Application of rice osbhlh004 protein or its coding gene in regulating seed dormancy of plants
By overexpressing and knocking out the rice OsbHLH004 protein, seed dormancy was regulated, solving the problem of panicle germination in rice seeds under high temperature and humidity conditions, improving seed germination rate and vigor, and promoting the breeding of new rice varieties.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- ZHEJIANG UNIV
- Filing Date
- 2023-06-20
- Publication Date
- 2026-04-17
AI Technical Summary
Rice seeds are prone to panicle sprouting under high temperature and humidity conditions, which leads to loss of seed viability and affects grain yield and quality. The current technology does not clearly define the dormancy regulation mechanism of rice seeds and lacks effective molecular regulation methods.
By constructing overexpression vectors and gene mutants of rice OsbHLH004 protein, the expression level of OsbHLH004 protein was regulated to control seed dormancy. This included overexpression and gene knockout methods to regulate seed germination rate and dormancy.
It can effectively regulate seed dormancy, reduce panicle sprouting, improve seed germination rate and vigor, and promote the breeding of new rice varieties resistant to panicle sprouting.
Smart Images

Figure CN118666978B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biotechnology, and more specifically, to the application of rice OsbHLH004 protein or its encoding gene in regulating plant seed dormancy. Background Technology
[0002] Rice, as one of the world's most important food crops, provides food for nearly 2 billion people worldwide. A prominent issue in rice production is maintaining excellent seed germination capacity, which is related to seed dormancy. Seed dormancy develops during seed maturation and is released through hydration after maturity or at specific temperatures. High seed dormancy is an undesirable trait in agricultural production; therefore, variations with medium to low seed dormancy are preferred to ensure rapid and uniform germination after planting (Nee et al., 2017). However, low-dormant rice seeds can experience preharvest germination (PHS), or panicle germination, under high temperature and humidity conditions, leading to loss of seed viability, reduced grain yield and quality, and significant economic losses in many parts of the world (Liu et al., 2013). Panicle germination occurs to varying degrees in most rice-producing areas and during hybrid rice seed production in China (Fang et al., 2008). The annual prevalence of rice panicle breakout in China is approximately 2%–5%, which can rise to 7%–50% if there is heavy rainfall during the harvest season (Zhou et al., 2011). Insufficient seed dormancy is the primary cause of panicle breakout. Therefore, studying the molecular mechanisms and regulation of seed dormancy is of significant practical importance for agricultural production. Furthermore, seed dormancy is a classic theme in plant science research, playing a crucial role in species propagation and preservation. Research on seed dormancy can further reveal the common molecular regulatory mechanisms in plant development, which is of great scientific significance. Identifying the key factors regulating rice seed dormancy and elucidating the molecular regulatory mechanisms within it has important theoretical and practical implications for enhancing our understanding of panicle breakout and promoting the breeding of new rice varieties resistant to panicle breakout.
[0003] One of the core events in regulating growth and development and responding to changes in the external environment in higher plants is the binding of various transcription factors to the promoter regions of target genes, activating or inhibiting target gene expression. Basic / helix-loop-helix (bHLH) transcription factors are a class of important transcription factors with basic / helix-loop-helix structures, widely distributed in eukaryotes, and named for their bHLH domains. The bHLH domain consists of an amino-terminal DNA-binding domain (E-box) and a carboxyl-terminal HLH domain, the latter promoting the formation of homodimers or heterodimers. Therefore, bHLH transcription factors typically function in a dimer form. Currently, approximately 140 and 160 bHLH transcription factors have been identified in the model plants Arabidopsis and rice, respectively. These bHLH transcription factors are widely involved in multiple biological processes, including plant growth and development, stress response, and signal transduction (Jakoby et al., 2002; Nijhawan et al., 2008; Sun et al., 2011). There are also a few reports on the involvement of bHLH transcription factors in seed germination, such as the delayed seed germination of the Osbhlh035 mutant under salt stress; simultaneously, the expression of ABA biosynthetic genes OsABA2 and OsAAO3 is upregulated, while the expression of the ABA decomposition gene OsABA8ox1 is downregulated (Chen et al., 2018). The bHLH transcription factor SPATULA is a photostable seed germination inhibitor and mediates the temperature response of seed germination; in addition, SPT is essential for the inhibition of GA3ox transcription in dormant seeds (Penfield et al., 2005). In Arabidopsis thaliana, the bHLH protein PIL5 (PIF3-like 5PIF1 / bHLH15), which interacts with phytochromes, is a seed germination inhibitor, exerting its effect by reducing GA levels in the dark (Eunkyoo et al., 2006). While the involvement of bHLH transcription factors in seed dormancy has been rarely reported, bHLH57 in Arabidopsis positively regulates seed dormancy by modulating the expression of NCED6 and NCED9 (Liu et al., 2010). However, the function and molecular mechanism of bHLH in seed dormancy in rice remain unknown to date. Therefore, we selected rice, an economically important crop, and explored more genes involved in rice dormancy regulation by creating gene-edited mutants and overexpression lines.
