Preparation method and application of yeast-expressed triple-helix type I recombinant human collagen

Abstract

The present invention discloses a preparation method and application of yeast-expressed triple-helix structure type I recombinant human collagen, which relates to the field of biotechnology. The preparation method includes the step of fermenting and purifying the triple-helix structure type I recombinant human collagen using an engineered bacterium; the construction method of the engineered bacterium includes the step of transforming plasmids pMChZ-α1(I), pMCrN-α2(I), pPIC9K-P4H(DP)-1 and pMCeH-[α1(I)]2α2(I) into a host bacterium to construct the engineered bacterium. The type I recombinant human collagen with a triple-helix structure prepared by using this preparation method contains hydroxyproline, and the hydroxyproline accounts for more than 30% of the total proline. Thereby, the type I recombinant human collagen can be widely used in the fields of cosmetics, medical beauty, medical devices, biomedical materials, etc., and has good practicability and important market application value.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to a preparation method and application of yeast-expressed triple-helix structure type I recombinant human collagen. Background Art

[0002] Collagen is a very important protein in the body. It is composed of three left-handed α-peptide chains entangled with each other to form a right-handed triple helix structure. Type I collagen is one of the most abundant collagens with a triple helix structure in the human body, and plays an important role in maintaining skin health and the integrity of bone tissue structure. Type I collagen in the human body is mostly a heterotrimer composed of two α1 chains and one α2 chain. This triple helix structure gives collagen good biomechanical properties and biocompatibility, making it play a key role in maintaining skin elasticity, bone strength, and tendon toughness.

[0003] As a substitute for natural human collagen, recombinant human type I collagen is widely used in inhibiting and relieving dermatitis, improving sensitive skin, and caring for postoperative wounds, playing a huge role in functional biomaterials, cosmetics, and food. Currently, most recombinant human type I collagen products on the market are recombinant human collagen or recombinant collagen, which can be expressed in large quantities in microorganisms at a relatively low cost, but this type of collagen does not have a triple helix structure. The mechanical properties of single-chain collagen are far inferior to those of triple helix collagen, and it is difficult to perform in application scenarios that require higher mechanical strength. Therefore, it is urgent to develop a method for preparing recombinant human collagen type I with a triple helix structure. Summary of the invention

[0004] The purpose of the present invention is to provide a preparation method and application of yeast expressing triple helical type I recombinant human collagen to solve the problems existing in the above-mentioned prior art. The type I recombinant human collagen prepared by the preparation method has a triple helical structure, so that the type I recombinant human collagen can obtain good biomechanical properties and biocompatibility.

[0005] To achieve the above object, the present invention provides the following solutions:

[0006] The present invention provides a method for constructing an engineering bacterium expressing triple helical type I recombinant human collagen, comprising the steps of transforming a pMChZ-α1(Ⅰ) plasmid, a pMCrN-α2(Ⅰ) plasmid, a pPIC9K-P4H(DP)-1 plasmid and a pMCeH-[α1(Ⅰ)]2α2(Ⅰ) plasmid into a host bacterium to construct the engineering bacterium;

[0007] The pMChZ-α1(Ⅰ) plasmid is obtained by cloning α1(Ⅰ) into the pMChZ-AOX vector;

[0008] The pMCrN-α2(Ⅰ) plasmid is obtained by cloning α2(Ⅰ) into the pMCrN-AOX vector;

[0009] The pPIC9K-P4H(DP)-1 plasmid is obtained by replacing KanR in the P4H 9K DP plasmid with a DNA molecule having a nucleotide sequence as shown in SEQ ID NO.12;

[0010] The pMCeH-[α1(Ⅰ)]2α2(Ⅰ) plasmid is obtained by cloning the [α1(Ⅰ)]2α2(Ⅰ) transcription unit into the pMCeH-AOX vector;

[0011] The nucleotide sequence of α1(Ⅰ) is shown in SEQ ID NO.3;

[0012] The nucleotide sequence of α2(Ⅰ) is shown in SEQ ID NO.6;

[0013] The nucleotide sequence of the [α1(Ⅰ)]2α2(Ⅰ) transcription unit is shown in SEQ ID NO.13;

