Polypeptides that inhibit replication of herpes viruses and uses thereof

By designing a peptide that specifically binds to USP7-TRAF, the interaction between OTUD4 and USP7 was blocked, solving the problem of Kaposi's sarcoma virus (KSHV) lysis and replication, achieving effective inhibition of KSHV and MHV68, and providing a new antiviral treatment option.

CN118666954BActive Publication Date: 2026-05-12WUHAN UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202410684412.5
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-05-30
Publication Date
2026-05-12
Estimated Expiration
2044-05-30

AI Technical Summary

Technical Problem

Currently, there are no antiviral drugs targeting the lysis and replication of Kaposi's sarcoma virus (KSHV). Existing treatments mainly rely on immune-related therapies, and the virus can easily escape treatment with mutant peptide drugs. Blocking the key host protein complex that inhibits viral replication has become a new therapeutic target.

Method used

A polypeptide with the amino acid sequence VNQSASQSSN or YGRKKRRQRRRGGVNQSASQSSN was designed to bind to USP7-TRAF, inhibit the interaction between OTUD4 and USP7, reduce the stability of RTA protein, and thus inhibit KSHV cleavage, reactivation, and replication.

Benefits of technology

This peptide significantly reduces RTA protein levels and effectively inhibits the lysis and replication of KSHV and mouse herpesvirus MHV68, providing a new anti-KSHV treatment approach. It can also be used in combination with other drugs to enhance the therapeutic effect.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN118666954B_ABST
    Figure CN118666954B_ABST
Patent Text Reader

Abstract

The application discloses a polypeptide for inhibiting herpes virus replication and application thereof, and belongs to the field of biological medicine. The application screens a polypeptide which can specifically interfere with the interaction between OTUD4 and USP7, significantly reduce the RTA protein level, and inhibit the lysis replication of herpes virus, and the amino acid sequence of the polypeptide is VNQSASQSSN. The polypeptide containing the amino acid sequence can be used for preparing an anti-herpes virus drug or a drug for preventing and treating herpes virus infection, wherein the herpes virus is a gamma herpes virus, including KSHV and MHV68.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biomedicine, specifically relating to a polypeptide that inhibits the replication of herpesviruses and its applications. Background Technology

[0002] Herpesvirus infection is very common in the population, causing a variety of diseases, especially severe in immunocompromised individuals. Herpesviruses are divided into three subfamilies: α, β, and γ, with Kaposi's sarcoma virus (KSHV) belonging to the γ subfamily. Like other herpesviruses, KSHV's life cycle consists of a latent period and a lysis and replication period. When the virus initiates lysis and reactivates, a key viral protein, replication and transcription activator (RTA), is expressed. Subsequently, the RTA binds to the promoter of the viral gene, initiating the transcription and expression of a series of downstream genes, thus enabling the virus to fully enter a lysis and replication state. After KSHV infection, it can successfully evade detection by the human immune system and establish a long-term latent state. Latently infected cells initiate lysis and replication upon specific stimuli. KSHV infection and replication can lead to a variety of serious diseases, such as Kaposi's sarcoma (KS), primary exudative lymphoma (PEL), multivascular follicular lymphoproliferative disease (MCD), and KSHV-associated cytokine storm (KICS). These diseases are often more prevalent in HIV-infected and immunocompromised patients. Currently, treatment for KSHV-related diseases primarily focuses on immunotherapy, including CD20 antibody Rituximab, CD38 antibody Daratumumab, IL-6 antibody Siltuximab, IL-6R antibody Tocilizumab, as well as PD-1 and CTLA4 antibodies for HIV-positive patients. Since there are currently no antiviral drugs specifically targeting KSHV, developing a specific antiviral drug that targets KSHV viral replication is crucial. This drug could then be combined with immunotherapy to further enhance treatment efficacy.

[0003] Since the introduction of insulin nearly a century ago, more than 80 peptide drugs have been marketed, and research on novel peptide therapies has been steadily progressing. Currently, over 150 peptides are in clinical development, with another 400-600 undergoing preclinical studies. These are used to treat various diseases, including diabetes, cancer, osteoporosis, multiple sclerosis, HIV infection, and chronic pain. For treating viral infections, blocking the binding of viruses to host proteins using peptides is a promising approach. However, this can lead to a series of viral mutations that allow the virus to evade peptide drug treatment; therefore, blocking key host protein complexes that regulate viral replication can address this issue. The ubiquitin-proteasome system plays a crucial role in controlling target protein stability and regulating various cellular events, such as autophagy, DNA damage responses, antiviral innate immunity, and viral infection. In our previous study, we found that the deubiquitinase OTUD4 can bind to KSHV-RTA, promoting the deubiquitination and stabilization of RTA, thereby promoting KSHV cleavage and reactivation (Shaowei Wang et al., Non-canonical regulation of the reactivation of an oncogenic herpesvirus by the OTUD4-USP7 deubiquitinases, PLOS PATHOGENS, January 12, 2024). Interestingly, the deubiquitinase activity of OTUD4 is not important; instead, OTUD4 acts as an adaptor protein, recruiting another deubiquitinase, USP7, increasing the protein level of RTA and promoting KSHV cleavage and reactivation. This study reveals a novel mechanism by which KSHV utilizes the OTUD4-USP7 deubiquitinase to promote its own cleavage and reactivation, providing a new target for the development of novel antiviral therapies. Summary of the Invention

[0004] The purpose of this invention is to provide a polypeptide that inhibits the replication of herpesviruses and its application in the preparation of pharmaceuticals.

