A recombinant Helicobacter pylori vaccine and its preparation method and application

By preparing a recombinant Helicobacter pylori vaccine containing urease B and adhesion A and adhesion to BCG bacterial metabolite metabolite adjuvant, the challenges of existing vaccines in terms of immune protection effects and safety are solved, and efficient immune response and large-scale production are achieved.

CN118662616BActive Publication Date: 2025-07-11ANHUI ZHIFEI LONGCOM BIOPHARM CO LTD +2
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202410699742.1
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-05-31
Publication Date
2025-07-11
Estimated Expiration
2044-05-31

AI Technical Summary

Technical Problem

The existing recombinant Helicobacter pylori vaccine has challenges in terms of immune protection effects and safety, making it difficult to achieve efficient large-scale production.

Method used

Using a combination of fusion antigen and adjuvant, the fusion antigen contains Helicobacter pylori antigen urea B and adhesion A. The adjuvant is an intracellular metabolite of the BCG bacteria. The vaccine is prepared by genetically engineered bacteria expression and purification.

Benefits of technology

Induce an efficient anti-Herrelic pylori immune response in immune individuals, with excellent immunogenicity and safety, and is suitable for mass production.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN118662616B_ABST
    Figure CN118662616B_ABST
Patent Text Reader

Abstract

The present invention discloses a recombinant Helicobacter pylori vaccine and its preparation method and application. The recombinant Helicobacter pylori vaccine comprises a fusion antigen and an adjuvant. The fusion antigen is a fusion protein containing Helicobacter pylori antigen protein and an immunocyte factor, and the adjuvant is an intracellular metabolite of Mycobacterium bovis BCG. The beneficial effects of the present invention are as follows: The vaccine provided by the present invention uses, for the first time, a fusion protein containing Helicobacter pylori antigen protein and an immunocyte factor as the fusion antigen, supplemented with an intracellular metabolite of Mycobacterium bovis BCG as the adjuvant. This fusion antigen has natural protein activity, can produce excellent immunogenicity, and can trigger an effective anti-Helicobacter pylori immune response in immunized individuals. After further combining with the adjuvant, it can stimulate a more efficient immune response against Helicobacter pylori antigen. The fusion antigen is expressed by genetically engineered bacteria, and the bacteria used for extracting the adjuvant have high safety, stable and controllable sources, and can be mass-produced on a large scale.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the technical field of vaccines, and particularly relates to a recombinant Helicobacter pylori vaccine, a preparation method thereof, and an application thereof. Background Art

[0002] Helicobacter pylori (H. pylori) infection is a common clinical disease, and the H. pylori infection rate in China reaches 40%-60%. Almost all H. pylori-infected individuals are accompanied by chronic active gastritis, and on this basis, diseases such as peptic ulcer, gastric mucosal atrophy, and precancerous lesions of gastric cancer (intestinal metaplasia and dysplasia) can develop. It is also an important risk factor for the development of gastric cancer. In 1994, the International Agency for Research on Cancer has classified H. pylori as a Group 1 carcinogen. The main modes of transmission of H. pylori are spontaneous infection, oral-oral transmission, and fecal-oral transmission. Due to the simple mode of infection, the infection rate is high, and it was classified as an infectious disease in 2015. Eradicating H. pylori is an effective measure to reduce the risk of gastric cancer and its precancerous lesions. At present, the more advocated is the bismuth quadruple therapy: bismuth agent + proton pump inhibitor + 2 antibacterial drugs; however, H. pylori resistance is an important problem faced worldwide. The increasing resistance rate year by year not only easily leads to the failure of radical cure, but also causes many problems such as dysbacteriosis of the body flora and an increase in adverse reactions. Therefore, it is particularly important to study a safe and effective H. pylori vaccine to prevent H. pylori infection.

[0003] The discovery of various virulence factors and protective antigens of H. pylori and the establishment of a mature animal model provide a basis for the research and development of H. pylori vaccines. Currently, the H. pylori vaccines developed worldwide are mainly whole-bacterium vaccines and genetically engineered subunit vaccines.

[0004] Due to its advantages such as safety and high specificity, the genetically engineered subunit vaccine has always been a research hotspot of Hp vaccines. Currently, the preclinical research on H. pylori vaccines at home and abroad mainly focuses on this aspect. Single antigens such as urease (UreB), vacuolating cytotoxin (VacA), cytotoxin-associated gene A (CagA), adhesin (HpaA), γ-glutamyl transpeptidase (GGT), neutrophil-activating protein (NapA), etc., in combination with different adjuvants, such as heat-labile enterotoxin of Escherichia coli (LTB), etc., are used to immunize animals, and certain preventive effects have been shown.

[0005] Table 1 Summary of preclinical research information on H. pylori vaccines at home and abroad

[0006] Host Antigen Adjuvant Host Antigen Adjuvant Escherichia coli HpaA, CagA, UreB LTB Escherichia coli <![CDATA[UreB 414 、Ompl8]]> LTB Escherichia coli NapA-HpaA-UreB LTB Salmonella typhimurium NapA / Escherichia coli NapA, HpaA, UreB LTB Escherichia coli NapA-HpaA-UreB LTB Escherichia coli HspA-HpaA-UreB LTB Escherichia coli UreB / Escherichia coli Kat, UreB CT Escherichia coli HpaA, CagA, UreB / Escherichia coli IMPDH, CSII, UreB / Whole bacteria / LT Attenuated Salmonella CagA-VacA-UreB / Salmonella typhimurium Kat-UreA / Lactobacillus HpaA / Escherichia coli UreB CTB Salmonella choleraesuis UreB, CagA / Escherichia coli UreB-HpaA LTB Escherichia coli Kat / Salmonella typhimurium UreB-CagA / Salmonella typhi UreB / Escherichia coli UreB CTB Escherichia coli AhpC, Lpp20, UreB LTB Escherichia coli UreB LTA Escherichia coli HpaA, Ure, CagA CTB Escherichia coli NapA-HpaA-UreB LTB Escherichia coli HspA, HpaA, UreB LTB Escherichia coli UreI-UreB CTB Escherichia coli NapA, HpaA, UreB LTB Escherichia coli HpaA LTB Escherichia coli LTA1, LTA2 LTB Escherichia coli Hsp / Escherichia coli UreB, HpaA LTB Escherichia coli UreB, Kat / Escherichia coli HspA LTB Escherichia coli HspA-HpaA-UreB LTB Escherichia coli AhpC, UreB LTB Escherichia coli HpaA LTB