[0014] The pMChZ-AOX vector is obtained by modifying the pPIC9K plasmid as follows: replacing 4648-9221 bp of the pPIC9K plasmid with a DNA molecule with a nucleotide sequence as shown in SEQ ID NO.7; deleting BamHI located upstream of αMF in the pPIC9K plasmid; and introducing a BamHI recognition site between 1583-1584 bp of the pPIC9K plasmid by point mutation;

[0015] The pMCrN-AOX vector is constructed by replacing the PpHIS4 and Zeocin screening markers on the pMChZ-AOX plasmid with DNA molecules with nucleotide sequences such as SEQ ID NO.8 and SEQ ID NO.9, respectively;

[0016] The pMCeH-AOX vector is constructed by replacing PpHIS4 and PEM7-BleoR-CYC1 tt on the pMChZ-AOX plasmid with DNA molecules with nucleotide sequences as shown in SEQ ID NO.10 and SEQ ID NO.11, respectively.

[0017] Furthermore, the construction method specifically comprises the following steps:

[0018] Transforming the pMChZ-α1(Ⅰ) plasmid into the host bacteria to obtain the KM71H / pMChZ-α1(Ⅰ) strain;

[0019] Transforming the pMCrN-α2(Ⅰ) plasmid into the KM71H / pMChZ-α1(Ⅰ) strain to obtain the KM71H / α1(Ⅰ)-α2(Ⅰ) strain;

[0020] Transforming the pPIC9K-P4H(DP)-1 plasmid into the KM71H / α1(Ⅰ)-α2(Ⅰ) strain to obtain the KM71H / α1(Ⅰ)-α2(Ⅰ)-P4H strain;

[0021] The pMCeH-[α1(Ⅰ)]2α2(Ⅰ) plasmid is transformed into the KM71H / α1(Ⅰ)-α2(Ⅰ)-P4H strain to obtain the engineered bacteria.

[0022] Furthermore, the host bacteria is Pichia pastoris X33 or Pichia pastoris KM71.

[0023] Furthermore, BamHI located upstream of αMF in the pPIC9K plasmid was deleted by point mutation.

[0024] The present invention also provides an engineering bacterium expressing triple helical type I recombinant human collagen constructed according to the above construction method.

[0025] The present invention also provides the use of the above-mentioned engineering bacteria in the preparation of triple helical structure type I recombinant human collagen.

[0026] The present invention also provides a method for preparing triple helical type I recombinant human collagen expressed by yeast, comprising the steps of obtaining the triple helical type I recombinant human collagen by fermentation and purification using the above-mentioned engineering bacteria.

[0027] The present invention also provides a triple helical type I recombinant human collagen prepared according to the above preparation method.

[0028] The present invention also provides the use of the above triple helical structure type I recombinant human collagen in the preparation of functional biomaterials, cosmetics or medical devices.

[0029] The present invention discloses the following technical effects:

[0030] The present invention provides a method for preparing a type I recombinant human collagen with a triple helical structure expressed by yeast. The type I recombinant human collagen prepared by the preparation method has a triple helical structure, so that the type I recombinant human collagen can obtain good biomechanical properties and biocompatibility. The type I recombinant human collagen with a triple helical structure prepared by the present invention can be widely used in the fields of cosmetics, medical cosmetology, medical devices, biomedical materials, etc., and has important market application value. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0032] Figure 1 is the plasmid map of pPIC9K;

[0033] Figure 2 is the plasmid map of pMChZ-AOX;

[0034] Figure 3 is the plasmid map of pMCrN-AOX;

[0035] Figure 4 is the plasmid map of pMCeH-AOX;

[0036] Figure 5 is the plasmid map of pPIC9K-P4H(DP)-1;

[0037] Figure 6 These are the results of detecting collagen using COL1A1 and COL1A2 antibodies, respectively;

[0038] Figure 7 The results of detecting collagen using P4HA1 and P4HB antibodies, respectively;

[0039] Figure 8 is the circular dichroism test result;

[0040] Figure 9 The results are obtained by transmission electron microscopy. DETAILED DESCRIPTION

[0041] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but should be understood as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0042] It should be understood that the terms described in the present invention are only for describing a particular embodiment and are not intended to limit the present invention. In addition, for the numerical range in the present invention, it should be understood that each intermediate value between the upper and lower limits of the scope is also specifically disclosed. The intermediate value in any stated value or stated range, and each smaller range between any other stated value or intermediate value in the described range is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded in the scope.