[0005] The objective of this invention is achieved through the following technical solution:

[0006] This invention provides a polypeptide for inhibiting herpesvirus replication, the amino acid sequence of which includes the sequence shown in SEQ ID NO.1. SEQ ID NO.1: VNQSASQSSN.

[0007] Furthermore, the amino acid sequence of the polypeptide that inhibits herpesvirus replication is shown in SEQ ID NO.2. SEQ ID NO.2: YGRKKRRQRRRGGVNQSASQSSN.

[0008] The ubiquitinase OTUD4 promotes the deubiquitination and stability of KSHV-RTA by recruiting USP7, thereby promoting KSHV cleavage and reactivation. The peptide can bind to USP7-TRAF, specifically inhibiting the interaction between OTUD4 and USP7, reducing the stability of RTA protein, and thus inhibiting herpesvirus cleavage and reactivation and cleavage replication.

[0009] This invention also provides the application of the above-mentioned peptide that inhibits herpesvirus replication in the preparation of antiherpesvirus drugs or drugs for the prevention and treatment of herpesvirus infection. The peptide that inhibits herpesvirus replication can be used alone as the sole active ingredient for antiviral therapy, or it can be used in combination with other drugs. The drug works by inhibiting the lysis and reactivation of herpesvirus and inhibiting the lysis and replication of herpesvirus.

[0010] The present invention also provides an antiherpes virus drug or a drug for preventing and treating herpes virus infection, which comprises the above-mentioned polypeptide that inhibits herpes virus replication, and may also comprise a pharmaceutically acceptable carrier or excipient.

[0011] The herpesviruses mentioned above are gamma herpesviruses, including Kaposi's sarcoma virus (KSHV) and mouse herpesvirus (MHV68).

[0012] Advantages and beneficial effects of this invention: This invention screened a polypeptide that can specifically interfere with the interaction between OTUD4 and USP7, significantly reduce RTA protein levels, and inhibit herpesvirus lysis and replication. This polypeptide can be used to prepare anti-herpesvirus drugs or drugs for the prevention and treatment of herpesvirus infection. This invention provides a new drug for the treatment of KSHV. Attached Figure Description

[0013] Figure 1 A is the design pattern diagram of the polypeptide;

[0014] Figure 1 B is the plasmon resonance diagram of the binding of USP7-TRAF and peptide #8.

[0015] Figure 2 A is a flow cytometry statistical graph showing that peptide #8 has KSHV inhibitory activity;

[0016] Figure 2 B is a dose-dependent flow cytometry statistical graph showing that peptide #8 inhibits KSHV cleavage and reactivation.

[0017] Figure 2 C represents peptide #8, which inhibits the IC50 of KSHV. 50 Flow cytometry analysis statistics.

[0018] Figure 3 A is a flow cytometry statistical graph of the key amino acids in peptide #8 that inhibit viral reactivation;

[0019] Figure 3 B is a genomic statistical diagram of viral supernatant inhibiting KSHV cleavage and reactivation by peptide #8;

[0020] Figure 3 C is a qPCR diagram of viral gene transcription in cells after polypeptide treatment;

[0021] Figure 3 D is an immunoblot image of viral protein expression in cells after polypeptide treatment.

[0022] Figure 4 A represents the viral titer of polypeptide #8, which can effectively inhibit the lysis and replication of mouse herpesvirus MHV68.

[0023] Figure 4 qPCR diagram showing that B-peptide #8 can effectively inhibit MHV68 virus genome transcription.

[0024] Figure 5 A is an immunoblot and flow cytometry statistical graph showing that the function of peptide #8 depends on OTUD4 and USP7.

[0025] Figure 5 B is a flow cytometry statistical graph showing that the function of peptide #8 depends on the interaction between OTUD4 and RTA.

[0026] Figure 6 A is an immunoblot image and a Coomassie brilliant blue staining image showing how polypeptide #8 can block the interaction between OTUD4 and USP7-TRAF in vitro.

[0027] Figure 6 B is an immunoblot image showing that polypeptide #8 can block the interaction between OTUD4 and USP7 in cells.

[0028] Figure 6 C represents polypeptide #8, which can block the immunoblotting of OTUD4 on elevated RTA protein levels.

[0029] Figure 6 D represents the immunofluorescence pattern showing that peptide #8 can inhibit the co-localization of OTUD4 and USP7. Detailed Implementation

[0030] The following embodiments are used to further illustrate the present invention, but should not be construed as limiting the present invention. For those skilled in the art, any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the scope of protection of the present invention.