[0007] The vaccines in the clinical stage at home and abroad mainly adopt physical mixing of multiple antigens, or fusion expression of single antigen combined with internal adjuvant, or fusion expression of multiple antigen active fragments. Currently, there are 5 vaccines in the clinical stage (Table 2). Abroad, they are Novartis VacA-CagA-NAP (NCT00736476), ImevaX IMX101 (NCT03270800), and Oravax recombinant Urease+LT. Domestically, they are the recombinant Helicobacter pylori molecular internal adjuvant vaccine jointly developed by the Third Military Medical University / Kangwei Biotechnology and the recombinant Helicobacter pylori live vector vaccine jointly developed by the Third Military Medical University / Kangbao Pharmaceutical (CTR20201399). Three of these 5 vaccines suspended research in the clinical Phase I-II stage. The main reasons are that the immune protection effect is less than expected and the safety is challenged. Only one completed Phase III clinical trials in 2007 but failed to be marketed for various reasons. Although companies and research institutions at home and abroad have been committed to developing effective anti-Helicobacter pylori vaccines, no success has been achieved so far.

[0008] Table 2 Current Status of Clinical Research on Recombinant Helicobacter pylori Vaccines at Home and Abroad

[0009]

[0010] Summary of the Invention

[0011] In view of the deficiencies of the prior art, the present invention provides a recombinant Helicobacter pylori vaccine and its preparation method and application. This vaccine can trigger a highly efficient anti-Helicobacter pylori immune response in immunized individuals, has high raw material safety, stable and controllable sources, and can achieve batch and large-scale production.

[0012] In the first aspect of the present invention, a recombinant Helicobacter pylori vaccine is provided, which comprises a fusion antigen and an adjuvant; the fusion antigen is a fusion protein comprising a Helicobacter pylori antigen protein and an immune cytokine, and the adjuvant is an intracellular metabolite of Mycobacterium bovis BCG.

[0013] According to the specific embodiments of the present invention, the Helicobacter pylori antigen protein is Helicobacter pylori urease B (UreB) and / or Helicobacter pylori adhesin A (HpaA) protein.

[0014] Urease is a metalloenzyme that can hydrolyze urea, accounting for about 8%-10% of the total Hp cell protein, is related to the colonization ability of Hp in the stomach, and can cause inflammatory cell reactions and damage gastric epithelial cells; the urease B subunit (UreB) is the preferred protective antigen for current Helicobacter pylori vaccine research. Adhesin A (HpaA) gene encodes a conserved flagellar adhesin (HpaA), which is the subunit that binds to the receptor, has a conserved sequence, and the immunogenicity of its encoded product has been confirmed.

[0015] According to a specific embodiment of the present invention, the immunocytokine is type I interferon, preferably IFN-α.

[0016] As an antiviral cytokine, type I interferon has many biological activities, including the stimulating effect on immune cells. After type I interferon acts on immature DCs, it can promote the expression of MHC molecules and co-stimulatory molecules on the surface of DCs, such as MHC class I, CD80, and CD86, thereby enhancing the ability of DCs to activate T cells. In addition, after type I interferon acts on DCs, it can promote the migration of DCs to lymph nodes by upregulating the expression of chemokine receptors, thereby promoting the activation of T cells. Among them, IFN-α can transmit signals through IFNAR1 / IFNAR2 and affect the functions of various immune cells; it can also promote the survival of activated CD4 + T cells and memory CD8 + T cells.

[0017] According to a specific embodiment of the present invention, when the fusion antigen is a fusion protein of Helicobacter pylori urease B, Helicobacter pylori adhesin A protein, and IFN-α, the fusion antigen is encoded by the nucleotide sequence shown in SEQ ID NO:4.

[0018] According to a specific embodiment of the present invention, the adjuvant is prepared as follows: The BCG cell bodies are mixed with water and then broken, the supernatant is taken by centrifugation, and after sterilization, the adjuvant is obtained, which contains biologically active substances such as proteins, nucleic acids, and polysaccharides.

[0019] According to a specific embodiment of the present invention, the mass ratio of the fusion antigen to the adjuvant is 50 μg:10 - 30 μg.

[0020] In a second aspect of the present invention, a method for preparing a recombinant Helicobacter pylori vaccine is provided, including: constructing a recombinant vector containing the coding genes of Helicobacter pylori antigen proteins and immunocytokines, transferring the recombinant vector into a host bacterium for expression, and after purification, obtaining a fusion antigen; mixing the BCG cell bodies with water and then breaking, taking the supernatant by centrifugation, and after sterilization, obtaining an adjuvant; mixing the fusion antigen and the adjuvant evenly to obtain the recombinant Helicobacter pylori vaccine.

[0021] According to a specific embodiment of the present invention, the conditions for breaking include: first breaking at 7000 - 10000 rpm for 1 - 3 minutes, then stopping for 3 - 5 minutes, and repeating this cycle more than 3 times.

[0022] According to a specific embodiment of the present invention, the conditions for centrifugation include: 11000 - 12000 g, 35 - 40 minutes, 4°C.