[0043] Unless otherwise indicated, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art. Although the present invention describes only preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of a conflict with any incorporated document, the content of this specification shall prevail.

[0044] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments of the present invention description without departing from the scope or spirit of the present invention. Other embodiments derived from the present invention description will be apparent to those skilled in the art. The present invention description and examples are exemplary only.

[0045] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0046] The Pichia pastoris KM71 used in the following examples was purchased from Invitrogen; the pPIC9K vector was purchased from Invitrogen.

[0047] Example 1

[0048] 1. Construction of the sequence encoding type I recombinant human collagen α1 chain α1 (Ⅰ):

[0049] A His Tag tag was added between the signal peptide and the N-terminal peptide of the sequence (SEQ ID NO.1); a TEV cleavage sequence was added between the N-terminal peptide and the triple helix region; a TEV cleavage sequence was added between the triple helix region and the C-terminal peptide, and a His Tag tag was added to the C-terminus to obtain α1(Ⅰ). The amino acid sequence of α1(Ⅰ) is shown in SEQ ID NO.2. The amino acids of α1(Ⅰ) were optimized according to the expression preference of Pichia pastoris to obtain a coding gene, and the nucleic acid sequence is shown in SEQ ID NO.3.

[0050] 2. Construction of a sequence encoding type I recombinant human collagen α2 chain α2 (Ⅰ):

[0051] A His Tag tag was added between the signal peptide and the N-terminal peptide of the sequence (SEQ ID NO.4); a TEV restriction sequence was added between the N-terminal peptide and the triple helix region; a TEV restriction sequence was added between the triple helix region and the C-terminal peptide, and a His Tag tag was added to the C-terminus to obtain α2(Ⅰ). The amino acid sequence of α2(Ⅰ) is shown in SEQ ID NO.5. The amino acids of α2(Ⅰ) were optimized according to the expression preference of Pichia pastoris to obtain a coding gene, and the nucleic acid sequence is shown in SEQ ID NO.6.

[0052] 3. Construction of plasmid:

[0053] 3.1 Construction of plasmid pMChZ-AOX

[0054] The synthetic nucleotide sequence is shown as an alternative sequence in SEQ ID NO.7, and the 4648-9221 bp of the pPIC9K vector sequence is replaced, that is, the KanR resistance gene, Bom and AOX13'fragment elements in pPIC9K are replaced with the DNA molecule shown as SEQ ID NO.1; BamHI (938-943 bp) and αMF located before αMF in pPIC9K are deleted by point mutation, and the BamHI recognition site is introduced by point mutation downstream of AOX1tt (also known as AOX1 transcription termination or AOX1termination) (between 1583-1584 bp), and the sequences of other vector elements remain unchanged, thereby constructing a plasmid pMChZ-AOX (wherein h represents the recombination site PpHIS4, and Z represents the selection marker BleoR). The plasmid can express Cre recombinase when induced by methanol, catalyze the recombination of lox71 and lox66, and realize the recovery of the resistance gene. BamHI located after AOX1tt can be used to construct an in vitro multi-copy plasmid with the same tail enzyme. The plasmid maps of the original plasmid pPIC9K and the pMChZ-AOX constructed in the present invention are as follows: Figure 1 and Figure 2 shown.

[0055] Among them, the nucleotide sequence as shown in SEQ ID NO.7 contains lox71 and lox66 sequences at both ends of the replacement sequence, there is ori upstream of lox71, and there is a Cre transcription unit inside, and the Cre gene is driven by the AOX1 promoter with a SacⅠ restriction site mutation; there are prokaryotic and eukaryotic promoters upstream of BleoR, which can be used for prokaryotic and eukaryotic screening, and there is a prokaryotic promoter upstream of AmpR, which can be used for prokaryotic screening.

[0056] The meanings of the various parts in SEQ ID NO.7 are explained as follows:

[0057] Lowercase letters indicate ori, 5' end Shown is lox71, 3' end The indicated number is lox66; "_" indicates AmpR, Shown is pAmpR (AmpR promoter), Shown is the pAOX1 promoter with the SacⅠ site mutated. The Cre recombinase gene is shown in the figure, and the AOX1tt is shown in the figure. The figure shows pTEF1 (corresponding to TEF1 promoter in the figure). At the same time, the lowercase part is pEM7 (corresponding to EM7promoter in the figure), The figure shows BleoR, and the lowercase letter part "_" is CYC1tt (corresponding to CYC1terminator in the figure).