[0031] Unless otherwise specified, the technical means used in the following embodiments are conventional means well known to those skilled in the art.

[0032] In the following examples, primers were synthesized by Sangon Biotech; peptides were synthesized by Qiangyao Biotechnology; CM5 chips were purchased from Cytiva; Phanta Max Super-Fidelity DNA Polymerase (catalog number: P505-d1) was purchased from Nanjing Novizan Biotechnology; DMEM high-glucose medium and trypsin cell digestion solution were purchased from Sigma-Aldrich; 100× penicillin-streptomycin solution was purchased from Gibco; Fugene HD was purchased from Promega; NheI, EcoRI, NotI, XhoI, and T4 ligases were all purchased from NEB; qPCR MIX was purchased from Mona Biotechnology; FLAG and β-Actin antibodies were purchased from Wuhan Dian Biotechnology; USP7, ORF45, ORF57, and K8α antibodies were purchased from Santa Cruz Biotechnology; OTUD4 antibody was purchased from Proteintech; reverse transcription kits were purchased from Beijing Adley Biotechnology Co., Ltd.; and PLA kits were purchased from Sigma-Aldrich.

[0033] Example 1

[0034] 1. Design and screening of peptides that can bind to the USP7-TRAF domain

[0035] (1) Peptide design strategy

[0036] Previous studies have shown that the host protein OTUD4 recruits USP7 to stabilize KSHV-RTA protein levels, promoting viral lysis and replication. Furthermore, the N-terminus of OTUD4 interacts with the USP7-TRAF domain (Shaowei Wang et al., Non-canonical regulation of the reactivation of an oncogenic herpesvirus by the OTUD4-USP7 deubiquitinases, PLOS PATHOGENS, January 12, 2024). Therefore, we plan to design a peptide molecule to disrupt the interaction between OTUD4 and USP7, thereby preventing OTUD4 from stabilizing the RTA protein and achieving an antiviral therapeutic effect. The peptide design schematic is shown below. Figure 1 As shown in Figure A.

[0037] (2) Screening for polypeptide molecules that can bind to the USP7-TRAF domain.

[0038] Studies have shown that USP7-TRAF binds to substrate proteins via the P / A / EXXS motif (where X represents any amino acid) (Robbert Q. Kim and Titia K. Sixma, Regulation of USP7: A High Incidence of E3 Complexes, J Mol Biol, 2017). Therefore, this invention designs a series of peptides (retaining 4 amino acids before and 2 amino acids after the conserved motif) based on the N-terminal sequence of OTUD4 with this motif, and uses plasmon resonance spectroscopy to detect protein-peptide binding with USP7-TRAF to identify candidate peptides. Specifically, BL21(DE3) bacteria containing GST-vector, GST-USP7-TRAF, and GST-USP7-UBL plasmids were transferred 1:100 to 100 mL of LB medium and cultured in a shaker at 37°C (construction of the relevant plasmids can be found in the literature: Shaowei Wang et al., Non-canonical regulation of the reactivation of an oncogenic herpesvirus by the OTUD4-USP7deubiquitinases, PLOS PATHOGENS, January 12, 2024), and cultured until OD 600 Once the concentration reached 0.6, IPTG was added to a final concentration of 0.5 mM and cultured overnight at 18°C ​​on a shaker to induce protein expression. The next day, bacteria were collected by centrifugation at 4°C and 8000 rpm for 10 minutes. The bacteria were resuspended in Triton X-100 lysis buffer containing a protease inhibitor, and the bacteria were sonicated to disrupt the cytokine balance. The bacterial suspension was observed to change from turbid to clear. Subsequently, the supernatant containing protein was collected by centrifugation at 4°C and 13000 rpm for 15 minutes. 200 μL of equilibrated Glutathione-Sepharose beads were added to the supernatant and the mixture was incubated at 4°C on a shaker for 3 hours for binding. After binding was complete, the beads bound to GST protein were collected by centrifugation at 4°C and 4000 rpm for 2 minutes. The precipitate was then washed three times with washing buffer, and finally, protein was eluted with elution buffer containing 10 mM reduced L-glutathione.

[0039] The purified GST-USP7-TRAF protein was then amino-coupled onto a CM5 chip. Peptide solutions of different concentration gradients were prepared and allowed to flow over the chip surface. BIAcore detected the signals to obtain the binding mode of the peptide and ligand, as well as the binding kinetic constants, thereby screening for candidate peptides with binding activity. Peptide synthesis information is shown in Table 1 below.

[0040] Table 1

[0041]

[0042]

[0043] The results showed that peptides #2, #5, #7, and #8 bound to USP7-TRAF (Data not shown), but only #8 showed the strongest binding. Figure 1 B).

[0044] 3. Screening for peptide molecules that inhibit KSHV cleavage and reactivation.

[0045] 1) Screening for peptides that inhibit KSHV cleavage and reactivation.