[0004] In view of this, the present invention is proposed. Summary of the Invention
[0005] The problem addressed by this invention is to provide the application of rice OsbHLH004 protein or its encoding gene in regulating plant seed dormancy and a method for breeding transgenic rice resistant to pre-sprouting. This invention provides a theoretical basis and implementation approach for exploring key factors regulating seed dormancy, revealing the molecular regulatory mechanism of plant seed dormancy, and breeding new rice varieties resistant to pre-sprouting.
[0006] The technical solution provided by this invention is as follows:
[0007] In one aspect, the present invention provides the application of rice OsbHLH004 protein or its encoding gene in regulating plant seed dormancy, the amino acid sequence of said rice OsbHLH004 protein being shown in SEQ ID No. 2.
[0008] This invention constructed an overexpression vector for rice OsbHLH004 and an OsbHLH004 gene mutant, and obtained positive overexpression lines and positive mutant lines. Through functional identification, it was found that the seed dormancy of the rice OsbHLH004 mutant lines was prolonged and the seed germination rate was slower than that of the wild type, while the seed germination rate of different overexpression lines was faster than that of the wild type. Moreover, the degree of increase in germination rate of overexpression lines was closely related to the upregulation level of OsbHLH004 transcription, indicating that OsbHLH004 negatively regulates seed dormancy.
[0009] In this invention, "rice OsbHLH004 protein" encompasses fusion proteins obtained by attaching tags to the N-terminus and / or C-terminus of the protein shown in SEQ ID No. 2, as well as proteins with the same function obtained by substituting and / or deleting and / or adding one or more amino acid residues of the amino acid sequence shown in SEQ ID No. 2.
[0010] In one embodiment, the nucleotide sequence of the gene encoding the rice OsbHLH004 protein is shown in SEQ ID No. 1.
[0011] The present invention covers sequences that have 90% or more, preferably 95% or more, and more preferably 99% or more similarity to the nucleotide sequence shown in SEQ ID No. 1 and have the same function.
[0012] In one embodiment, the rice OsbHLH004 protein is a mutant rice OsbHLH004 protein, and the amino acid sequence of the mutant protein is shown in any one of SEQ ID No. 7-SEQ ID No. 10. This invention provides the application of the OsbHLH004 mutant in regulating plant seed dormancy. Specifically, the mutants involve mutations at target sequences, namely positions 85-107 and 316-338 of the OsbHLH004 gene CDS sequence. All four mutants shown in SEQ ID No. 7-SEQ ID No. 10 result in frameshift mutations in the encoded protein.
[0013] In one embodiment, the nucleotide sequence of the mutant protein is shown in any one of SEQ ID No. 3-SEQ ID No. 6.
[0014] In another aspect, the present invention provides the application of biomaterials containing a gene encoding the rice OsbHLH004 protein in regulating plant seed dormancy, wherein the biomaterials comprise any one of the following:
[0015] (A) An expression cassette containing a nucleic acid molecule having a nucleotide sequence as shown in any one of SEQ ID No. 1, SEQ ID No. 3-SEQ ID No. 6;
[0016] (B) A recombinant vector containing the expression cassette described in (A);
[0017] (C) Recombinant microorganisms containing the expression cassette described in (A) or the recombinant vector described in (B);
[0018] (D) Recombinant cells containing the expression cassette described in (A) or the recombinant vector described in (B).