[0058] SEQ ID NO.7:

[0059]

[0060]

[0061]

[0062] 3.2 Construction of plasmid pMCrN-AOX

[0063] The SEQ ID NO.8 sequence (PpRGI2) and SEQ ID NO:9 sequence were synthesized to replace the PpHIS4 and Zeocin screening marker sequences on the pMChZ-AOX obtained in step 3.1, respectively, to obtain the plasmid pMCrN-AOX (where r represents the recombination site PpRGI2, and N represents the screening marker NrsR). The map is shown in FIG. Figure 3 shown.

[0064] 3.3 Construction of plasmid pMCeH-AOX

[0065] The SEQ ID NO.10 sequence (PpENO) and the SEQ ID NO.11 sequence were synthesized to replace PpHIS4 and PEM7-BleoR-CYC1 tt on pMChZ-AOX, respectively, to obtain the plasmid pMCeH-AOX (e represents the recombination site is PpENO, H represents the screening marker is HygR), the map is shown in Figure 4 shown.

[0066] SEQ ID NO.11:

[0067] ATGGGTAAAAAGCCTGAACTCACCGCGACGTCTGTCGAGAAGTTTCTGATCGAAAAGTTCGACAGCGT CTCCGACCTGATGCAGCTCTCGGAGGGCGAAGAATCTCGTGCTTTCAGCTTCGATGTAGGAGGGCGTGGATATGTC CTGCGGGTAAATAGCTGCGCCGATGGTTTCTACAAAGATCGTTATGTTTATCGGCACTTTGCATCGGCCGCGCTCC CGATTCCGGAAGTGCTTGACATTGGGGAATTCAGCGAGAGCCTGACCTATTGCATCTCCCGCCGTGCACAGGGTGT CACGTTGCAAGACCTCCCTGAAACCGAACTGCCCGCTGTTCTGCAGCCGGTCGCGGAGGCCATGGATGCGATCGCT GCGGCCGATCTTAGCCAGACGAGCGGGTTCGGCCCATTCGGACCGCAAGGAATCGGTCAATACACTACATGGCGTG ATTTCATATGCGCGATTGCTGATCCCCATGTGTATCACTGGCAAACTGTGATGGACGACACCGTCAGTGCGTCCGT CGCGCAGGCTCTCGATGAGCTGATGCTTTGGGCCGAGGACTGCCCCGAAGTCCGGCACCTCGTGCACGCGGATTTC GGCTCCAACAATGTCCTGACGGACAATGGCCGCATAACAGCGGTCATTGACTGGAGCGAGGCGATGTTCGGGGATT CCCAATACGAGGTCGCCAACATCTTCTTCTGGAGGCCGTGGTTGGCTTGTATGGAGCAGCAGACGCGCTACTTCGA GCGGAGGCATCCGGAGCTTGCAGGATCGCCGCGGCTCCGGGCGTATATGCTCCGCATTGGTCTTGACCAACTCTAT CAGAGCTTGGTTGACGGCAATTTCGATGATGCAGCTTGGGCGCAGGGTCGATGCGACGCAATCGTCCGATCCGGAG CCGGGACTGTCGGGCGTACACAAATCGCCCGCAGAAGCGCGGCCGTCTGGACCGATGGCTGTGTAGAAGTACTCGC CGATAGTGGAAACCGACGCCCCAGCACTCGTCCGAGGGCAAAGGAATAATCAGTACTGACAATAAAAAGATTCTTGTTTTCAAGAACTTGTCATTTGTATAGTTTTTTTATATTGTAGTTGTTCTATTTTAATCAAATGTTAGCGTGATTTATATTTTTTTTCGCCTCGACATCATCTGCCCAGATGCGAAGTTAAGTGCGCAGAAAGTAATATCATGCGTCAATCGTATGTGAATGCTGGTCGCTATACTG, wherein the underline is HYGR and the 3' end is TEFTT.