[0023] In the third aspect of the present invention, there is provided the use of the aforementioned recombinant Helicobacter pylori vaccine in the preparation of a medicament for preventing or treating diseases caused by Helicobacter pylori.

[0024] The beneficial effects of the present invention are as follows:

[0025] The vaccine provided by the present invention uses, for the first time, a fusion protein containing a Helicobacter pylori antigen protein and an immune cytokine as a fusion antigen, supplemented with the intracellular metabolite of Mycobacterium bovis BCG as an adjuvant. This fusion antigen has natural protein activity, can generate excellent immunogenicity, and can trigger an effective anti-Helicobacter pylori immune response in immunized individuals. After further combining with the adjuvant, it can stimulate a more efficient immune response against Helicobacter pylori. This fusion antigen is expressed by a genetically engineered bacterium, and the bacteria used for extracting the adjuvant have high safety, stable and controllable sources, and can be mass-produced on a large scale. Description of the Drawings

[0026] Figure 1 It is the protein peak diagram monitored by ultraviolet at 280 nm for the affinity chromatography of UreB protein;

[0027] Figure 2 It is the SDS-PAGE analysis map for the purification of UreB protein by affinity chromatography;

[0028] Figure 3 It is the protein peak diagram monitored by ultraviolet at 280 nm for the affinity chromatography of HpaA protein;

[0029] Figure 4 It is the SDS-PAGE analysis map for the purification of HpaA protein by affinity chromatography;

[0030] Figure 5 It is the protein peak diagram monitored by ultraviolet at 280 nm for the affinity chromatography of UreB-HpaA protein;

[0031] Figure 6 It is the SDS-PAGE analysis map for the purification of UreB-HpaA protein by affinity chromatography;

[0032] Figure 7 It is the protein peak diagram monitored by ultraviolet at 280 nm for the affinity chromatography of UreB-HpaA-IFN-α protein;

[0033] Figure 8 It is the SDS-PAGE analysis map for the purification of UreB-HpaA-IFN-α protein by affinity chromatography;

[0034] Figure 9 It is the diagram showing that the recombinant UreB-HpaA-IFN-α has natural antigen activity (ELISA);

[0035] Figure 10Results of Western Blot for cross-reactivity between recombinant Helicobacter pylori protein and natural protein;

[0036] Figure 11 Results of detection of the number of spots of antigen-specific IFN-γ secreting cells;

[0037] Figure 12 Results of serum-specific IgG expression;

[0038] Figure 13 Plasmid map of pET-28b-UreB;

[0039] Figure 14 Plasmid map of pET-28b-HpaA;

[0040] Figure 15 Plasmid map of pET-28b-UreB-HpaA;

[0041] Figure 16 Plasmid map of pET-28b-UreB-HpaA-IFN-α. Detailed implementation mode

[0042] To make the objectives, technical solutions and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be described clearly and completely below. Obviously, the described embodiments are some, but not all, of the embodiments of the present invention. All other embodiments obtained by those of ordinary skill in the art based on the embodiments of the present invention without creative efforts shall fall within the protection scope of the present invention.

[0043] Example 1 Construction of recombinant single antigen gene UreB of Helicobacter pylori

[0044] According to the UreB gene sequence (AAD07143.1) of Helicobacter pylori strain 26695 in the NCBI database, the nucleotide sequence was optimized according to the codon preference of Escherichia coli. The gene sequence is shown in SEQ ID NO:1. The restriction enzyme sites NcoI and Hind III were designed and cloned into the pET-28b vector to construct the recombinant plasmid pET-28b-UreB (the gene was codon-optimized by GenScript Biotech Corporation, synthesized and ligated to the vector).

[0045] Example 2 Construction of recombinant engineering bacterium pET-28b-UreB / BL21(DE3) of Helicobacter pylori

[0046] Absorb 5 μl of the pET-28b-UreB plasmid and transfer it into the competent cell BL21(DE3). Incubate on ice for 30 min. Heat shock at 42 °C for 90 s, then take it out and incubate on ice for 2 min. Add 160 μl of LB liquid medium and culture at 37 °C with 200 rpm for 1 h. Centrifuge at 3000 - 4000 rpm at room temperature for 1 min, aspirate 120 μl of the supernatant and discard it. Resuspend the centrifuged precipitate by pipetting, aspirate 50 μl of the bacterial solution and spread it evenly on the LB solid medium containing Kan (50 μg / ml). Incubate the petri dish inverted in the 37 °C incubator for 14 - 16 h. Select 2 moist, smooth and neatly edged colonies from each plate, a total of 10 monoclonal colonies, add them to 500 μl of LB medium containing kanamycin, and label them as pET-28b-UreB / BL21(DE3)1 - 10 respectively. Culture at 37 °C with 180 rpm for 14 - 16 h.

[0047] Example 3 Screening of the recombinant engineering bacterium pET-28b-UreB / BL21(DE3) of Helicobacter pylori

[0048] 1. Nucleotide verification: Take 50 μl of the 10 monoclonal bacterial solutions in Example 2, transfer them to 5 ml of LB liquid medium containing kanamycin, and culture with shaking at 37 °C for 14 - 16 h, then extract the plasmid. The plasmid extraction uses the kit of Takara Company. Take 20 μl of the plasmid and send it to Sangon Biotech (Shanghai) Co., Ltd. for sequencing.

[0049] 2. Bacterial solution PCR verification: PCR reaction system (50 μl): 10×Buffer 5 μl, upstream primer 0.5 μl, downstream primer 0.5 μl, dNTP 5 μl, template 1.5 μl, ddH2O 37.5 μl. PCR amplification conditions: Pre-denaturation at 95 °C for 5 min; denaturation at 95 °C for 45 s, annealing at 60 °C for 45 s, extension at 72 °C for 1 min, 30 cycles; extension at 72 °C for another 10 min.

