of the "9930" and CsWIN1-1-OE inoculated with aphids for 10 days;

[0025] Figure 4 The time and number of aphid probing and sucking of the "9930" and CsWIN1-1-OE. Detailed implementation manners

[0026] The technical solutions of the present invention will be further described below with reference to the drawings.

[0027] The materials, reagents, etc. used in the following examples can be obtained from commercial channels without special instructions. The experimental methods without specific conditions noted in the examples are usually carried out under conventional conditions or according to the conditions recommended by the manufacturer.

[0028] "9930", the experimental material of this invention, is a germplasm for which the V3.0 reference genome assembly of a highly inbred cucumber line has been completed. "RNA-seq-based comparative transcriptome analysis reveals the role of CsPrx73 in waterlogging-triggered adventitious root formation in cucumber" was published in the journal Horticulture Research (Pan et al., 2024). Overexpression plants were constructed using the "9930" cucumber material, and this germplasm resource is stored in the seed bank of the Yangzhou University laboratory.

[0029] Cucumber Gy14: Preserved in the cucumber germplasm resource bank of Yangzhou University; Zhang T, Dong X, Yuan X, Hong Y, Zhang L, Zhang X, Chen S. Identification and characterization of CsSRP43, a major gene controlling leaf yellowing in cucumber. Hortic Res. 2022 Dec 1;9:uhac212.

[0030] pCAMBIA1301: "RNA-seq-based comparative transcriptome analysis reveals the role of CsPrx73 in waterlogging-triggered adventitious root formation in cucumber" was published in the journal Horticulture Research (Pan et al., 2024), and this vector is stored in the Yangzhou University laboratory.

[0031] The present invention constructs a cucumber CsWIN1 overexpression material by using transgenic technology to study the function of the CsWIN1 gene. The CsWIN1 gene is transferred into the "9930" plant. After overexpression, transgenic plants with improved aphid resistance are obtained. The specific manifestations are as follows: Compared with the "9930" line, in the transgenic lines overexpressing CsWIN1, 10 days after inoculating aphids, the number of aphids on the leaves of the transgenic offspring plants of CsWIN1 decreases, and the fecundity of aphids decreases; at the same time, the EPG results show that aphids spend more time piercing and sucking the overexpressing plants, indicating that the insect resistance of the overexpressing plants is improved, which shows that the insect resistance of cucumbers is enhanced by increasing the expression level of the CsWIN1 gene. Therefore, the CsWIN1 gene is of great significance for improving the insect resistance of cucumbers and creating new cucumber germplasms, promoting the diversified development of the cucumber industry, and having broad application prospects.

[0032] Example 1

[0033] Cloning of the CsWIN1 gene includes the following steps:

[0034] (1) RNA extraction

[0035] Take fresh leaf tissue (0.1 g) of cucumber Gy14, grind it with liquid nitrogen, operate with enzyme-free centrifuge tubes and pipette tips, and use the TIANGEN (Beijing) RNA Easy Fast Plant Tissue RNA Rapid Extraction Kit (DP452) to extract the RNA solution, which can be reverse transcribed into cDNA or stored at -80 °C (1 - 2 days).

[0036] (2) Reverse transcription of cDNA

[0037] Dilute the concentration of the above-extracted RNA solution to 400 ng / ul, use the HiScript II Q RT SuperMix for qPCR (+gDNAwiper) kit to prepare a 20 ul system, and use a 200 ul centrifuge tube; steps: 4 ul of 4×gDNAwiper Mix, 2 ul of RNA template, 10 ul of RNase-free ddH2O, gently pipette and mix well. Incubate at 42 °C for 2 min. Add 4 ul of 5×HiScript III qRT SuperMix to the above mixture. PCR reaction program: 37 °C for 15 min, 85 °C for 15 s; obtain cDNA, store the PCR product at -20 °C, or it can be used for quantitative reaction immediately.