[0068] 4. Construction of recombinant expression vector:

[0069] 4.1 Clone α1(Ⅰ) into the pMChZ-AOX vector constructed in 3.1 above to obtain the recombinant expression plasmid pMChZ-α1(Ⅰ).

[0070] 4.2 Clone α2(Ⅰ) into the pMCrN-AOX vector constructed in 3.2 above to obtain the recombinant expression plasmid pMCrN-α2(Ⅰ).

[0071] 4.3 The target genes α1(Ⅰ) and α2(Ⅰ) were amplified using pMChZ-α1(Ⅰ) and pMCrN-α2(Ⅰ) as templates, respectively, to construct the [α1(Ⅰ)]2α2(Ⅰ) transcription unit (SEQ ID NO.13), and the [α1(Ⅰ)]2α2(Ⅰ) transcription unit was cloned into the pMCeH-AOX vector constructed in the above 3.3 using BsaⅠ endonuclease to obtain pMCeH-[α1(Ⅰ)]2α2(Ⅰ).

[0072] 4.4 Construction of P4H expression vector pPIC9K-P4H(DP)-1

[0073] The synthesized sequence SEQ ID NO.12 was used to replace KanR in the P4H 9K DP plasmid (disclosed in Chinese patent CN114480471A), that is, PTEF and PEM7 were added to the 5' end of the selection marker (according to the direction of the pPIC9K plasmid), and CYC1tt was added to the 3' end to obtain the P4H expression vector pPIC9K-P4H(DP)-1. Figure 5 shown.

[0074] SEQ ID NO.12:

[0075]

[0076] in, PTEF is shown, “” is PEM7, “” is KANR, and “” is CYC1TT.

[0077] 5. Construction of recombinant engineering strains, induced expression and strain screening:

[0078] Pichia KM71 (or X33) was used as the starting strain, and the competent state of Pichia was prepared according to the competent state preparation method described by Lin-Cereghino (Lin-Cereghino et al., 2005); pMChZ-α1(Ⅰ) obtained in 4.1 was linearized with SalⅠ to obtain pMChZ-α1(Ⅰ) linearized plasmid. The pMChZ-α1(Ⅰ) linearized plasmid was electroporated into the competent state of Pichia according to the method of Invitrogen's Pichia ExpressionKit USER GUIDE, and then coated on a YPDZ (bleomycin, 300 μg / mL) plate to obtain the strain KM71H / pMChZ-α1(Ⅰ).

[0079] Using KM71H / pMChZ-α1(Ⅰ) as the starting strain, pMCrN-α2(Ⅰ) obtained in 4.2 above was linearized using SalⅠ and transformed into the competent cell of the starting strain to obtain strain KM71H / α1(Ⅰ)-α2(Ⅰ).

[0080] Using KM71H / α1(Ⅰ)-α2(Ⅰ) as the starting strain, the pPIC9K-P4H(DP)-1 obtained in 4.4 above was linearized using BspEⅠ and transformed into the competent cell of the starting strain to obtain strain KM71H / α1(Ⅰ)-α2(Ⅰ)-P4H.

[0081] Using KM71H / α1(Ⅰ)-α2(Ⅰ)-P4H as the starting strain, the pMCeH-[α1(Ⅰ)]2α2(Ⅰ) obtained in 4.3 above was linearized using SalⅠ and transformed into the competent cell of the starting strain to obtain the strain KM71H / [α1(Ⅰ)]2α2(Ⅰ)-P4H.