[0046] The transmembrane peptide TAT was added to the N-terminus of four candidate peptides to enable them to enter cells. A GG soft linker amino acid was added between the TAT and the peptide sequence. Subsequently, acetylation was added to the N-terminus and amidation was added to the C-terminus to mimic the natural peptides and improve their stability. Peptide synthesis information is shown in Table 2 below.

[0047] Table 2

[0048]

[0049] The cell line SLK.iBAC-GFP (construction of SLK.iBAC-GFP can be found in the literature: Shaowei Wang et al., Non-canonical regulation of the reactivation of an oncogenic herpesvirus by the OTUD4-USP7 deubiquitinases, PLOS PATHOGENS, January 12, 2024) was used for validation. This cell line contains the KSHV genome and has inserted expression of the DOX-induced RTA expression system and constitutively expressed GFP into the KSHV genome. Therefore, this cell line can be induced by DOX to initiate viral lysis and reactivate the virus, releasing viral particles. The addition of sodium butyrate can enhance the production and release of viral particles. Because it constitutively expresses green fluorescent protein, the virus produced by lysis replication in the cell culture supernatant can be collected, and the progeny virus titer can be quantified by flow cytometry after infecting HEK293T cells. Specifically, SLK.iBA-GFP cells were seeded in 12-well plates and, when the density reached 80%, pretreated with 100 μM TAT-peptide for 3 hours. Then, DOX (1 μg / mL) and sodium butyrate (0.5 mM) were added to induce KSHV lysis and reactivation. Finally, the supernatant containing viral particles was collected for titer determination. The specific steps are as follows: 100 μL of viral supernatant was used to infect HEK293T cells. After 24 hours, the cells were collected for flow cytometry analysis to detect the proportion of GFP-positive cells, and the number of progeny viral particles was further calculated. Finally, peptide molecules that can inhibit viral lysis and reactivation were screened.

[0050] The results are as follows Figure 2 As shown in A, peptide #8 can effectively inhibit KSHV cleavage and reactivation.

[0051] 2) Peptide #8 inhibits KSHV cleavage and reactivation in a dose-dependent manner.

[0052] SLK.iBA-GFP cells were seeded in 12-well plates and pretreated with 0 μM, 10 μM, 50 μM, and 100 μM peptide #8 for 3 hours. Then, DOX and sodium butyrate were added to induce KSHV lysis and reactivation. Finally, the supernatant containing viral particles was collected to infect HEK293T cells, and the progeny virus titer was detected by flow cytometry.

[0053] The results are as follows Figure 2 As shown in B, the inhibition of KSHV cleavage and reactivation by peptide #8 is dose-dependent.

[0054] 3) Detection of the IC50 value of peptide #8 in inhibiting KSHV cleavage and reactivation. 50

[0055] SLK.iBA-GFP cells were seeded in 12-well plates and allowed to reach 80% density. The cells were then pretreated with peptide #8 at concentration gradients of 0, 10, 20, 40, 80, 160, and 320 μM for 3 hours. DOX and sodium butyrate were then added to induce KSHV lysis and reactivation. Finally, the supernatant containing viral particles was collected to infect HEK293T cells, and the progeny virus titer was detected by flow cytometry.

[0056] The results are as follows Figure 2 As shown in C, peptide #8 inhibits the IC50 of KSHV cleavage and reactivation. 50 52.64-61.13 μM.

[0057] 4. Verify the key amino acids in the peptide that inhibit viral reactivation and further verify the inhibitory effect of peptide #8 on KSHV cleavage and reactivation.

[0058] 1) Verify the key amino acids in the peptide that inhibit viral reactivation.

[0059] The Ac-YGRKKRRQRRRGGVNQSASQSSN-NH2 sequence of peptide #8 was mutated to Ac-YGRKKRRQRRRGGVNQSASQASN-NH2, that is, the key amino acid S in the motif was mutated to A. SLK.iBA-GFP cells were seeded in 12-well plates, and after the cell density reached 80%, the cells were pretreated with 100 μM wild-type peptide and mutant peptide (#8m) for 3 hours. Then, DOX and sodium butyrate were added to induce KSHV lysis and reactivation. Finally, the supernatant containing viral particles was collected to infect HEK293T cells, and the progeny virus titer was detected by flow cytometry.

[0060] The results are as follows Figure 3 As shown in A, serine in the peptide is crucial for inhibiting KSHV cleavage and reactivation.

[0061] 2) Repeatedly validate the function of peptide #8 in KSHV naturally latent cells BCBL-1 cells.