[0019] In one embodiment, the expression vector is an overexpression vector or a mutant expression vector.
[0020] In one implementation, the recombinant expression vector contains a transcripton that initiates transcription of the target gene. In particular, to achieve overexpression of the target gene, the promoters contained in the recombinant expression vector include, but are not limited to: constitutive promoters; tissue-, organ-, and development-specific promoters; and inducible promoters.
[0021] In a preferred embodiment, the overexpression vector contains a Ubiquitin promoter or a CaMV 35S promoter; the nucleic acid molecule of the target gene is operatively linked to the promoter.
[0022] In one embodiment, the regulation of plant seed dormancy includes regulating plant seed dormancy and / or seed germination by modulating the activity or expression level of the OsbHLH004 protein or its encoding gene in the plant.
[0023] In one embodiment, the microorganism is Agrobacterium, preferably Agrobacterium EHA105.
[0024] In one embodiment, regulating the activity or expression level of the OsbHLH004 protein or its encoding gene in plants includes:
[0025] Upregulating the activity or expression level of the OsbHLH004 protein or its encoding gene can reduce seed dormancy or promote germination, while downregulating the activity or expression level of the OsbHLH004 protein or its encoding gene can increase seed dormancy or reduce germination.
[0026] In one embodiment, the plant is a monocotyledonous or dicotyledonous plant, including but not limited to Arabidopsis thaliana, rice, rapeseed, etc.; preferably, the plant includes rice, and more preferably, the plant is Nipponbare rice.
[0027] In another aspect, the present invention provides a method for breeding transgenic rice resistant to pre-harvest sprouting, comprising knocking out or silencing the OsbHLH004 gene or inhibiting the activity of the OsbHLH004 protein in the plant to obtain transgenic plants with a seed germination rate lower than that of wild-type plants.
[0028] In one embodiment, the transgenic plant includes seeds, callus tissue, intact plants, and cells. The transgenic plant includes not only first-generation transgenic plants obtained by transforming the target plant with the gene, but also its progeny.
[0029] In one embodiment, gene editing is performed using a CRISPR system to knock out the OsbHLH004 gene; the nucleotide sequence of the sgRNA used in the gene editing is shown in SEQ ID No. 15 or SEQ ID No. 16.
[0030] The beneficial effects of this invention are:
[0031] This invention is the first to demonstrate the important role of the OsbHLH004 gene in regulating seed dormancy in plants. Inactivation of the rice OsbHLH004 protein or knockout of its encoding gene significantly reduces seed germination rate, enhances seed dormancy, and reduces germination, making it suitable for breeding transgenic rice resistant to panicle sprouting. Attached Figure Description
[0032] Figure 1 The amino acid sequence comparison results of the protein encoded by the rice gene OsbHLH004 and the protein encoded by the OsbHLH035 gene provided for this invention.
[0033] Figure 2 This is a schematic diagram of the rice gene OsbHLH004 gene editing site provided by the present invention;
[0034] Figure 3 The expression level of OsbHLH004 in different overexpression lines of rice provided by this invention;
[0035] Figure 4 The germination rate of rice OsbHLH004 overexpression lines provided by this invention after 5 days of water absorption;
[0036] Figure 5Germination phenotypes of wild-type rice, Osbhlh004 mutant, and Osbhlh004-1gOsbHLH004-4HA#6 provided by this invention after 30 days (DAP) and 5 days of water absorption;
[0037] Figure 6 This invention provides the germination time process of fresh seeds collected under different genetic backgrounds. Detailed Implementation
[0038] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Unless otherwise specified, the following embodiments and features can be combined with each other.
[0039] The detailed description of the embodiments of the present invention provided below is not intended to limit the scope of the claimed invention, but merely to illustrate selected embodiments of the invention. All other embodiments obtained by those skilled in the art based on the embodiments of the present invention without inventive effort are within the scope of protection of the present invention.