[0050] 3. Plasmid digestion detection: Single digestion reaction system of the recombinant plasmid (50 μl): plasmid 17 μl, 10×Buffer 5 μl, NdeⅠ2 μl, ddH2O 26 μl. Double digestion reaction system of the recombinant plasmid (50 μl): plasmid 17 μl, 10×H 5 μl, NdeⅠ2 μl, Hind III 2 μl, ddH2O 24 μl.

[0051] 4. Target protein detection: Take the recombinant bacterium with correct identification and sequencing, inoculate it at a ratio of 1:1000 into 100 ml of LB liquid medium containing kanamycin at a concentration of 50 μg / ml and culture for 3 - 4 h (OD 600At (0.6 - 0.8), add IPTG for induction (final concentration 0.8 mM), and culture at 37 °C and 180 rpm for 3 h. Detect the expression form and expression level of the recombinant protein by 12% polyacrylamide gel electrophoresis, and screen for highly expressing strains.

[0052] Example 4 Purification of the Target Product

[0053] Prepare highly expressing recombinant Helicobacter pylori strains pET-28b-UreB / BL21(DE3), pET-28b-HpaA / BL21(DE3), pET-28b-UreB-HpaA / BL21(DE3), pET-28b-UreB-HpaA-IFN-α / BL21(DE3) according to the methods of Examples 1 - 3, and then perform the expression and purification of the target product.

[0054] 1. Expression and Purification of Single Antigen UreB

[0055] Add glycerol bacteria containing the pET-28b-UreB / BL21(DE3) plasmid (plasmid map as Figure 13 shown) to 5 ml of LB liquid medium (containing kan at a concentration of 50 μg / ml) at a ratio of 1:1000 and culture overnight. Then inoculate the above bacterial solution into 2 bottles of 1000 ml of LB liquid medium (containing kan at a concentration of 50 μg / ml) at a ratio of 1:100, and culture for 3 - 4 h (OD 600 At (0.6 - 0.8), add IPTG for induction (final concentration 0.8 mM), and culture at 37 °C and 180 rpm for 3 h. After the culture is completed, centrifuge at 8000 rpm and 4 °C for 10 min, and discard the supernatant. Resuspend the cell pellet in 20 mM TE buffer at a ratio of 1:30 (g / ml), and lyse the cells by sonication (120 W, 9 s, with a 9 s interval, for a total of 30 min). Centrifuge the lysed bacterial solution at 12000 rpm and 4 °C for 30 min, and retain the pellet. Take the pellet after cell lysis and centrifugation, and add inclusion body lysis solution at a ratio of 1:10 (g / ml). After complete dissolution (stir on ice bath for about 3 - 4 h), centrifuge at 10000 rpm and 4 °C for 40 min, and retain the supernatant. Take the supernatant and perform ultrafiltration using an ultrafiltration tube with a molecular weight cut-off of 100 kD, and collect the ultrafiltration permeate.

[0056] The affinity chromatography column is an EzFast Ni HP pre-packed column, the affinity chromatography medium is IMAC Bestarose FF, the column size is 16×25 (mm), and the column volume (CV) is 5 ml. It is equilibrated with affinity chromatography buffer A (500 mM NaCl, 20 mM Tris, 5 mM imidazole, pH 8.0) at an equilibration flow rate of 2.0 ml / min. After the UV and conductivity become stable, sample loading is carried out. The sample loading method is direct sample loading by pump, and the sample loading flow rate is 1.0 ml / min. After the sample loading is completed, first equilibrate with affinity chromatography buffer A at a flow rate of 2.0 ml / min. After the flow-through completely flows out and the conductivity and UV decrease steadily, the target peak is collected. Equilibrate with 8 M urea - affinity chromatography buffer A (8 M urea, 500 mM NaCl, 20 mM Tris, 5 mM imidazole, pH 8.0), remove impurities with 8 M urea - affinity chromatography buffer C containing 50 mM imidazole concentration, and elute with 8 M urea - affinity chromatography buffer C containing 75 mM imidazole concentration to obtain a target protein with relatively high purity, as Figure 1 shown. The purified protein is analyzed by SDS-PAGE, and the purity is 95%, and the molecular weight of the target protein is 60 kDa, as Figure 2 shown.

[0057] 2. Expression and purification of single antigen HpaA

[0058] The glycerol bacteria containing the pET-28b-HpaA / BL21(DE3) plasmid (the plasmid map is as Figure 14 shown) are added to 5 ml of LB liquid medium (containing kan concentration of 50 μg / ml) at a ratio of 1:1000 and cultured overnight. Then, the above bacterial solution is inoculated into 2 bottles of 1000 ml of LB liquid medium (containing kan concentration of 50 μg / ml) at a ratio of 1:100 respectively, and cultured for 3 - 4 h (OD 600 is between 0.6 and 0.8), IPTG is added for induction (final concentration 0.8 mM), and cultured at 37°C and 180 rpm for 3 h. After the culture is completed, centrifuge at 8000 rpm and 4°C for 10 min, and discard the supernatant. The obtained bacterial cell precipitate is resuspended in 20 mM TE buffer at a ratio of 1:30 (g / ml), sonicated (120 W, 9 s, interval 9 s, for a total of 30 min), and the sonicated bacterial solution is centrifuged at 12000 rpm and 4°C for 30 min, discard the precipitate, and retain the supernatant. Filter with a 0.22 μm filter membrane, and ultrafilter the sonicated supernatant with an ultrafiltration tube with a molecular weight cut-off of 100 kD, collect the permeate, and store it at 2 - 8°C for standby.