[0038] (3) Amplification of the target fragment

[0039] Design amplification primers for the CsWIN1 gene: CsWIN1-F: ATGCCAAAGTGTAAGAAATTTA; CsWIN1-R: CTAAAGATAATTAATATCCTTTCCTTG; Using the above cDNA as a template, use the Novoprotein Phanta Max Super-Fidelity DNA Polymerase kit to prepare a 50ul system according to the operation instructions, mix well in a 200ul centrifuge tube, briefly centrifuge and place it in a PCR instrument; The system is as follows: ddH 2 O 17ul, 2x Phanta Max Buffer 25ul, dNTP Mix (10mM each) 1ul, upstream primer (10μM) 2ul, downstream primer (10μM) 2ul, Phanta Max Super-Fidelity DNA Polymerase 1ul, template DNA 2ul. The reaction program is as follows: Cycling steps: including pre-denaturation at 95°C for 3 min, denaturation at 95°C for 15 s, annealing at 55°C for 15 s, extension at 72°C for 30 s, cycle 34 times, then complete extension at 72°C for 5 min, and finally store at 4°C or take out in time for gel electrophoresis.

[0040] (4) Gel electrophoresis verification

[0041] Perform a spotting gel electrophoresis experiment on the above PCR product, set the program to 120V for 25 min, and cut out the gel block with the same size as the target fragment band. Use the Tiangen kit Universal DNA Purification and Recovery Kit (DP214) to purify and recover the PCR amplification product according to the instructions, and send it to Beijing Tsingke Biotechnology Co., Ltd. for sequencing. After sequence alignment and analysis, it is found that its nucleotide sequence is 672bp in length, and the gene sequence is as shown in SEQ ID No.1; it encodes 223 amino acids, and the sequence is as shown in SEQ ID No.2.

[0042] Example 2

[0043] Construction of CsWIN1 overexpression lines, including the following steps:

[0044] 1. Ligation

[0045] Ligate the purified target fragment in Example 1 using the Novoprotein 5min TA / Blunt-Zero Cloning Kit, and prepare a 5ul system according to the operation steps: 5×TA / Blunt-Zero Cloning Mix 1μl, purified product 2ul, ddH 2 O 2ul, mix well, briefly centrifuge and place it in a PCR instrument set at 37°C for 5 min. After the reaction, place the centrifuge tube on ice.

[0046] 2. E. coli Transformation

[0047] Transform the above ligation product into E. coli using the Novoprotein DH5α Competent cell kit. The operating steps are as follows: ① Take out the competent cells from -70°C and quickly place them on ice to melt. ② Add the DNA to be transformed into 100 μl of competent cells, gently flick the tube wall to mix (avoid pipetting), and let it stand on ice for 30 min. ③ After heat shock in a 42°C water bath for 45 sec, quickly place it on ice and let it stand for 2 min. Do not shake the centrifuge tube. ④ Add 900 μl of LB or SOC liquid medium (without antibiotics) to the centrifuge tube, mix well, and place it in a 37°C shaker at 200 rpm for 1 h. ⑤ Centrifuge at 5000 rpm (2,500×g) for 3 min, discard 900 μl of the supernatant, resuspend the bacteria with the remaining medium, and evenly spread it on an LB solid medium plate containing the corresponding antibiotic. ⑥ Place the plate upright in a 37°C incubator for 10 min. After the bacterial solution is completely absorbed, invert the plate and incubate overnight.

[0048] 3. Vector Quality Control

[0049] ① Use the universal primer M13 of the 5min TA / Blunt-Zero Cloning Kit and configure the system with the Novoprotein 2×Rapid Taq Master Mix kit in a 200 μl PCR centrifuge tube. The system is as follows: ddH 2 O 9.5 μl, 2xRapid Tag Master Mix 12.5 μl, Forward primer (10 μM) 1 μl, Reverse primer (10 μM)

[0050] 1 μl, then mix well and centrifuge briefly. Pick 8 single colonies from the plate prepared in step 2 and spot them into the system, and streak for growth on a plate containing Kan; then place the PCR centrifuge tube in a PCR instrument according to the program: cycling steps: 95°C for 3 min, 95°C for 15 s, 60°C for 15 s, 72°C for 15 s, cycle 34 times, then extend thoroughly at 72°C for 5 min, and finally store at 4°C or take it out in time for gel electrophoresis verification. ② Select those with the same band size and send them to Beijing Tsingke Biotechnology Co., Ltd. for sequencing comparison, and select the plate with consistent sequences for growing bacteria.