[0062] First, stably expressing Tet-RTA cells (named BCBL-1Tet-RTA cells) were transfected into BCBL-1 cells, enabling them to better initiate KSHV lysis and replication through DOX-induced RTA expression (construction of BCBL-1Tet-RTA cells can be found in the literature: Xuezhang Tian et al., Genome-Wide CRISPR-Cas9 Screen Identifies SMCHD1 as a Restriction Factor for Herpesviruses, mBio, 2023). Cells were then pretreated with 100 μM peptide #8 and its mutant for 3 hours, followed by the addition of DOX and sodium butyrate to induce KSHV lysis and reactivation. Viral supernatant was collected after 48 hours to detect viral copy number. The specific steps are as follows: Collect 500 μL of viral supernatant and add DNase I (final concentration: 20 U / mL) and 5 μL each of 500 mM calcium chloride and 1 M magnesium chloride to activate DNase I. Treat at 37°C for 1 hour to degrade the non-shelled KSHV genome; add 30 μL of proteinase K (20 mg / mL) and 50 μL of 10% SDS to the reaction solution, mix well, and incubate at 65°C for 1 hour; add 600 μL of... Shake the sample with Tris-saturated phenol reagent for 20 seconds, centrifuge at 13200 rpm for 7 minutes at 44°C, and transfer 500 μL of the supernatant to a new EP tube. Repeat this step once. Add an equal volume of DNA extraction buffer (phenol:chloroform:isoamyl alcohol = 25:24:1), shake well for 20 seconds, centrifuge at 13200 rpm for 7 minutes at 4°C, and transfer the supernatant to a new EP tube. Transfer the upper aqueous phase, add 1 / 10 volume of 3M sodium acetate (pH = 5.2) and 2.5 volumes of anhydrous ethanol, mix well, and incubate at -20°C overnight to precipitate. The next day, remove the sample, centrifuge at 13200 rpm for 15 minutes at 4°C, discard the supernatant, wash the precipitate thoroughly once with 1 mL of 70% ethanol, centrifuge at 13200 rpm for 15 minutes at 4°C, discard the supernatant, air dry, and add 20 μL of... The precipitate was dissolved in TE buffer; the extracted DNA was diluted to 10 ng / μL to serve as a template, and primers targeting the FLAG-RTA gene sequence were selected. A standard curve was constructed using a series of diluted pEF-FLAG-RTA plasmids (construction of pEF-FLAG-RTA plasmid can be found in the literature: Shaowei Wang et al., Non-canonical regulation of the reactivation of an oncogenic herpesvirus by the OTUD4-USP7 deubiquitinases, PLOS PATHOGENS, January 12, 2024) as templates.The viral genome copy number is calculated by substituting the sample Cq value into the standard curve regression equation.

[0063] The qPCR reaction system is as follows:

[0064]

[0065] Forward primer: CGCAATGCGTTACGTTGTTG

[0066] Reverse primer: GCCCGGACTGTTGAATCG.

[0067] The results are as follows Figure 3 As shown in B, in BCBL-1Tet-RTA cells, peptide #8 can inhibit KSHV cleavage and reactivation, while its mutant #8m cannot.

[0068] 3) RT-qPCR verification of viral genome transcription after peptide treatment of BCBL-1

[0069] BCBL-1 cells were seeded in 12-well plates. When the cell density reached approximately 80%, the cells were pretreated with 100 μM peptide #8 and its mutant for 3 hours. DOX was then added to induce KSHV lysis and reactivation. After 48 hours of treatment, the cell pellet was collected and resuspended in 500 μL Trizol. The cells were lysed at room temperature for 10 min. 100 μL chloroform was added, and the mixture was vortexed and allowed to stand for 10 min. The cells were centrifuged at 12,000 g for 15 min, and 200 μL of the supernatant was transferred to a new 1.5 mL EP tube. 200 μL isopropanol was added, and the mixture was inverted and allowed to stand for 15 min. The cells were centrifuged at 12,000 g for 15 min to obtain the RNA pellet. The supernatant was discarded, and the pellet was rinsed with 500 μL 75% anhydrous ethanol. The pellet was centrifuged at 7500 g for 5 min. The RNA pellet was air-dried, dissolved in 20 μL DEPC water, and the RNA concentration was measured using Nanodrop. 1 μg of the RNA pellet was then taken. RNA was reverse transcribed to obtain cDNA; the obtained cDNA was diluted 20-fold, and viral gene expression was detected by RT-qPCR. Primers are shown in the table below:

[0070]

[0071] The RNA reverse transcription system is as follows:

[0072] Components Volume / mass RNA 1μg 5×TRUE RT MasterMix 4μL <![CDATA[H2O]]> To 20μL

[0073] The PCR instrument was programmed as follows: 25℃ for 10 min, 42℃ for 15 min, and 85℃ for 5 s.

[0074] qPCR reaction system:

[0075]

[0076] The results are as follows Figure 3 As shown in C: Peptide #8 can inhibit viral genome transcription, while #8m cannot.

[0077] 4) Immunoblotting verification showed that the peptide could inhibit viral protein expression.