[0059] The affinity chromatography column is an EzFast Ni HP pre-packed column, the affinity chromatography medium is IMAC Bestarose FF, the column size is 16×25 (mm), and the column volume (CV) is 5 ml. It is equilibrated with Affinity Chromatography Solution A at an equilibration flow rate of 2.0 ml / min. After the UV and conductivity become stable, sample loading is carried out. The sample loading method is direct sample loading by pump, and the sample loading flow rate is 1.0 ml / min. After the sample loading is completed, first equilibrate with Affinity Chromatography Solution A at a flow rate of 2.0 ml / min. After the flow-through completely flows out and the conductivity and UV decrease steadily, collect the target peak. Equilibrate with Affinity Chromatography Solution A, remove impurities with Affinity Chromatography Solution C at a concentration of 100 mM imidazole, and elute with Affinity Chromatography Solution C at a concentration of 150 mM imidazole to obtain a target protein with relatively high purity, such as Figure 3 shown. The purified protein is analyzed by SDS-PAGE, and the purity is 100%, and the molecular weight of the target protein is 15 kDa, such as Figure 4 shown.

[0060] 3. Expression and purification of the fusion antigen UreB-HpaA

[0061] Add the glycerol bacteria containing the pET-28b-UreB-HpaA / BL21(DE3) plasmid (the plasmid map is as Figure 15 shown) to 5 ml of LB liquid medium (containing kan concentration of 50 μg / ml) at a ratio of 1:1000 and culture overnight. Then inoculate the above bacterial solution into 2 bottles of 1000 ml of LB liquid medium (containing kan concentration of 50 μg / ml) at a ratio of 1:100 respectively, and culture for 3 - 4 h (OD 600 is between 0.6 - 0.8), add IPTG for induction (final concentration 0.8 mM), and culture at 37 °C and 180 rpm for 3 h. After the culture is completed, centrifuge at 8000 rpm and 4 °C for 10 min, and discard the supernatant. Resuspend the bacterial cell pellet in 20 mM TE buffer at a ratio of 1:30 (g / ml), disrupt the bacteria by sonication (120 W, 9 s, interval 9 s, for a total of 30 min), centrifuge the disrupted bacterial solution at 12000 rpm and 4 °C for 30 min, and retain the pellet. Take the pellet after centrifugation of the disrupted bacteria, add inclusion body dissolution solution at a ratio of 1:10 (g / ml), and after complete dissolution (stir in an ice bath for about 3 - 4 h), centrifuge at 10000 rpm and 4 °C for 40 min, and retain the supernatant. Take the supernatant, perform ultrafiltration using an ultrafiltration tube with a molecular weight cut-off of 100 kD, collect the permeate, and store it at 2 - 8 °C for standby.

[0062] The affinity chromatography column is an EzFast Ni HP pre-packed column, the affinity chromatography medium is IMAC Bestarose FF, the column size is 16×25 (mm), and the column volume (CV) is 5 ml. It is equilibrated with Affinity Chromatography Solution A at a flow rate of 2.0 ml / min. After the UV and conductivity are stable, sample loading is carried out. The sample loading method is direct sample loading by pump, and the sample loading flow rate is 1.0 ml / min. After the sample loading is completed, first equilibrate with Affinity Chromatography Solution A at a flow rate of 2.0 ml / min. After the flow-through completely flows out and the conductivity and UV decrease steadily, the target peak is collected. It can be equilibrated with Affinity Chromatography Solution A (8M urea, 500 mM NaCl, 20 mM Tris, 5 mM imidazole, pH 8.0), the impurity removal is carried out with the Affinity Chromatography Eluent with a concentration of 25 mM imidazole (8M urea, 500 mM NaCl, 20 mM Tris, pH 8.0), and the elution is carried out with the Affinity Chromatography Eluent with a concentration of 100 mM imidazole (8M urea, 500 mM NaCl, 20 mM Tris, pH 8.0) to obtain a target protein with higher purity, such as Figure 5 shown. The purified protein is analyzed by SDS-PAGE, and the purity is 95%, and the molecular weight of the target protein is 30 kDa, as Figure 6 shown.

[0063] 4. Expression and purification of the cytokine fusion antigen UreB-HpaA-IFN-α

[0064] The glycerol bacteria containing the pET-28b-UreB-HpaA-IFN-α / BL21(DE3) plasmid (the plasmid map is as Figure 16 shown) were added to 5 ml of LB liquid medium (containing kan concentration of 50 μg / ml) at a ratio of 1:1000 and cultured overnight. Then, the above bacterial solution was inoculated into 2 bottles of 1000 ml of LB liquid medium (containing kan concentration of 50 μg / ml) at a ratio of 1:100 and cultured for 3 - 4 h (OD 600 was between 0.6 and 0.8), IPTG was added for induction (final concentration 0.8 mM), and cultured at 37°C and 180 rpm for 3 h. After the culture was completed, centrifuged at 8000 rpm and 4°C for 10 min, and the supernatant was discarded. The bacterial cell precipitate was resuspended in 20 mM TE buffer at a ratio of 1:30 (g / ml), and the bacteria were lysed by ultrasonic treatment (120 W, 9 s, interval 9 s, for a total of 30 min). The lysed bacterial solution was centrifuged at 12000 rpm and 4°C for 30 min, and the precipitate was retained. Take the precipitate after centrifugation of the lysed bacteria, add inclusion body dissolution solution at a ratio of 1:10 (g / ml), and after complete dissolution (stirring in an ice bath for about 3 - 4 h), centrifuge at 10000 rpm and 4°C for 40 min, and retain the supernatant. Take the supernatant, use an ultrafiltration tube with a molecular weight cut-off of 100 kD for ultrafiltration, collect the permeate, and store it at 2 - 8°C for standby.