[0051] 4. Plasmid Extraction

[0052] ①Pick the colonies with consistent sequence alignment mentioned above and place them in a 50 ml sterile EP tube. Add 10 ml of LB liquid containing Kan in advance and shake the bacteria for 12 h until the liquid becomes turbid. ②Use the Tiangen Plasmid Mini Kit (DP103) to extract the plasmid according to the instructions to obtain the recombinant vector CsWIN1-pCE2 TA / Blunt-Zero and store it at -80 °C for later use.

[0053] 5. Construction of expression vector

[0054] As Figure 1 shown, ①The pCAMBIA1301 vector was double-digested with BamHⅠ and SalI using the NEB R3136 and NEB R3138 (New England Biolabs (Beijing) LTD., NEB (Beijing) Co., Ltd.) kits, and the gel was recovered using the DC301 kit (gel recovery kit). ②Use the homologous recombination kit Novoprotein C112 ( IIOneStep Cloning Kit) to ligate the plasmid extracted above into the vector (pCAMBIA1301) to obtain a recombinant overexpression vector. Specifically, prepare a 20 μl system: 30 - 50 ng of plasmid CsWIN1-pCE2 TA / Blunt-Zero, 4 μl of vector pCAMBIA1301, 2 μl of homologous recombination enzyme, ddH 2 O to 20 μl. ③After the PCR reaction program at 37 °C for 30 min, store it on ice or at 4 °C. The steps of transforming the recombinant vector into Escherichia coli, vector quality control, and extracting the recombinant plasmid are the same as above. ④Use the GV3101 (pSoup) Electroporation-Competent Cell kit to transform the recombinant plasmid CsWIN1-pCAMBIA1301 into Agrobacterium tumefaciens GV3101. After picking the bacteria, perform PCR positive detection, and propagate the positive colonies with consistent bands.

[0055] Example 3

[0056] Creation of CsWIN1 overexpression lines and detection of gene expression levels:

[0057] 1. Creation of CsWIN1 overexpression lines

[0058] (1) Infection

[0059] Sow the cucumber germplasm "9930" seeds on the SGM sowing medium and culture them in the dark at 28 °C for 36 h. Infect with the above-mentioned positive Agrobacterium tumefaciens liquid with consistent sequencing, and the OD of the bacterial liquid is 0.2 - 0.3. Add the seeds cultured in the dark to the Agrobacterium tumefaciens liquid and culture them in the dark at 25 °C on the IM co-culture medium for 3 - 4 d.

[0060] (2) Screen the transferred culture medium, and let the overexpressing lines self-cross for two generations to obtain T 2

[0061] Perform fluorescence screening and detection on the germinated plants in the above steps. Transfer the fluorescent buds to 1M SRM differentiation medium and RM rooting medium. The temperature is 24.5°C, the humidity is 62%, the light intensity is 6500 Lux, and the plants are cultured under a 16-hour light and 8-hour dark cycle. When the number of roots reaches about 12 - 15, transplant them into the soil to grow into cucumber plants. Wait until young leaves grow for identification. The identification primers are F: GTCAGTAGCGTCAGAAGG and R: GGAGTCCGTTGGTAGAG. The plants with bands are resistant transgenic plants T0. Wait for the transgenic cucumbers to grow, self-cross, and save the seeds to obtain the T1 generation. Sow the harvested T1 seeds, and after self-cross purification, obtain the homozygous T2 generation transgenic lines overexpressing CsWIN1. Obtain two overexpressing lines CsWIN1-1-OE and CsWIN1-2-OE from the T2 generation transgenic lines for subsequent experiments.

[0062] (3) RNA extraction

[0063] Take 0.1 g of leaves from the "9930" plant and the transgenic lines CsWIN1-1-OE and CsWIN1-2-OE, grind them in liquid nitrogen, and operate using enzyme-free centrifuge tubes and pipette tips. Use the TIANGEN (Beijing) RNAEasy Fast Plant Tissue RNA Rapid Extraction Kit (DP452) to extract the RNA solution, which can be reverse-transcribed into cDNA immediately or stored at -80°C (for 1 - 2 days). Each sample has three biological replicates.

