Proline hydroxylase mutants and their use and methods in hydroxyproline production
By mutating key sites of proline hydroxylase and optimizing genetically engineered strains, the problem of insufficient hydroxyproline yield and purity in existing technologies has been solved, and high-purity hydroxyproline production has been achieved.
Patent Information
- Application Number
- CN202510063543.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-01-15
- Publication Date
- 2026-02-24
- Estimated Expiration
- 2045-01-15
AI Technical Summary
In existing technologies, the low enzyme activity of proline hydroxylase leads to the presence of proline in hydroxyproline produced by fermentation, making it difficult to increase the yield of hydroxyproline and increasing the difficulty of purification, thus limiting its large-scale application.
By mutating specific sites of proline hydroxylase (such as S85, D122, H125, V126, G141, S205, and S211), the activity and efficiency of the enzyme can be improved, and genetically engineered strains can be optimized to increase the production of hydroxyproline.
It significantly improved the yield and purity of hydroxyproline, and the combination of mutation sites can increase the yield of hydroxyproline to more than 90%, thus reducing production costs.
Smart Images

Figure CN119899811B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application belongs to the field of genetic engineering and enzyme engineering, and particularly relates to a proline hydroxylase mutant and its application and method in hydroxyproline production. BACKGROUND
[0002] Hydroxyproline (HYP) is a sub-product of imino acid, a non-essential amino acid, one of the main components of collagen tissue, and a unique amino acid in collagen, accounting for about 13% of the total amount of collagen amino acids. Hydroxyproline has a wide range of uses and has broad application prospects in the fields of food, cosmetics, dietary supplements, medicine, etc. In the food field, hydroxyproline can be used as a food additive for cakes, bread, fruit juice, sauce, ice cream, etc., which can improve the taste of food and improve the utilization rate of raw materials; in the medical field, hydroxyproline can treat arthritis and synthesize collagen needed by the human body. The preparation methods of hydroxyproline include microbial fermentation method, protein hydrolysis extraction method and chemical synthesis method. Due to the problems of high production cost and complex operation of the chemical synthesis method, large-scale production has not been realized, so the protein hydrolysis extraction method is the mainstream method for preparing hydroxyproline. However, due to the high production cost of this preparation method, large-scale application is limited, and therefore a production method with lower cost is urgently needed to be developed.
[0003] The microbial fermentation method mainly uses the biosynthesis pathway of microbial strains to produce hydroxyproline. Its advantages are that it uses sugar as raw material, which meets the eating habits, has low production cost and high efficiency. In particular, with the adoption of genetic engineering breeding technology and high-yield optimization control technology, the production cost of fermentation method is greatly reduced. The technology of using metabolic engineering and genetic engineering methods to modify strains to produce products beneficial to humans is becoming more and more mature, and the advantages are more obvious. However, due to the low enzyme activity of proline hydroxylase p4h, a certain proportion of proline is mixed in the final product hydroxyproline, which cannot continue to increase the yield of hydroxyproline, and also increases the difficulty of downstream purification process, making it difficult to obtain high-purity hydroxyproline. SUMMARY
[0004] In order to solve the above problems, the present application provides a proline hydroxylase mutant, which can increase the yield of hydroxyproline and also reduce the content of proline. The present application first reports that p4h point mutation can increase the yield of HYP.
[0005] In one aspect, the present application provides a proline hydroxylase mutant, which is mutated based on the sequence of SEQ ID NO. 1; the mutation site is selected from one or more of S85, D122, H125, V126, G141, S211, or S205.