[0082] 6. The engineered strain obtained above was inoculated into a 100 mL Erlenmeyer flask containing 10 mL of BMGY medium and cultured at 28°C and 220 rpm until OD 600 The cells were collected by centrifugation at 3000 g for 5 min at room temperature and resuspended in BMMY medium to an OD of 4. 600The cell culture medium was placed on a shaker at 28°C and 220 rpm for 3 days. 100% methanol was added to the culture medium every 24 hours to a final concentration of 1.0%. After induction with methanol, bacterial samples were collected every 24 hours. The sample volume was 1 mL and placed in a 1.5 mL EP tube. The supernatant and bacterial cells were collected separately after centrifugation at 12000 g for 5 minutes at 4°C. 80 μL of the supernatant was added with 20 μL of loading buffer and heated at 80°C for 5 minutes to prepare the sample. 20 μL was taken for SDS-PAGE. Add 200 μL of cell wall breaking solution and 40% of the liquid volume of 0.5 mm glass beads to the cells; vortex for 1 min, place on ice for 1 min, and repeat 6 times; centrifuge at 12000g for 30 min at 4°C, take 80 μL of the supernatant and add 20 μL of loading buffer, heat at 99°C for 5 min to prepare the sample, dissolve the precipitate with 8M urea, and prepare the sample according to the supernatant operation steps, take 20 μL for SDS-PAGE, and then perform Western Blot. Collagen was detected using COL1A1 and COL1A2 antibodies, respectively. The test results are as follows: Figure 6 As shown in the results, KM71H / α1(Ⅰ)-α2(Ⅰ) and KM71H / [α1(Ⅰ)]2α2(Ⅰ)-P4H can detect full-length COL1A1 and COL1A2. The α subunit of P4H was detected with the P4HA1 antibody, and the β subunit of P4H was detected with the P4HB antibody. The detection results are shown in Figure 7 As shown, the results showed that KM71H / α1(Ⅰ)-α2(Ⅰ) and KM71H / [α1(Ⅰ)]2α2(Ⅰ)-P4H could normally express P4HA and P4HB subunits.

[0083] Formula of cell wall breaking solution: 50 mM sodium phosphate (pH 7.4), 1 mM EDTA, 5% glycerol and 1 mM phenylmethylsulfonyl fluoride (PMSF) were dissolved in anhydrous ethanol to prepare a 100× mother solution, which was added before cell wall breaking.

[0084] 7. High-density fermentation culture and protein purification: The engineered bacteria with high expression levels identified through protein expression will be subjected to high-density fermentation culture and protein purification in a fermenter.

[0085] KM71H / [α1(Ⅰ)]2α2(Ⅰ)-P4H was inoculated into a 1 L shake flask containing 200 mL of seed culture medium YPG and cultured at 220 rpm and 30°C for 18 h until OD600 = 2-10.

[0086] Use a 5L fermentation tank (Baoxing Biotechnology) with 2L of fermentation medium. Before inoculation, adjust the speed to 300rpm, the ventilation volume to 4L / min, the temperature to 30°C, and adjust the pH with an alkali solution prepared with concentrated ammonia water to set the pH to 6.0. First, add 0.9mL PTM1, then add the prepared 200mL seed solution to the tank (flame circle inoculation), then click on the dissolved oxygen electrode to calibrate, and start fermentation after calibration. When the dissolved oxygen drops to 30% for the first time during growth, use the dissolved oxygen cascade speed function to maintain 30%; wait for the glycerol to be consumed, the dissolved oxygen to rebound, and the dissolved oxygen to be greater than 70% (OD 600 value of about 20), cancel the dissolved oxygen cascade speed, increase the stirring speed to 650rpm, use 30% linkage feeding of glycerol, and feed 150mL. Stop feeding glycerol, after the dissolved oxygen rebounds to more than 70%, induce culture with methanol, and feed at a constant rate of 4mL / h. After induction for 80h, OD 600 When the change is not obvious or decreases, the tank can be released to obtain the fermentation liquid.

[0087] After the fermentation, the bacterial liquid was centrifuged at 5000rpm for 30min to collect the bacterial cells, which were resuspended in the purified cell wall breaking solution at a ratio of 1:10 (W:V), and broken by a homogenizer at 1000bar. After the breaking, the supernatant and precipitate were separated by centrifugation at 12000rpm and 4℃ for 30min. The precipitate was washed, renatured, digested with pepsin, ultrafiltered and desalted, and then freeze-dried to obtain α1(Ⅰ)α2(Ⅰ) freeze-dried powder.

[0088] Purification cell wall breaking solution formula: 10mM Tris-HCl (pH 7.4), 100mM NaCl and 100mM glycine.

[0089] 8. Structural characterization of α1(Ⅰ)α2(Ⅰ) lyophilized powder:

[0090] The α1(Ⅰ)α2(Ⅰ) freeze-dried powder was reconstituted and then acid-hydrolyzed. The sample was analyzed by liquid chromatography-mass spectrometry. The peak area of ​​the targeted data was calculated using MassLynx quantitative software. The identification result was obtained using the standard curve method. The results showed that the hydroxyproline content reached more than 30% of the total proline.