[0078] BCBL-1Tet-RTA cells were seeded in 12-well plates. When the cell density reached approximately 80%, the cells were pretreated with 100 μM peptide #8 and its mutant for 3 hours. Then, DOX and sodium butyrate were added to induce KSHV lysis and reactivation. After 48 hours of treatment, the cell pellet was collected and lysed on ice for 10 min with 100 μL Triton X-100 lysis buffer. The cells were then centrifuged at 12000 rpm for 10 min. 80 μL of the supernatant was collected and 20 μL of 5×SDS-loading buffer was added. The cells were boiled at 95°C for 15 min. Electrophoresis was performed on 8% SDS-PAGE gels at 70V for 35 min and 130V for 1 hour. Wet transfer was performed at 100V for 60 min. After transfer, the membrane was blocked with 5% milk for 30 minutes and incubated overnight at 4°C on a shaker with proteins RTA, ORF57, K8α, and internal control antibody. The membrane was washed three times with TBST for 10 minutes each time. The membrane was incubated with secondary antibody at room temperature for 1 hour. The membrane was washed three times with TBST for 10 minutes each time and then developed with LICOR ODYSSEY.

[0079] The results are as follows Figure 3 As shown in D, polypeptide #8 can inhibit viral protein expression, while #8m cannot.

[0080] 5. The peptide can inhibit the lysis and replication of mouse herpesvirus MHV68.

[0081] 1) Mouse lung fibroblasts (MLF) were seeded in 12-well plates. When the cell density reached approximately 80%, the cells were pretreated with 100 μM peptide #8 and its mutant for 3 hours. Subsequently, the cells were infected with MHV68 virus at an MOI of 0.1. Viral supernatants were collected at 24, 48, and 72 hours for virus titer determination. Vero cells were seeded in 24-well plates. When the density reached 30%, serially diluted viral supernatants were added. After 3 hours, the medium was replaced with low-serum complete medium containing 1.5% methylcellulose (serum content 2%). After 5 days, the supernatant was discarded, and the cells were stained with crystal violet. Plaques were calculated to obtain the virus titer.

[0082] The results are as follows Figure 4 As shown in A, peptide #8 can inhibit MHV68 replication, while #8m cannot.

[0083] 2) RT-qPCR verification of MHV68 genome transcription after peptide treatment with MLF

[0084] MLF cells were seeded in 12-well plates. When the cell density reached approximately 80%, the cells were pretreated with 100 μM peptide #8 and its mutant for 3 hours. Subsequently, the cells were infected with MHV68 virus at an MOI of 0.1. After 48 hours, the cell pellet was collected, and the cells were resuspended in 500 μL Trizol and lysed at room temperature for 10 min. 100 μL chloroform was added, and the mixture was vortexed and allowed to stand for 10 min. The cells were then centrifuged at 12000g for 15 min, and 200 μL of the supernatant was transferred to a new 1.5 ml EP tube. 200 μL isopropanol was added, and the mixture was inverted and allowed to stand for 15 min. The cells were then centrifuged at 12000g for 15 min to obtain the RNA pellet. The supernatant was discarded, and the pellet was rinsed with 500 μL 75% anhydrous ethanol and centrifuged at 7500g for 5 min. The RNA pellet was air-dried, dissolved in 20 μL DEPC water, and the RNA concentration was measured using Nanodrop. 1 μg of the RNA pellet was then taken. RNA was reverse transcribed to obtain cDNA; the obtained cDNA was diluted 20-fold, and viral gene expression was detected by RT-qPCR. Primers are shown in the table below:

[0085]

[0086]

[0087] The RNA reverse transcription system is as follows:

[0088] Components Volume / mass RNA 1μg 5×TRUE RT MasterMix 4μL <![CDATA[H2O]]> To 20μL

[0089] The PCR instrument was programmed as follows: 25℃ for 10 min, 42℃ for 15 min, and 85℃ for 5 s.

[0090] qPCR reaction system:

[0091]

[0092] The results are as follows Figure 4 As shown in B: Polypeptide #8 can inhibit MHV68 virus genome transcription, while #8m cannot.

[0093] 6. Peptide #8 functions in dependence on the OTUD4-USP7-RTA complex.

[0094] 1) Knockdown of OTUD4 or USP7 resulted in peptide #8 losing its inhibitory effect on KSHV cleavage and reactivation.

[0095] Stable cell lines were established by infecting SLK.iBAC-GFP cells with shRNA-Control, shRNA-OTUD4, or shRNA-USP7 lentiviruses (Shaowei Wang et al., Non-canonical regulation of the reactivation of an oncogenic herpesvirus by the OTUD4-USP7 deubiquitinases, PLOS PATHOGENS, January 12, 2024). SLK.iBA-GFP cells were seeded in 12-well plates and pretreated with 100 μM peptide #8 and its mutant for 3 hours. DOX and sodium butyrate were then added to induce KSHV lysis and reactivation. After 48 hours, the supernatant containing viral particles was collected to infect HEK293T cells. The percentage of GFP-positive cells was quantified by flow cytometry, and the viral titer in the supernatant was calculated.

[0096] The results are as follows Figure 5 As shown in Figure A: When OTUD4 or USP7 is knocked down, peptide #8 loses its inhibition of KSHV cleavage reactivation.