[0006] SEQ ID NO. 1:
[0007] ATGCTGACTCCAACCGAACTGAAACAATATCGTGAAGCTGGCTATCTGCTGATTGAGGATGGTCTGGGCCCTCGCGAAGTGGACTGCCTGCGCCGTGCAGCGGCGGCTCTGTACGCTCAGGATAGCCCTGACCGTACCCTGGAAAAGGACGGTCGTACCGTTCGTGCTGTCCACGGTTGCCACCGCCGCGACCCGGTTTGCCGTGATCTGGTTCGTCACCCTCGTCTGCTGGGTCCAGCTATGCAAATCCTGTCCGGCGACGTTTACGTGCACCAGTTCAAGATCAACGCGAAGGCTCCTATGACCGGTGATGTCTGGCCTTGGCACCAGGATTACATCTTTTGGGCACGCGAAGATGGCATGGACCGCCCGCATGTGGTTAACGTGGCTGTTCTGCTGGATGAGGCAACTCACCTGAACGGTCCTCTGCTGTTCGTTCCAGGCACCCACGAACTGGGCCTGATTGACGTTGAGCGCCGTGCTCCAGCCGGTGACGGCGATGCACAGTGGCTGCCACAGCTGAGCGCAGACCTGGACTACGCTATCGATGCCGACCTGCTGGCTCGCCTGACCGCAGGCCGCGGTATTGAAAGCGCAACTGGCCCAGCCGGCTCTATCCTGCTGTTTGACTCCCGCATCGTGCACGGTTCCGGCACTAACATGAGCCCGCATCCGCGCGGTGTGGTTCTGGTCACCTACAACCGCACTGACAATGCGCTGCCAGCACAGGCTGCGCCTCGTCCTGAGTTCCTGGCGGCTCGCGACGCAACCCCACTGGTGCCGCTGCCAGCAGGCTTCGCACTGGCTCAACCGGTGTAA.
[0008] Further specifically, the amino acid sequence corresponding to the sequence SEQ ID NO. 1 is SEQ ID NO. 6.
[0009] SEQ ID NO. 6:
[0010] MLTPTELKQYREAGYLLIEDGLGPREVDCLRRAAAALYAQDSPDRTLEKDGRTVRAVHGCHRRDPVCRDLVRHPRLLGPAMQILSGDVYVHQFKINAKAPMTGDVWPWHQDYIFWAREDGMDRPHVVNVAVLLDEATHLNGPLLFVPGTHELGLIDVERRAPAGDGDAQWLPQLSADLDYAIDADLLARLTAGRGIESATGPAGSILLFDSRIVHGSGTNMSPHPRGVVLVTYNRTDNALPAQAAPRPEFLAARDATPLVPLPAGFALAQPV*.
[0011] In particular, the mutation site comprises a semi-saturation mutation and / or a saturation mutation.
[0012] Preferably, the mutation site can be a saturation mutation.
[0013] In particular, the mutation site can be selected from one or more of S85G, S85N, S85R, S85E, S85Q, S85D, S85A, D122A, H125A, H125S, H125T, V126A, V126N, V126T, G141A, G141T, G141R, G141Q, G141S, S205A and S211A.
[0014] Preferably, the mutation site can be selected from S85Q, S85A, V126A, V126T, H125S, H125T, G141A, S85Q-V126A (combination of two sites S85Q and V126A), S85A-V126T, G141A-H125S or G141A-H125T.
[0015] In another aspect, the present application provides a nucleic acid molecule encoding the aforementioned proline hydroxylase mutant.
[0016] In another aspect, the present application provides a recombinant plasmid comprising the aforementioned nucleic acid molecule.
[0017] In another aspect, the present application provides a host cell comprising the aforementioned nucleic acid molecule or recombinant plasmid.
[0018] In particular, the host cell can be a eukaryotic cell or a prokaryotic cell.
[0019] Further in particular, the host cell can be a prokaryotic cell.
[0020] Preferably, the prokaryotic cells include, but are not limited to: Escherichia coli, Pseudomonas, Bacillus, Streptococcus, or Actinomycetes.
[0021] More preferably, the prokaryotic cell may be Escherichia coli.
[0022] In another aspect, the present invention provides a method for increasing the yield and / or purity of hydroxyproline, obtained through the aforementioned host cell fermentation.
[0023] In another aspect, the present invention provides the application of the aforementioned proline hydroxylase mutants, nucleic acid molecules, or host cells in the preparation of hydroxyproline.
[0024] In another aspect, the present invention provides the application of the aforementioned proline hydroxylase mutants, nucleic acid molecules, or host cells in the preparation of cosmetics or pharmaceuticals.
[0025] The technical effects achieved by this invention are as follows:
[0026] This invention is the first to propose that mutations at the p4h site can significantly increase the content and proportion of hydroxyproline (HYP). Mutation sites include, but are not limited to: G141, S205, S211, H125, D122, S85, or V126. These sites can be half-saturated or saturated mutations, and can also be combined in pairs for mutation, all of which can improve HYP yield and purity. Attached Figure Description
[0027] Figure 1 This is a chromatogram of HPLC peaks.