[0065] The affinity chromatography column is an EzFast Ni HP pre-packed column, the affinity chromatography medium is IMAC Bestarose FF, the column size is 16×25 (mm), and the column volume (CV) is 5 ml. It is equilibrated with Affinity Chromatography Solution A at a flow rate of 2.0 ml / min. After the UV and conductivity are stable, sample loading is carried out. The sample loading method is direct sample loading by a pump, and the sample loading flow rate is 1.0 ml / min. After the sample loading is completed, first equilibrate with Affinity Chromatography Solution A at a flow rate of 2.0 ml / min. After the flow-through completely flows out and the conductivity and UV decrease steadily, the target peak is collected. It is equilibrated with Affinity Chromatography Solution A (8M urea, 500 mM NaCl, 20 mM Tris, 5 mM imidazole, pH 8.0), the impurities are removed with an affinity chromatography eluent with an imidazole concentration of 50 mM and 75 mM (8M urea, 500 mM NaCl, 50 mM Tris, pH 8.0), and eluted with an affinity chromatography eluent with an imidazole concentration of 150 mM (8M urea, 500 mM NaCl, 100 mM Tris, pH 8.0) to obtain a target protein with relatively high purity, such as Figure 7 shown. The purified protein was analyzed by SDS-PAGE, and the purity was 100%. The molecular weight of the target protein was 50 kDa, as Figure 8 shown.

[0066] Table 3 Purity of the target protein

[0067]

[0068]

[0069] Example 5 Analysis of the correlation between the recombinant protein and the native antigen protein

[0070] Taking the cytokine fusion antigen UreB-HpaA-IFN-α as an example (hereinafter referred to as the recombinant protein UHI), immune sera containing antigen specificity were harvested by immunizing Balb / c mice. The whole cell protein of Helicobacter pylori was used as the test sample, and the mouse immune serum was used as the detection antibody (primary antibody). The cross-reactivity between the recombinant protein UHI and the native protein was detected by Western blot and ELISA techniques to prove that the recombinant protein UHI has biological activities similar to those of the native protein.

[0071] 1. Detection of the cross-reactivity between the recombinant protein UHI and the native protein by ELISA

[0072] (1) Experimental procedures: Coating: Dilute the whole cell protein of Helicobacter pylori to 10 μg / ml with 1× coating buffer, add it to the ELISA plate, 100 μl per well, seal with sealing film, and place at 2 - 8°C overnight (16 - 18 h). Blocking: Take out the ELISA plate, wash the plate, 300 μl per well, wash 3 times, gently pat dry, then add 200 μl of blocking buffer per well, seal with sealing film, and incubate in a 37°C water bath for 2 h; Primary antibody incubation: Take out the ELISA plate, wash the plate 3 times, gently pat dry, then add the recombinant protein UHI-immunized mouse serum diluted 1:1000 to the ELISA plate, 100 μl per well, seal with sealing film, and incubate in a 37°C water bath for 2 h; Secondary antibody incubation: Take out the ELISA plate, wash the plate 3 times, gently pat dry, dilute the goat anti-mouse IgG-HRP 1000-fold with the blocking buffer and then add it to the ELISA plate, 100 μl per well, seal with sealing film, and incubate in a 37°C water bath for 1 h; Color development: Take out the ELISA plate, wash the plate 5 times, gently pat dry, add the TMB single-component color development solution, 100 μl per well, and develop color in a light-proof environment for 5 - 10 min; Termination: After color development, add the termination solution, 50 μl per well, to terminate the reaction; Reading: Put the ELISA plate into the microplate reader, use 630 nm wavelength as the reference wavelength, and read the absorbance value at 450 nm.

[0073] (2) Experimental design: Coat the 96-well plate with the natural protein of Helicobacter pylori as the capture antibody, use the recombinant protein UHI-immunized mouse serum as the primary antibody for ELISA detection, and use the PBS-immunized serum as the negative control for detection.

[0074] (3) Experimental results: The recombinant protein UHI-immunized mouse serum can bind to the natural protein of Helicobacter pylori, and there is a significant difference compared with the control group, indicating that the constructed recombinant protein UHI has a cross-reaction with Helicobacter pylori, as Figure 9 shown.

[0075] 2. Detection of the cross-reaction between recombinant protein UHI and natural protein by Western Blot

[0076] (1) Experimental procedures: Loading samples: Add 4×Protein Loading Buffer to the test sample, dilute the test sample to 1 μg / μl with appropriate purified water, and boil it in boiling water for 10 min. After natural cooling, load the sample. The loading volume of recombinant protein UHI is 15 μl and the loading amount is 15 μg; the loading volume of Helicobacter pylori native protein is 30 μl and the loading amount is 30 μg. Electrophoresis: The initial voltage is 80 V, and it is adjusted to 120 V when entering the separating gel. Stop electrophoresis when the bromophenol blue migrates to the bottom of the gel. Transferring membrane: After electrophoresis, take out the gel, cut off the edges of the gel, and immerse it in the transfer buffer for 5 min. Cut a PVDF membrane of appropriate size, treat it with methanol for 15 s, and transfer it to the transfer buffer for soaking for 5 min. On the transfer plate, arrange from the negative electrode to the positive electrode as No. 3 filter paper, SDS-PAGE gel, treated PVDF membrane, and No. 3 filter paper. Transfer the membrane at a constant current of 300 mA in an ice bath for 30 min. Blocking: Take out the PVDF membrane, wash it once in TBST buffer, place the PVDF membrane face down, and put it into a 5% skim milk blocking solution, and incubate at 25 °C for 2 h. Incubation with primary antibody: The primary antibody is the serum of mice immunized with recombinant protein UHI. After diluting the mouse serum 2000-fold with the blocking solution respectively, take out the PVDF membrane from the blocking solution and put it into the primary antibody, and incubate overnight at 2-8 °C. Incubation with secondary antibody: Take out the membrane from the primary antibody, wash it 3 times with TBST buffer, 8 min each time. Dilute goat anti-mouse IgG-HRP 1000-fold with the blocking solution, put the membrane into the diluted secondary antibody, and incubate at 25 °C for 1 h. Color development: Take out the membrane from the secondary antibody, wash it 3 times with TBST buffer, 8 min each time. Prepare the HRP-DAB substrate color development solution according to the kit instructions, mix well and put the above PVDF membrane into it, and gently shake it at room temperature for color development. Termination: After the band depth reaches the requirement, rinse it with purified water to terminate the reaction. Scan and photograph the PVDF membrane that has terminated the reaction with white light, and record the results.