[0040] Currently, many seeds dormancy-related genes in rice have not yet been discovered. Research articles on the involvement of bHLH transcription factors in rice seed dormancy regulation are relatively few. Discovering and validating more genes involved in plant seed dormancy regulation is of great significance for crop breeding and yield improvement. The protein encoded by the OsbHLH035 gene, which has been reported previously, shares 12.31% homology with the OsbHLH004 gene provided in this invention. Figure 1 The results of amino acid sequence comparison between the proteins encoded by the OsbHLH035 gene and the OsbHLH004 gene are presented. Figure 1 It can be seen that the protein encoded by the OsbHLH004 gene (nucleotide sequence shown in SEQ ID No. 1) provided by this invention has very low homology with the proteins encoded by genes that have been reported so far. There are no literature reports on the function of OsbHLH004 protein or its encoding gene in regulating rice seed dormancy.
[0041]
[0042] In one embodiment, upregulating the activity or expression level of the OsbHLH004 protein or its encoding gene can reduce seed dormancy or promote germination. OsbHLH004 overexpression lines all germinated faster than the wild type.
[0043] In one embodiment, a nucleic acid molecule encoding the OsbHLH004 protein is introduced into a starting plant to obtain a transgenic plant. Compared with the starting plant, the transgenic plant has earlier seed germination and / or seed dormancy is broken, resulting in a higher germination rate.
[0044] In one embodiment, gene expression of the OsbHLH004 protein is suppressed to obtain a transgenic plant; compared with the original plant, the transgenic plant has delayed seed germination and / or prolonged seed dormancy, resulting in a reduced germination rate.
[0045] In one specific embodiment, the expression of the gene encoding the OsbHLH004 protein in the target plant can be suppressed by conventional methods in the art, such as editing, interfering with or knocking out the OsbHLH004 gene using the CRISPR / Cas9 system to disrupt its biological function.
[0046] In one specific embodiment, a mutant vector pCAMBIA1300-CAS9-Os-OsbHLH004 was constructed to obtain a psgR-CAS9-OsbHLH004 plasmid vector containing the OsbHLH004 specific target.
[0047] In one specific embodiment, the nucleotide sequences of the sgRNAs used for gene editing are sgRNA-1 (GAAGATCTGTGGCTTCAGGC, SEQ ID No. 15) and sgRNA-2 (AACCCGTACAAGAGATCAGG, SEQ ID No. 16).
[0048] The rice OsbHLH004 protein or its encoding gene of this invention can be used to regulate the germination time of plant seeds, for example, to promote or delay seed germination. Alternatively, the rice OsbHLH004 protein or its encoding gene can be used to regulate seed dormancy, for example, to break or prolong seed dormancy. This gene or protein has important applications in breeding new transgenic plant varieties resistant to pre-harvest sprouting and in ensuring seed storage safety.
[0049] Definitions of terms involved in this invention
[0050] The term “nucleotide” or “polynucleotide” refers to deoxyribonucleotides, deoxyribonucleosides, ribonucleosides or ribonucleotides and their polymers in single-stranded or double-stranded form.
[0051] The terms "identity" or "similarity" refer to sequence similarity to a natural nucleic acid sequence. Identity or similarity can be evaluated using computer software. Using computer software, the identity between two or more sequences can be expressed as a percentage (%), which can be used to evaluate the identity between related sequences.
[0052] The term "expression" or "gene expression" refers to the transcription of a specific gene or multiple specific genes or specific gene constructs into structural RNA (rRNA, tRNA) or mRNA, which is subsequently translated or not translated into protein. This process includes the transcription of DNA and the processing of the resulting mRNA product.
[0053] The terms "enhanced expression / overexpression" and "overexpression" refer to any form of expression that is enhanced relative to the original wild-type expression level. Methods for enhancing the expression of genes or gene products have been described in the art, and these methods include, for example, overexpression driven by a suitable promoter, the use of transcriptional enhancers, or translational enhancers.
[0054] The terms “increase,” “improve,” or “increase” are interchangeable and, in their application, should mean at least 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, or more of yield and / or growth and / or change compared to a control plant. The terms “decrease,” “decrease,” or “reduction” are interchangeable and, in their application, should mean at least 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, or 20% less of yield and / or growth and / or change compared to a control plant.
[0055] The term "transformation" refers to the method of introducing a heterologous DNA sequence or a vector containing a DNA sequence into a host cell or organism. The term "recombinant expression vector" refers to one or more DNA vectors used to achieve plant transformation; these vectors are often referred to in the art as binary vectors.
[0056] Example 1. Cloning of OsbHLH004
[0057] RNA was extracted using an Easto DNA kit.