[0028] Figure 2 This is the result of a p4h alanine scan.
[0029] Figure 3 The content of hydroxyproline and proline, and the percentage of hydroxyproline in the S85 saturation mutant.
[0030] Figure 4 The content and percentage of hydroxyproline and proline in the V126 saturation mutant are shown.
[0031] Figure 5 The content and percentage of hydroxyproline and proline in the G141 saturated mutant are shown.
[0032] Figure 6 The content of hydroxyproline and proline, and the percentage of hydroxyproline in the H125 saturated mutant.
[0033] Figure 7 The content and percentage of hydroxyproline and proline in the H125 and G141 combined mutations are shown. Detailed Implementation
[0034] The present invention will be further described in detail below with reference to specific embodiments. The following embodiments are not intended to limit the present invention, but only to illustrate the present invention. Unless otherwise specified, the experimental methods used in the following embodiments are generally performed under conventional conditions. Unless otherwise specified, the materials and reagents used in the following embodiments are commercially available.
[0035] Basic Experiment 1: Method for producing hydroxyproline by genetically engineered strains (shake flask fermentation)
[0036] (1) Experimental reagents
[0037] (a) LB medium: Each liter of medium contains 5g yeast extract, 10g sodium chloride, 10g peptone, and deionized water to a final volume of 1L (by J. Sambrook, translated by Huang Peitang, Molecular Cloning Guide, 2002, 1595).
[0038] The above solution was sterilized by high-pressure steam at a temperature of 121°C for 20-30 minutes.
[0039] (b) Fermentation medium (per liter): 30g glucose, 200mL 5N-5 times salt solution, 1mL TM3 solution, 10mg ferric citrate, 246mg magnesium sulfate heptahydrate, 111mg calcium chloride, 1μg thiamine, and diluted to 1L with sterile deionized water.
[0040] The 5N-5 times salt solution consists of 75.6g of disodium hydrogen phosphate dodecahydrate, 15g of potassium dihydrogen phosphate per liter, 2.5g of sodium chloride, and 25g of ammonium chloride, diluted to 1L with deionized water; the TM3 solution consists of 2.0g of zinc chloride tetrahydrate, 2.0g of calcium chloride hexahydrate, 2.0g of sodium molybdate dihydrate, 1.9g of copper sulfate pentahydrate, 0.5g of boric acid, 100mL of hydrochloric acid, diluted to 1L with deionized water.
[0041] The above solution was autoclaved at 121°C for 20-30 minutes. Simultaneously, empty shake flasks were prepared, with 0.6g of calcium carbonate weighed into each flask to achieve a final calcium carbonate concentration of 30g / L.
[0042] (2) Experimental apparatus: constant temperature shaker incubator.
[0043] (3) Experimental methods:
[0044] (a) Inoculate the recombinant strain into 3 mL of LB medium containing antibiotics and incubate at 37°C on a shaker at 250 rpm; (b) Transfer 200 μL of the seed culture after 16 h to 2 mL of LB liquid medium containing antibiotics and incubate at 37°C on a shaker at 250 rpm for 4 h; (c) Transfer all 2 mL of the secondary seed culture into a shake flask containing 18 mL of fermentation medium and incubate at 37°C on a shaker at 250 rpm for 4 h; (d) Add IPTG to a final concentration of 1 mM, adjust the shaker temperature to 37°C, and continue incubation for approximately 20 h. Mix 0.1 mL of fermentation broth with 0.9 mL of water, centrifuge (12000 rpm, 1 min), and take 100 μL of the supernatant for derivatization sample preparation.
[0045] Derivatization method: Take 100 μL of supernatant, add 100 μL of 0.5 M boric acid solution (pH 7.7), mix well, incubate at 30 °C for 3 min, add 200 μL of Fmoc-Cl solution, mix well, incubate at 30 °C for 5 min, add 800 μL of ADAM solution, mix well and react for 2 min, filter with organic phase and detect by HPLC.
[0046] Basic Experiment 2: HPLC Determination of Hydroxyproline in Fermentation Broth
[0047] The derivatized supernatant was precisely pipetted through a 0.22 μm organic filter membrane and analyzed by HPLC. The HPLC parameters were as follows: an Agilent SB-C18 4.6*150 mm column was used; the mobile phase was A: 0.1% formic acid / water, C: acetonitrile, with an initial ratio of A:C = 55:45; the elution gradient program is shown in Table 1; the column flow rate was 1.35 mL / min; the column temperature was 30℃; the wavelength was 264 nm; the injection volume was 5 μL; and the detection time was 13.5 min. Hydroxyproline eluted at 2.6 min, and proline at 5.9 min. The HPLC chromatogram is shown below. Figure 1 As shown.