[0077] (2) Experimental design: Use the whole cell protein of Helicobacter pylori as the protein to be tested for SDS-PAGE, and use the serum of mice immunized with recombinant protein UHI and the serum of mice immunized with PBS (negative control) as the primary antibody for Western Blot detection;

[0078] (3) Experimental results: The immune serum of recombinant protein UHI can bind to the whole cell protein of Helicobacter pylori, and there are significant differences compared with the control group, as Figure 10 shown.

[0079] 3. Experimental conclusion

[0080] This experiment was to detect whether the recombinant protein UHI has biological activities similar to those of the natural protein. The cross-reactivity between the recombinant protein UHI and the Helicobacter pylori natural protein was detected by ELISA and Western Blot. The experimental conclusions are as follows: The serum of mice immunized with the recombinant protein UHI can bind to the whole-cell proteins of Helicobacter pylori, indicating that the IgG antibodies in the serum obtained by immunizing with the recombinant protein UHI as a vaccine can specifically recognize the whole-cell proteins of Helicobacter pylori, and the recombinant protein UHI has biological activities similar to those of the natural protein.

[0081] Preparation of Adjuvant in Example 6

[0082] 1. Bacterial cell disruption: Take out 200 g of Mycobacterium bovis bacillus Calmette-Guérin (BCG) bacterial cells from the -20°C freezer, add the same weight of sterilized injection water and mix evenly at 1 g / ml, and then disrupt (disruption conditions: 9000 rpm, disrupt for 3 min, stop for 3 min, disrupt for 3 min, stop for 3 min, disrupt for 3 min).

[0083] 2. Bacterial cell centrifugation: After disruption, perform centrifugation. The centrifugation parameters are 12000 g, 40 min, 4°C (parameter range: 11000 - 12000 g, 35 - 40 min, 4°C). Discard the precipitate and retain the supernatant.

[0084] 3. Sterilization of the supernatant of the bacterial solution: Sterilize the supernatant at 121°C for 30 min and then aliquot and store to obtain the adjuvant.

[0085] Vaccine Evaluation in Example 7

[0086] 1. Vaccine preparation: Prepare vaccines by separately or jointly formulating the single antigen and the fusion antigen prepared in Example 4 with different types and concentrations of adjuvants (aluminum adjuvant or the adjuvant in Example 6). Taking the fusion antigen UreB-Hp aA-IFN-α + the adjuvant in Example 6 (high dose) as an example: Take 438 μl of PBS buffer, add 402 μl of the fusion antigen UreB-Hp aA-IFN-α (746 μg / ml) and 360 μl of the adjuvant in Example 6 (500 μg / ml), and mix evenly.

[0087] 2. Immunization process: The immunogenicity was evaluated by using an animal model of immunized mice (for cellular immunity, the number of cells secreting antigen-specific IFN-γ was detected by ELISpot, and for humoral immunity, the antibody level of serum IgG was detected by ELISA). Specifically, the vaccines were used to immunize Balb / c mice respectively by intramuscular injection, 3 injections, with a 7-day interval between each injection, and the immunization volume was 200 μl / mouse.

[0088] 3. Immunization method: Grasp the hind limb of one side of the mouse with the left hand, wipe and disinfect the outer thigh muscle area with 75% ethanol, hold the syringe at a 60° angle to the muscle with the right hand, quickly insert it into the muscle, and aspirate to ensure there is no backflow before injecting the drug solution. After injection, press the injection site with a dry cotton ball and then withdraw the needle. Inject 100 μl of the sample into each hind limb. Immunogenicity evaluation was performed 1 week after the last immunization.

[0089] 4. Detection of the number of antigen-specific IFN-γ secreting cell spots by ELISpot method

[0090] One week after the last immunization, the spleen of the mouse was taken to isolate lymphocytes, and the concentration of splenic lymphocytes was adjusted to 2.5×10 6 cells / ml. Add 100 μl of cells to each well, use recombinant protein UHI as the stimulator (50 μl / well), and ConA (50 μl / well) as the positive control. All stimulators were set up in duplicate wells. Then, incubate at 37°C in a 5% CO2 incubator for 18 h and then develop color. The number of IFN-γ secreting cell spots (SFC) was detected by the ELISpot method. The results are as Figure 11 shown.

[0091] 5. Detection of the antigen-specific IgG secretion level in serum by ELISA method

[0092] One week after the last immunization, the serum of the mouse was taken. After diluting the serum 1:1000, add 100 μl / well to a 96-well plate coated with recombinant antigen UreB-HpaA-IFN-α, and incubate at 37°C for 2 h; then incubate with the secondary antibody and develop color; use 630 nm wavelength as the reference wavelength and read the absorbance value (OD value) at 450 nm. The results are as Figure 12 shown.

[0093] The immunization grouping and immunization information of the experimental animals are shown in Table 4. The experimental results are shown in Table 5, Figure 11-12 as shown. The results show that the fusion antigen BCG-UreB-HpaA-IFN-α containing the adjuvant of Example 6 can significantly improve the cellular and humoral immune levels of the body compared with other groups.