[0097] 2) Peptide #8 inhibits KSHV cleavage and reactivation, which depends on OTUD4-RTA interaction.

[0098] Previous results indicated that OTUD4 can bind to the last three amino acids of RTA, specifically the FRD (Shaowei Wang et al., Non-canonical regulation of the reactivation of an oncogenic herpesvirus by the OTUD4-USP7 deubiquitinases, PLOS PATHOGENS, January 12, 2024). Mutating the last three amino acids of RTA to AAA (i.e., RTA-3A) results in the loss of interaction with OTUD4. SLK.iBAC-GFP RTA-WT cells and SLK.iBAC-GFP RTA-3A cells were seeded in 12-well plates (Shaowei Wang et al., Non-canonical regulation of the reactivation of an oncogenic herpesvirus by the OTUD4-USP7 deubiquitinases, PLOS PATHOGENS, January 12, 2024). In these cells, OTUD4 loses binding to RTA. After reaching a density of 80%, cells were pretreated with 100 μM peptide #8 and its mutant for 3 hours, respectively. DOX and sodium butyrate were then added to induce KSHV lysis and reactivation. Forty-eight hours later, the viral supernatant was collected to infect HEK293T cells. The percentage of GFP-positive cells was quantified by flow cytometry, and the viral titer in the supernatant was calculated.

[0099] The results are as follows Figure 5 As shown in B: Peptide #8 inhibits KSHV cleavage and reactivation in a manner dependent on the binding of OTUD4-RTA.

[0100] 7. Peptide #8 can block the interaction between OTUD4 and USP7-TRAF, thereby reducing RTA protein levels.

[0101] 1) Seed HEK293T cells in 10 cm dishes. When the cell density reaches 70%, transfect with 10 μg of FLAG-OTUD4 plasmid. After 24 hours, lyse the cells with NP-40 lysis buffer and centrifuge at 12000 rpm for 10 minutes to obtain cell lysate containing FLAG-OTUD4 protein. Add 20 μg of purified GST-USP7-TRAF protein to the supernatant, followed by 100 μM of peptide #8 or its mutant. Incubate at 4°C on a shaker for 3 hours. Then enrich GST protein with glutathione beads. Finally, detect OTUD4 protein using Western blotting.

[0102] The results are as follows Figure 6As shown in Figure A: Peptide #8 can effectively prevent the binding of OTUD4 to USP7-TRAF, while mutant #8m cannot.

[0103] 2) Treatment with peptide #8 decreased RTA protein levels.

[0104] The expression of RTA was validated using the iSLK cell line, which contains a DOX-induced RTA expression system (iSLK cell construction is described in the literature: Shaowei Wang et al., Non-canonical regulation of the reactivation of an oncogenic herpesvirus by the OTUD4-USP7 deubiquitinases, PLOS PATHOGENS, January 12, 2024). iSLK cells were seeded in 12-well plates and, when the cell density reached 80%, pretreated with 100 μM peptide #8 and its mutant for 3 hours, followed by DOX induction of RTA expression. After 24 hours, the cell pellet was collected, lysed with Triton X-100, and then Western blotting was performed to detect RTA protein levels.

[0105] The results are as follows Figure 6 As shown in B: Peptide #8 can effectively reduce RTA protein levels, while mutant #8m cannot.

[0106] 3) Peptide #8 can prevent OTUD4 from stabilizing RTA protein levels.

[0107] HEK293T cells were seeded in 6-well plates and pretreated with 100 μM peptide #8 and its mutant for 3 hours. Then, the cells were transfected with HA-RTA and FLAG-OTUD4 plasmids (construction of HA-RTA and FLAG-OTUD4 plasmids can be found in the literature: Shaowei Wang et al., Non-canonical regulation of the reactivation of anoncogenic herpesvirus by the OTUD4-USP7 deubiquitinases, PLOS PATHOGENS, January 12, 2024). 24 hours after transfection, the cell pellet was collected for Western blotting to detect RTA protein levels.

[0108] The results are as follows Figure 6 As shown in C: Peptide #8 can prevent OTUD4 from stabilizing RTA protein levels, while mutant #8m cannot.

[0109] 4) Peptide #8 can prevent OTUD4 and USP7 from co-localizing.

[0110] SLK.iBAC-GFP pHAGE-OTUD4 cells were seeded in 12-well plates (cell line construction literature: Shaowei Wang et al., Non-canonical regulation of the reactivation of an oncogenic herpesvirus by the OTUD4-USP7 deubiquitinases, PLOS PATHOGENS, January 12, 2024). The cells were induced with DOX (1 μg / mL) for 24 hours the following day, followed by PLA experiments. The specific steps are as follows:

[0111] Closed:

[0112] 1. Vortex Duolink sealing fluid.

[0113] 2. Add 1 drop (~40 μL) of Duolink blocking solution to each 1 cm² sample. Ensure the blocking solution covers the entire sample.