[0048] Table 1 Gradient elution program
[0049] Time (min) Phase A (% v / v) Phase C (% v / v) 0.01 55 45 7.00 47 53 7.50 25 75 8.00 0 100 10.00 0 100 10.50 55 45 13.5 55 45
[0050] Example 1: p4h alanine scanning and fermentation verification
[0051] Starting with Escherichia coli W3110 (ATCC27325) (genotype: F-mcrAmcrB IN(rrnD-rrnE)1lambda-), our laboratory knocked out the genes responsible for the degradation and uptake of hydroxyproline. Simultaneously, we integrated a hydroxyproline synthesis operon that relieved feedback inhibition, and modified its feedback inhibition and weakened regulation to obtain the genetically engineered strain SHX107, which was classified as Escherichia coli.
[0052] In this laboratory, we docked and analyzed the three-dimensional structure of the p4h protein, scanned for alanine at seven sites (G141, S205, S211, H125, D122, S85, and V126), and constructed the corresponding mutant plasmids pHJ01-pHJ07. The correctly sequenced expression plasmids were transformed into the host SHX107, and the yield of hydroxyproline in the recombinant strain was verified using the shake-flask fermentation method described in Basic Experiment 1. The results are shown in Table 2. Figure 2 As shown, the mutant plasmids that scanned alanine all increased hydroxyproline production to varying degrees. Among them, G141A, V126A, H125A, and S85A significantly improved the purity of hydroxyproline, increasing it from 68% to over 78%. p4h... G141A The gene sequence is SEQ ID NO.2, and the amino acid sequence is SEQ ID NO.7.
[0053] SEQ ID NO.2:
[0054] ATGCTGACTCCAACCGAACTGAAACAATATCGTGAAGCTGGCTATCTGCTGATTGAGGATGGTCTGGGCCCTCGCGAAGTGGACTGCCTGCGCCGTGCAGCGGCGGCTCTGTACGCTCAGGATAGCCCTGACCGTACCCTGGAAAAGGACGGTCGTACCGTTCGTGCTGTCCACGGTTGCCACCGCCGCGACCCGGTTTGCCGTGATCTGGTTCGTCACCCTCGTCTGCTGGGTCCAGCTATGCAAATCCTGTCCGGCGACGTTTACGTGCACCAGTTCAAGATCAACGCGAAGGCTCCTATGACCGGTGATGTCTGGCCTTGGCACCAGGATTACATCTTTTGGGCACGCGAAGATGGCATGGACCGCCCGCATGTGGTTAACGTGGCTGTTCTGCTGGATGAGGCAACTCACCTGAACGCTCCTCTGCTGTTCGTTCCAGGCACCCACGAACTGGGCCTGATTGACGTTGAGCGCCGTGCTCCAGCCGGTGACGGCGATGCACAGTGGCTGCCACAGCTGAGCGCAGACCTGGACTACGCTATCGATGCCGACCTGCTGGCTCGCCTGACCGCAGGCCGCGGTATTGAAAGCGCAACTGGCCCAGCCGGCTCTATCCTGCTGTTTGACTCCCGCATCGTGCACGGTTCCGGCACTAACATGAGCCCGCATCCGCGCGGTGTGGTTCTGGTCACCTACAACCGCACTGACAATGCGCTGCCAGCACAGGCTGCGCCTCGTCCTGAGTTCCTGGCGGCTCGCGACGCAACCCCACTGGTGCCGCTGCCAGCAGGCTTCGCACTGGCTCAACCGGTGTAA;
[0055] SEQ ID NO.7:
[0056] MLTPTELKQYREAGYLLIEDGLGPREVDCLRRAAAALYAQDSPDRTLEKDGRTVRAVHGCHRRDPVCRDLVRHPRLLGPAMQILSGDVYVHQFKINAKAPMTGDVWPWHQDYIFWAREDGMDRPHVVNVAVLLDEAT HLNAPLLFVPGTHELGLIDVERRAPAGDGDAQWLPQLSADLDYAIDADLLARLTAGRGIESATGPAGSILLFDSRIVHGSGTNMSPHPRGVVLVTYNRTDNALPAQAAPRPEFLAARDATPLVPLPAGFALAQPV*.