[0064] (4) Reverse transcription

[0065] Dilute the concentration of the already extracted RNA solution to 400 ng / ul, and use the HiScript II Q RT SuperMix for qPCR (+gDNA wiper) kit to prepare a 20 ul system in a 200 ul centrifuge tube. Steps: Add 4 ul of 4×gDNA wiper Mix, 2 ul of RNA template, and 10 ul of RNase-free ddH 2 O, and gently pipette to mix evenly. Incubate at 42°C for 2 min. Add 4 ul of 5×HiScript III qRT SuperMix to the above mixture. PCR reaction program: 37°C for 15 min, 85°C for 15 s; obtain cDNA. Store the PCR product at -20°C, or it can be used for quantitative reaction immediately.

[0066] 2. Detection of CsWIN1 gene expression level

[0067] (1) qPCR analysis

[0068] Using the ChamQ SYBR qPCR Master Mix kit, prepare a 10 μl system with the cDNA solution obtained in the previous step: 5 μl of 2×ChamQ SYBR qPCR Master Mix, 3 μl of ddH2O, 0.5 μl of Forward primer, 0.5 μl of Reverse primer, and 1 μl of cDNA; Reaction program: Stage 1 pre-denaturation at 95 °C for 30 s, Stage 2 denaturation at 95 °C for 10 s, 60 °C for 30 s, cycle 2 times, Stage 3 melting curve, starting temperature 60 °C, ending temperature 95 °C.

[0069] Explore the expression levels of the CsWIN1 gene in "9930" plants and transgenic plants overexpressing CsWIN1 (CsWIN1-1-OE and CsWIN1-2-OE) by fluorescence quantitative PCR technology. Design fluorescence quantitative PCR primers for the forward primer 5’-CGTCATTGGGGTTCTTGGGT-3’ and the reverse primer 5'-TTTGGCGTTCCGACCACTTA-3’ based on the exon region of the CsWIN1 gene, and design internal reference primers for the forward primer 5’-GCTGGATTCTGGTGATGGTG-3’ and the reverse primer 5’-AGCAAGGTCCAAACGGAGAA-3’ based on the Actin gene. Using SYBR Premix Ex Taq (Takara) and the fluorescence quantitative PCR instrument q225 (Coolab), refer to the manufacturer's instructions for the PCR system and program, perform fluorescence quantitative PCR to obtain the cycle number reaching the fluorescence threshold, and calculate the relative expression level after the CsWIN1 gene. As Figure 2 shown, the relative expression levels of CsWIN1 in overexpressing lines and 9930 plants, and the results show that the CsWIN1 gene level in overexpressing lines is significantly higher than that in "9930" plants.

[0070] Example 4

[0071] Identification of aphid resistance of "9930" plants and CsWIN1-1-OE lines

[0072] 1. Through the observation of "9930" plants and CsWIN1-1-OE lines growing for 13 days, it was found that the leaf phenotype of the CsWIN1-1-OE line was brighter than that of the "9930" plant leaves. Therefore, the aphid reproduction numbers of the two materials were counted after 10 d to identify their aphid resistance.

[0073] S1: Select 6 plants of 13-day-old with consistent growth;

[0074] S2: On the previous day, inoculate 10 wingless adult aphids. At 8:00 AM the next day, pick off the adult aphids and leave 10 first-instar wingless nymphs. Record the total number of aphids on the plants after 10 days, and repeat 6 times.

[0075] Inoculation method: Select 10 adult aphids with consistent growth in a petri dish, starve them for 4 - 6 hours, then transfer them to cucumber leaves for cultivation. At the same time the next day, pick off the adult aphids and leave the first-instar nymphs for subsequent experiments.

[0076] S3: Use GraphPad software, refer to the software instructions and graph types for graphing and comparison.

[0077] 2. Data statistics: Use the TTEST function to analyze the resistance differences of different plants in terms of the aphid numbers on "9930" plants and CsWIN1-1-OE.

[0078] As Figure 3 shown, for the phenotypes of "9930" plants and CsWIN1-1-OE lines and the data of aphids inoculated for 10 days, it was found that compared with "9930" plants, the number of aphids on the CsWIN1-1-OE line was significantly reduced.