[0091] 9. Dissolve the α1(Ⅰ)α2(Ⅰ) freeze-dried powder in water and detect it using a circular dichroism spectrometer. The test results are as follows: Figure 8 As shown, it is consistent with the circular dichroism spectral characteristics of triple-helical collagen.

[0092] 10. After negative staining, the collagen sample was tested by transmission electron microscopy. The test results are as follows: Fig. 9 Shown are the typical structural features of collagen microfibrils with alternating light and dark characteristics.

[0093] The embodiments described above are only descriptions of the preferred modes of the present invention, and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope determined by the claims of the present invention.

Claims

1. A method for constructing an engineering bacterium expressing triple helical type I recombinant human collagen, characterized in that: The following steps are involved: The pMChZ-α1(Ⅰ) plasmid was transformed into the competent host bacteria to construct the strain KM71H / pMChZ-α1(Ⅰ); The pMCrN-α2(Ⅰ) plasmid was transformed into the competent cell of the strain KM71H / pMChZ-α1(Ⅰ) to construct the strain KM71H / α1(Ⅰ)-α2(Ⅰ); The pPIC9K-P4H(DP)-1 plasmid was transformed into the competent cell of the strain KM71H / α1(Ⅰ)-α2(Ⅰ) to construct the strain KM71H / α1(Ⅰ)-α2(Ⅰ)-P4H; The pMCeH-[α1(Ⅰ)]2α2(Ⅰ)-plasmid is transformed into the competent cell of the strain KM71H / α1(Ⅰ)-α2(Ⅰ)-P4H to construct the engineered bacteria; The host bacteria is Pichia pastoris X33 or Pichia pastoris KM71; The pMChZ-α1(Ⅰ) plasmid is obtained by cloning α1(Ⅰ) into the pMChZ-AOX vector; The pMCrN-α2(Ⅰ) plasmid is obtained by cloning α2(Ⅰ) into the pMCrN-AOX vector; The pPIC9K-P4H(DP)-1 plasmid is obtained by replacing KanR in the P4H 9K DP plasmid with the sequence shown in SEQ ID NO.12; The pMCeH-[α1(Ⅰ)]2α2(Ⅰ) plasmid is obtained by cloning the [α1(Ⅰ)]2α2(Ⅰ) transcription unit into the pMCeH-AOX vector; The nucleotide sequence of α1(Ⅰ) is shown in SEQ ID NO.3; The nucleotide sequence of α2(Ⅰ) is shown in SEQ ID NO.6; The nucleotide sequence of the [α1(Ⅰ)]2α2(Ⅰ) transcription unit is shown in SEQ ID NO.13; The pMChZ-AOX vector is obtained by modifying the pPIC9K plasmid as follows: replacing 4648-9221 bp of the pPIC9K plasmid with a DNA molecule with a nucleotide sequence as shown in SEQ ID NO.7; deleting BamHI located upstream of αMF in the pPIC9K plasmid; and introducing a BamHI recognition site between 1583-1584 bp of the pPIC9K plasmid by point mutation; The pMCrN-AOX vector is constructed by replacing the PpHIS4 and Zeocin selection markers on the pMChZ-AOX vector with DNA molecules with nucleotide sequences as shown in SEQ ID NO.8 and SEQ ID NO.9, respectively; The pMCeH-AOX vector is constructed by replacing PpHIS4 and PEM7-BleoR-CYC1 tt on the pMChZ-AOX vector with DNA molecules whose nucleotide sequences are shown in SEQ ID NO.10 and SEQ ID NO.11, respectively.

2. The construction method according to claim 1, characterized in that: The BamHI located upstream of αMF in the pPIC9K plasmid was deleted by point mutation.

3. An engineered bacterium expressing triple helical type I recombinant human collagen constructed according to the construction method according to any one of claims 1 to 2.

4. Use of the engineered bacteria as claimed in claim 3 in the preparation of triple helical type I recombinant human collagen.

5. A method for preparing triple helical type I recombinant human collagen expressed in yeast, characterized in that: The method comprises the steps of obtaining the triple helical type I recombinant human collagen by fermentation and purification using the engineering bacteria described in claim 3.

Images