[0057] With pHJ01(pEZ07-p4h G141A Taking the plasmid construction of pHX217 (pEZ07-p4h) as an example, using the primer pair pHJ01-F / pHJ01-R in Table 3, circular PCR was performed. The amplified product was taken in 2 μL + 6 μL sterile water + 1 μL DpnI + 1 μL 10xFDBuffer and placed at 37℃ for 1 h for digestion. Then it was transferred to ice and placed for 5 min. Subsequently, it was transferred into TG1 competent cells, mixed and placed for 5 min. After heat shock at 42℃ for 2 min, ice bath for 2 min, 800 μL of recovery medium LB was added. After recovery culture at 37℃ for 1 h, it was centrifuged and plated on LB plates containing 100 mg / L spectinomycin. The next day, clones were picked and cultured overnight. After plasmid extraction and enzyme digestion to verify correctness, it was sent to Genewiz for sequencing.
[0058] Table 2. Alanine Scan Results
[0059]
[0060] Note: In the table, the percentage of hydroxyproline = hydroxyproline production / (hydroxyproline production + proline production) * 100;
[0061] Percentage increase = (Hydroxyproline yield of mutant plasmid - Hydroxyproline yield of wild-type plasmid) / Hydroxyproline yield of wild-type plasmid * 100.
[0062] Table 3 Primer list for constructing plasmids pHJ01-pHJ07
[0063]
[0064]
[0065] Example 2: Construction and fermentation verification of p4h saturated mutant plasmid
[0066] The S85, H125, V126, and G141 clones with high mutation yields from Example 1 were simultaneously subjected to saturation mutagenesis. Following the method in Example 1, saturation library plasmids were constructed and plated on LB agar plates containing 100 mg / L spectinomycin. The following day, five clones from each plate were sent to Genewiz for sequencing verification. Only clones with a mutation probability of over 80% were considered for transfection into the SHX107 host for screening. Specifically, following the shake-flask fermentation method in Basic Experiment 1, 60 clones were randomly selected for initial library screening and secondary screening of dominant clones.
[0067] The results are as follows Figures 3-6 As shown in Table 4, most of the mutations can increase both the yield and purity of hydroxyproline. Among them, p4h... V126T p4h S85G p4h H125S The gene sequences are SEQ ID NO.3, SEQ ID NO.4, and SEQ ID NO.5, and the amino acid sequences are SEQ ID NO.8, SEQ ID NO.9, and SEQ ID NO.10.
[0068] Table 4. Results of Saturated Library Screening
[0069]
[0070]
[0071] SEQ ID NO.3:
[0072] ATGCTGACTCCAACCGAACTGAAACAATATCGTGAAGCTGGCTATCTGCTGATTGAGGATGGTCTGGGCCCTCGCGAAGTGGACTGCCTGCGCCGTGCAGCGGCGGCTCTGTACGCTCAGGATAGCCCTGACCGTACCCTGGAAAAGGACGGTCGTACCGTTCGTGCTGTCCACGGTTGCCACCGCCGCGACCCGGTTTGCCGTGATCTGGTTCGTCACCCTCGTCTGCTGGGTCCAGCTATGCAAATCCTGTCCGGCGACGTTTACGTGCACCAGTTCAAGATCAACGCGAAGGCTCCTATGACCGGTGATGTCTGGCCTTGGCACCAGGATTACATCTTTTGGGCACGCGAAGATGGCATGGACCGCCCGCATACTGTTAACGTGGCTGTTCTGCTGGATGAGGCAACTCACCTGAACGGTCCTCTGCTGTTCGTTCCAGGCACCCACGAACTGGGCCTGATTGACGTTGAGCGCCGTGCTCCAGCCGGTGACGGCGATGCACAGTGGCTGCCACAGCTGAGCGCAGACCTGGACTACGCTATCGATGCCGACCTGCTGGCTCGCCTGACCGCAGGCCGCGGTATTGAAAGCGCAACTGGCCCAGCCGGCTCTATCCTGCTGTTTGACTCCCGCATCGTGCACGGTTCCGGCACTAACATGAGCCCGCATCCGCGCGGTGTGGTTCTGGTCACCTACAACCGCACTGACAATGCGCTGCCAGCACAGGCTGCGCCTCGTCCTGAGTTCCTGGCGGCTCGCGACGCAACCCCACTGGTGCCGCTGCCAGCAGGCTTCGCACTGGCTCAACCGGTGTAA;
[0073] SEQ ID NO.4:
[0074] ATGCTGACTCCAACCGAACTGAAACAATATCGTGAAGCTGGCTATCTGCTGATTGAGGATGGTCTGGGCCCTCGCGAAGTGGACTGCCTGCGCCGTGCAGCGGCGGCTCTGTACGCTCAGGATAGCCCTGACCGTACCCTGGAAAAGGACGGTCGTACCGTTCGTGCTGTCCACGGTTGCCACCGCCGCGACCCGGTTTGCCGTGATCTGGTTCGTCACCCTCGTCTGCTGGGTCCAGCTATGCAAATCCTGGGGGGCGACGTTTACGTGCACCAGTTCAAGATCAACGCGAAGGCTCCTATGACCGGTGATGTCTGGCCTTGGCACCAGGATTACATCTTTTGGGCACGCGAAGATGGCATGGACCGCCCGCATGTGGTTAACGTGGCTGTTCTGCTGGATGAGGCAACTCACCTGAACGGTCCTCTGCTGTTCGTTCCAGGCACCCACGAACTGGGCCTGATTGACGTTGAGCGCCGTGCTCCAGCCGGTGACGGCGATGCACAGTGGCTGCCACAGCTGAGCGCAGACCTGGACTACGCTATCGATGCCGACCTGCTGGCTCGCCTGACCGCAGGCCGCGGTATTGAAAGCGCAACTGGCCCAGCCGGCTCTATCCTGCTGTTTGACTCCCGCATCGTGCACGGTTCCGGCACTAACATGAGCCCGCATCCGCGCGGTGTGGTTCTGGTCACCTACAACCGCACTGACAATGCGCTGCCAGCACAGGCTGCGCCTCGTCCTGAGTTCCTGGCGGCTCGCGACGCAACCCCACTGGTGCCGCTGCCAGCAGGCTTCGCACTGGCTCAACCGGTGTAA;
[0075] SEQ ID NO.5:
[0076] ATGCTGACTCCAACCGAACTGAAACAATATCGTGAAGCTGGCTATCTGCTGATTGAGGATGGTCTGGGCCCTCGCGAAGTGGACTGCCTGCGCCGTGCAGCGGCGGCTCTGTACGCTCAGGATAGCCCTGACCGTACCCTGGAAAAGGACGGTCGTACCGTTCGTGCTGTCCACGGTTGCCACCGCCGCGACCCGGTTTGCCGTGATCTGGTTCGTCACCCTCGTCTGCTGGGTCCAGCTATGCAAATCCTGTCCGGCGACGTTTACGTGCACCAGTTCAAGATCAACGCGAAGGCTCCTATGACCGGTGATGTCTGGCCTTGGCACCAGGATTACATCTTTTGGGCACGCGAAGATGGCATGGACCGCCCGAGTGTGGTTAACGTGGCTGTTCTGCTGGATGAGGCAACTCACCTGAACGGTCCTCTGCTGTTCGTTCCAGGCACCCACGAACTGGGCCTGATTGACGTTGAGCGCCGTGCTCCAGCCGGTGACGGCGATGCACAGTGGCTGCCACAGCTGAGCGCAGACCTGGACTACGCTATCGATGCCGACCTGCTGGCTCGCCTGACCGCAGGCCGCGGTATTGAAAGCGCAACTGGCCCAGCCGGCTCTATCCTGCTGTTTGACTCCCGCATCGTGCACGGTTCCGGCACTAACATGAGCCCGCATCCGCGCGGTGTGGTTCTGGTCACCTACAACCGCACTGACAATGCGCTGCCAGCACAGGCTGCGCCTCGTCCTGAGTTCCTGGCGGCTCGCGACGCAACCCCACTGGTGCCGCTGCCAGCAGGCTTCGCACTGGCTCAACCGGTGTAA;
[0077] SEQ ID NO.8:
[0078] MLTPTELKQYREAGYLLIEDGLGPREVDCLRRAAAALYAQDSPDRTLEKDGRTVRAVHGCHRRDPVCRDLVRHPRLLGPAMQILSGDVYVHQFKINAKAPMTGDVWPWHQDYIFWAREDGMDRPHTVNVAVLLDEATHLNGPLLFVPGTHELGLIDVERRAPAGDGDAQWLPQLSADLDYAIDADLLARLTAGRGIESATGPAGSILLFDSRIVHGSGTNMSPHPRGVVLVTYNRTDNALPAQAAPRPEFLAARDATPLVPLPAGFALAQPV*;
[0079] SEQ ID NO.9:
[0080] MLTPTELKQYREAGYLLIEDGLGPREVDCLRRAAAALYAQDSPDRTLEKDGRTVRAVHGCHRRDPVCRDLVRHPRLLGPAMQILGGDVYVHQFKINAKAPMTGDVWPWHQDYIFWAREDGMDRPHVVNVAVLLDEATHLNGPLLFVPGTHELGLIDVERRAPAGDGDAQWLPQLSADLDYAIDADLLARLTAGRGIESATGPAGSILLFDSRIVHGSGTNMSPHPRGVVLVTYNRTDNALPAQAAPRPEFLAARDATPLVPLPAGFALAQPV*;
[0081] SEQ ID NO.10:
[0082] MLTPTELKQYREAGYLLIEDGLGPREVDCLRRAAAALYAQDSPDRTLEKDGRTVRAVHGCHRRDPVCRDLVRHPRLLGPAMQILSGDVYVHQFKINAKAPMTGDVWPWHQDYIFWAREDGMDRPSVVNVAVLLDEATHLNGPLLFVPGTHELGLIDVERRAPAGDGDAQWLPQLSADLDYAIDADLLARLTAGRGIESATGPAGSILLFDSRIVHGSGTNMSPHPRGVVLVTYNRTDNALPAQAAPRPEFLAARDATPLVPLPAGFALAQPV*.
[0083] Construction of p4h combinatorial mutant plasmid in Example 3 and related fermentation
[0084] The advantageous mutations from Example 2 were combined in pairs. Specifically, following the method in Example 1, combined mutant plasmids were constructed and transformed into the host SHX107 for screening. Shake-flask fermentation was then performed according to the method in Basic Experiment 1.
[0085] Taking the superposition combination of H125 and G141 as an example, the results are as follows: Figure 7 As shown, compared with wild-type p4h, the yield of hydroxyproline in the combinatorial mutant libraries was increased to varying degrees, with the highest increase of 58.8% in the G141A-H125S combination, reaching a maximum proportion of 90%, which greatly improved the purity of hydroxyproline.
[0086] Comparative Example
[0087] Comparative Examples 1-6 were set up with reference to Example 1. The difference between the comparative examples and the examples is that the mutation sites of the constructed plasmids are different. The mutation sites and primers for plasmid construction are shown in Table 5. Other aspects are the same as in Example 1. The results are shown in Table 6.
[0088] Table 5 Comparative plasmid construction primers
[0089]
[0090]
[0091] Table 6
[0092]
[0093] The results showed that mutations at the p4h key site significantly altered enzyme activity, and the optimal combination of mutations significantly increased the yield and purity of hydroxyproline.
Claims
1. A proline hydroxylase mutant, characterized in that, The proline hydroxylase mutant is a mutation based on the sequence SEQ ID NO.1; the mutation is G141A, or any combination of G141A with H125A, H125S, and H125T.
2. A nucleic acid molecule, characterized in that, The nucleic acid molecule encodes the proline hydroxylase mutant of claim 1.
3. A recombinant plasmid, characterized in that, Includes the nucleic acid molecule as described in claim 2.
4. A host cell comprising the nucleic acid molecule of claim 2 or the recombinant plasmid of claim 3.
5. The host cell according to claim 4, characterized in that, The host cell is a eukaryotic cell or a prokaryotic cell.
6. A method for increasing hydroxyproline production, characterized in that, Obtained by host cell fermentation as described in claim 4 or 5.
7. The use of the proline hydroxylase mutant of claim 1, the nucleic acid molecule of claim 2, or the host cell of any one of claims 4-5 in the preparation of hydroxyproline.
Citation Information
Patent Citations
L-proline4-hydroxylase
CN108220259A
Method for producing trans-4-Hyp (trans-4-hydroxy-L-proline) through transformation of recombinant escherichia coli
CN113215120A