[0079] 3. Identify the aphid feeding preference and aphid resistance of "9930" plants and CsWIN1-1-OE lines through EPG; First, pick 20 wingless adult aphids of the same size and starve them for 4 hours; Select 4 plants with consistent growth at the two-leaf-one-heart stage for both "9930" plants and the overexpressed plant CsWIN1-1-OE; The operation steps refer to the instruction manual of the eight-channel insect penetration potential measurement system, and download the latest software (Stylet+), including Stylet+a and Stylet+d software. The program settings are as follows:

[0080] (1) Enter the file name in the Stylet+d software or change the data storage path, which is defaulted to the C:EPG data folder, and the data file suffix is aq8 (8 channels).

[0081] (2) Record the time, fill in the total time for which data needs to be recorded, with the unit being hours. Generally, the experiment may require recording data for 8 hours.

[0082] (3) Fill in the remarks. The first line of the remarks is reserved by the system, recording the basic information of the experiment. The second and third lines can be filled with relevant content.

[0083] (4) Click the Start button to start recording data, and the button will change to Stop. Click Stop to stop data recording. The current channel data is displayed below. Click the channel selection button to switch the display for waveform observation.

[0084] 4. Data statistics: After the data recording is completed, it is saved. The waveform type and the time of different waveforms are analyzed using the Stylet+a software, and the corresponding waveform times and frequencies are recorded. The TTEST function is used to analyze the resistance differences between the "9930" plants and the CsWIN1-1-OE lines;

[0085] As Figure 4 shown, the probing times and frequencies of aphids on the "9930" plants and the CsWIN1-1-OE lines are presented. The results indicate that aphids take more time to probe on the CsWIN1-1-OE lines, suggesting that the CsWIN1-1-OE lines impede aphid feeding and enhance the plant's resistance to aphids.

[0086] In summary, compared with the "9930" plants, the lines overexpressing the CsWIN1-1-OE gene in this invention have fewer non-selective settlement numbers. After 10 days of aphid inoculation, the number of aphids on the leaves of the CsWIN1-1-OE transgenic progeny plants decreases, the fecundity of aphids declines, and the insect resistance ability is improved, indicating that the insect resistance of cucumber is enhanced by increasing the expression level of CsWIN1-1-OE. Secondly, compared with the low expression of CsWIN1-1-OE, which has an enhancing effect on plant aphid resistance, it further shows that the transgenic plant CsWIN1-2-OE with high expression has stronger aphid resistance. Therefore, the CsWIN1 gene has important theoretical and practical significance for improving cucumber insect resistance, will play an important role in cucumber insect resistance breeding improvement, and has broad application prospects.

Claims

1. Overexpressed genes CsWIN1 or its encoded protein, or containing gene CsWIN1 Overexpression vectors or gene CsWIN1 Application of transgenic cells containing an overexpression vector in improving cucumber aphid resistance, the CsWIN1 The nucleotide sequence of the gene is shown in SEQ ID NO.1, and the amino acid sequence of the protein is shown in SEQ ID NO.

2.

2. The use according to claim 1, characterized in that: To amplify the gene CsWIN1 The primer pair is CsWIN1 -F:ATGCCAAAGTGTAAGAAATTTA, CsWIN1 -R: CTAAAGATAATTAATATCCTTCCTTG.

3. The use according to claim 1, characterized in that: The overexpression vector construction method is: CsWIN1 The gene sequence was connected to the pCE2 TA / Blunt-Zero vector, and then the vector was double-digested with BamHI and SalI. pCAMBIA1301 Ligation and construction of overexpression vector CsWIN1-pCAMBIA1301 .

4. The use according to claim 1, characterized in that: The transgenic cells use Agrobacterium as host cells.

5. Overexpressed genes CsWIN1 or its encoded protein, or containing gene CsWIN1 Overexpression vectors or gene CsWIN1 Application of transgenic cells of an overexpression vector in cultivating aphid-resistant cucumber plants, the CsWIN1 The nucleotide sequence of the gene is shown in SEQ ID NO.1, and the amino acid sequence of the protein is shown in SEQ ID NO.

2.

6. The use according to claim 5, characterized in that: The application process is: the overexpression vector is infected into cucumber plants through Agrobacterium-mediated, and self-pollination is performed to purify the cucumber materials with stable inheritance and resistance to aphids.

Images