[0114] 3. Place the glass slide in a heating and humidity chamber and incubate at 37°C for 60 minutes.

[0115] 4. Vortex Duolink antibody diluent.

[0116] 5. Dilute FLAG Rabbit antibody (1:500) and USP7 Mouse antibody (1:50) in Duolink antibody diluent.

[0117] 6. Tap the Duolink sealing solution off the slide.

[0118] 7. Add the primary antibody solution to each sample.

[0119] 8. Place the slide in a humidity chamber overnight to incubate the primary antibody.

[0120] Incubation of Duolink PLA probes:

[0121] 9. Vortex Plus and Minis PLA probes.

[0122] 10. Dilute the PLUS and MINUS PLA probes 1:5 in Duolink antibody diluent. For a 40 μL reaction, take 8 μL of PLA probe MINUS stock solution, 8 μL of PLA probe PLUS stock solution, and 24 μL of antibody diluent. Prepare sufficient solutions for all samples.

[0123] 11. Remove the primary antibody solution from the slide.

[0124] 12. Wash the slides 2x5 minutes in 1x washing buffer A at room temperature.

[0125] 13. Remove excess washing buffer, then drop the PLA probe solution onto the slide.

[0126] 14. Place the slide in a preheated humidity chamber at 37°C and incubate for 1 hour.

[0127] connect:

[0128] Note: The ligase should be added immediately when it is needed to be added to the sample. Ensure the ligation buffer is completely thawed and thoroughly mixed before use.

[0129] 15. Dilute the 5x Duolink ligation buffer 1:5 with high-purity pure water and mix. For a 40 μL reaction, add 8 μL of 5x ligation buffer to 32 μL of high-purity pure water. Prepare sufficient solutions for all samples.

[0130] 16. Remove the PLA probe solution from the glass slide.

[0131] 17. Wash the slides 2x5 minutes in 1x washing buffer A at room temperature.

[0132] 18. Add the ligase to the 1x ligation buffer at a 1:40 dilution and mix. For a 40 μL ligation solution, add 1 μL of ligase to 39 μL of 1x ligation buffer.

[0133] 19. Remove excess wash buffer, then add ligation solution, and place the slide in a preheated humidity chamber at 37°C.

[0134] Incubate for 30 minutes.

[0135] Amplification:

[0136] Note: Polymerase should be added immediately before adding it to the sample. Amplification buffer is light-sensitive. Avoid exposing any solutions containing amplification buffer to light.

[0137] 20. Dilute the 5x amplification buffer 1:5 with pure water and mix. For a 40 μL reaction, add 8 μL of 5x amplification buffer to 32 μL of pure water. Prepare sufficient solutions for all samples.

[0138] 21. Remove the bonding solution from the glass slide.

[0139] 22. Wash the slides 2x for 5 minutes in 1x washing buffer A at room temperature.

[0140] 23. Add the polymerase to the 1x amplification buffer at a dilution of 1:80 and mix.

[0141] 24. Remove excess washing buffer, then apply amplification solution.

[0142] 25. Place the slide in a preheated humidity chamber at 37°C and incubate for 100 minutes.

[0143] Final wash:

[0144] Note: This is a photosensitive reagent. Always store the slide away from light.

[0145] 26. Wash the slides for 2 x 10 minutes in 1x wash buffer B at room temperature.

[0146] 27. Wash the slide in 0.01x washing buffer B for 1 minute.

[0147] Preparing for imaging:

[0148] Note: Duolink in-situ sealing agent containing DAPI is water-based and will not solidify. You can use clear nail polish to seal the edges of the coverslip to the slide. Avoid trapping air bubbles under the coverslip.

[0149] 28. Remove excess washing buffer from the slide.

[0150] 29. Use the smallest volume of DAPI-containing Duolink in situ mounting medium to cover the slide with a coverslip.

[0151] 30. Wait 15 minutes, then analyze in a confocal microscope using a 63x oil immersion microscope.

[0152] The results are as follows Figure 6 As shown in Figure D: After treatment with peptide #8, the amount of fluorescence decreased, indicating that peptide #8 can inhibit the co-localization of OTUD4 and USP7.

Claims

1. A polypeptide that inhibits herpesvirus replication, characterized in that: The amino acid sequence of the polypeptide is the sequence shown in SEQ ID NO.

1.

2. A polypeptide that inhibits herpesvirus replication, characterized in that: The amino acid sequence of the polypeptide is shown in SEQ ID NO.

2.

3. The use of the polypeptide according to claim 1 or 2 in the preparation of an antiherpesvirus drug, characterized in that: The herpesvirus mentioned is either Kaposi's sarcoma virus or mouse herpesvirus.

4. An anti-herpesvirus drug, characterized in that: It contains the polypeptide as described in claim 1 or 2.

5. The drug according to claim 4, characterized in that: It also contains pharmaceutically acceptable carriers or excipients.

6. The drug according to claim 4 or 5, characterized in that: The herpesvirus mentioned is either Kaposi's sarcoma virus or mouse herpesvirus.