[0094] Table 4 Immunization grouping and immunization information of experimental animals

[0095]

[0096]

[0097] Among them: AL: aluminum adjuvant; BCG: adjuvant of Example 6; UH: fusion antigen UreB-HpaA; UHI: cytokine fusion antigen UreB-HpaA-IFN-α.

[0098] Table 5 Immunization evaluation results

[0099]

[0100] The sequence information involved in the embodiments of the present invention is shown in Table 6.

[0101] Table 6 Sequence Information

[0102]

[0103]

[0104]

[0105] Sequence 2 (SEQ ID NO: 2): ATGAATTATCACCCCGCTTCAGAAAAAGTAC AAGCCCTCGACGAAAAAATCTTGTTGCTGCGTCCGGCGTTTCAGTATAGCGATAATATTGCTAAAGAGTATGAGAACAAATTCAAAAACCAAACGGCGCTGAAAGTCGAGCAGATCCTTCAGAATCAAGGTTACAAGGTGATCAGCGTTGATAGCTCGGATAAGGACGACTTCTCCTTTGCGCAGAAGAAGGAGGGCTACCTGGCAGTTGCTATGAACGGCGAAATTGTTTCTCGTCCAGATCCGAAGCGCACCATTCAGAAGAAAAGCGAACCGGGTCTGCTGTTCTCCACCGGTCTGGACAAGATGGAAGGCGTGCTGATTCCGGCGGGTTTTATCAAAGTG

[0106] Sequence 3 (SEQ ID NO: 3): ATGGATACACTAAATGAAGCTGGATGTGTAGAGGACACCATGGCAGCCATTGCGGGCCGCACCATGCACACCTTTCATACGGAAGGCGCTGGCGGTGGTCATGCACCGGATATTATCAAGGTCGCTGGCGAGCACAACATCTTACCGGCTTCCACCAATCCGACCATTCCGTTCACCGTAAATACCGAAGCAGAGCACATGGATATGCTGATGGTTTGCCATCACCTAGACAAGTCCATCAAAGAGGACGTTCAATTTGCGGACTCCCGCATTCGTCCACAGACGATCGCGGCTGAAGATACCCTGCACGATATGGGTATTTTCTCTATCACTTCAAGCGACTCCCAGGCAATGGGTCGTGTTGGTGAGGTTATTACCCGTACGTGGCAGACCGCGGATAAGAACAAGAAGGAGTTCGGCGGTGGCTCTGGTGGCGGCAGCAATTACCATCCGGCGAGCGAAAAAGTGCAAGCGCTGGACGAAAAAATCCTGTTGCTCCGCCCTGCGTTTCAGTATAGCGACAACATCGCCAAAGAGTATGAAAACAAATTCAAGAACCAAACTGCGCTGAAAGTGGAACAGATTTTGCAAAACCAGGGTTACAAAGTCATCAGCGTGGATAGCAGCGATAAGGACGACTTCTCGTTCGCCCAAAAAAAGGAGGGCTACCTGGCGGTTGCAATGAATGGTGAAATCGTGAGCCGTCCGGATCCGAAACGTACGATCCAGAAAAAGAGCGAGCCGGGTCTGCTGTTTTCTACCGGCTTGGACAAGATGGAAGGTGTTCTGATTCCGGCGGGTTTTATCAAGGTG

[0107]

[0108] The preferred embodiments of the present invention have been described in detail above. However, the present invention is not limited to the specific details in the above embodiments. Within the scope of the technical concept of the present invention, various simple modifications can be made to the technical solutions of the present invention, and these simple modifications all fall within the protection scope of the present invention.

Claims

1. A recombinant Helicobacter pylori vaccine, characterized in that, The recombinant Helicobacter pylori vaccine comprises a fusion antigen and an adjuvant; the fusion antigen is a fusion protein containing Helicobacter pylori antigen protein and an immune cytokine, the fusion antigen is a fusion protein of Helicobacter pylori urease B, Helicobacter pylori adhesin A protein and IFN-α, the fusion antigen is encoded by the nucleotide sequence shown in SEQ ID NO:4, and the adjuvant is the intracellular metabolite of Mycobacterium bovis BCG.

2. The recombinant Helicobacter pylori vaccine according to claim 1, characterized in that, The adjuvant is prepared by the following method: mixing Mycobacterium bovis BCG cells with water, breaking them, centrifuging to obtain the supernatant, and sterilizing.

3. The recombinant Helicobacter pylori vaccine according to claim 1, wherein The mass ratio of the fusion antigen to the adjuvant is 50 μg:10 - 30 μg.

4. A method for preparing the recombinant Helicobacter pylori vaccine according to claim 1, characterized in that, The preparation method includes: Constructing a recombinant vector containing the coding genes of Helicobacter pylori antigen protein and an immune cytokine, transferring the recombinant vector into a host bacterium for expression, and after purification, obtaining the fusion antigen; Mixing Mycobacterium bovis BCG cells with water, breaking them, centrifuging to obtain the supernatant, and after sterilization, obtaining the adjuvant; Mixing the fusion antigen and the adjuvant evenly to obtain the recombinant Helicobacter pylori vaccine.

5. The preparation method according to claim 4, characterized in that, The conditions for breaking include: first breaking at 7000 - 10000 rpm for 1 - 3 min, then stopping for 3 - 5 min, and repeating for more than 3 times.

6. The preparation method according to claim 4, characterized in that, The conditions for centrifuging include: 11000 - 12000 g, 35 - 40 min, 4 °C.

7. Use of the recombinant Helicobacter pylori vaccine according to any one of claims 1 to 3 in the preparation of a medicament for preventing or treating diseases caused by Helicobacter pylori.