[0058] First-strand cDNA was synthesized using 1 μg RNA as a template, following the instructions of the cDNA synthesis kit (Yeasen).
[0059] The complete ORF of OsbHLH004 was obtained from the website (http: / / rice.plantbiology.msu.edu / expression.shtml), and specific primers were designed: the 5' primer was ATGGAGCTAATGGACGACGA (SEQ ID No. 11); the 3' primer was TTATATAAGACAGCCATC (SEQ ID No. 12).
[0060] PCR reaction system: 15 μL of 2×PhantaMax MasterMix, 0.6 μL each of forward and reverse primers, 2 μL of template (cDNA), and water to a final volume of 30 μL.
[0061] The reaction procedure is as follows: 95℃, pre-denaturation for 3 min, 95℃, denaturation for 30 s, annealing for 30 s, extension at 72℃ for 2 kb / min, 35 cycles, extension at 72℃ for 5 min.
[0062] The final amplified OsbHLH004 full-length 1143bp cDNA sequence (SEQ ID No. 1) encodes 381 amino acids (including the stop codon), and SEQ ID No. 2 shows the sequence of 380 amino acids.
[0063] Example 2. Construction of OsbHLH004 mutant vector and overexpression vector
[0064] 2.1 OsbHLH004 mutant vector
[0065] To construct pCAMBIA1300-CAS9-Os-OsbHLH004, positions 85-107 and 316-338 of the OsbHLH004 gene CDS sequence were selected as target sites 1 (Cas9-1, ...). CCG GAAGATCTGTGGCTTCAGGC (SEQ ID No. 13) and target site 2 (Cas9-2, AACCCGTACAAGAGATCAGG) CGG SEQ ID No. 14), where the underlined part is a PAM sequence conforming to NGG), and synthesize the corresponding sgRNA-1 (GAAGATCTGTGGCTTCAGGC, SEQ ID No. 15) and sgRNA-2 (AACCCGTACAAGAGATCAGG, SEQ ID No. 16).
[0066] The gene editing vector psgR-CAS9-Os was digested with BsaI. The primers were then annealed: for target site 1, 10 μL of F(5'-TGTGTGCCTGAAGCCACAGATCTTC-3', SEQ ID No.17) + 10 μL of R(5'-AAACGAAGATCTGTGGCTTCAGGCA-3', SEQ ID No.18) + 80 μL of ddH2O were mixed; for target site 2, 10 μL of F(5'-TGTGTGACCCGTACAAGAGATCAGG-3', SEQ ID No.19) + 10 μL of R(5'-AAACCCTGATCTCTTGTACGGGTCA-3', SEQ ID No.20) + 80 μL of ddH2O were mixed.
[0067] Anneal at 95℃ for 10 min, then ligate with the enzyme-digested vector psgR-CAS9-Os. The ligation system is as follows: 2 μL annealing product (containing sgRNA) + 2 μL recovered enzyme-digested vector + 0.5 μL 10×T4 buffer + 0.5 μL T4 ligase. Ligate at room temperature for 15 min to obtain the psgR-CAS9-OsbHLH004 vector containing the OsbHLH004 specific target. Transform it into E. coli competent cells DH5α. The transformation system is as follows: 5 μL of ligation product is added to E. coli competent cells, incubate on ice for 30 min, heat shock at 42℃ for 90 s, incubate on ice for 2 min, add 400 μL antibiotic-free LB, recover at 37℃ for 1 h, centrifuge at 5000 rpm for 1 min, aspirate most of the supernatant, keep 50 μL of liquid, mix well, plate on LB agar plates (50 mg / L Kan), and incubate overnight at 37℃.
[0068] After extracting plasmids from positive clones, they were sent to the company for sequencing. The plasmid psgR-CAS9-OOsbHLH004, which had the correct result, was selected to obtain mutant plants by infecting rice callus tissue with Agrobacterium.
[0069] 2.1 OsbHLH004 overexpression vector
[0070] To construct Ubi:OsbHLH004, the amplified PCR product of the target gene was first purified using an Easier gel extraction kit. The desired vector, Ubi-XX-4HA, was extracted and digested with HindIII. After electrophoresis and purification, ligation was performed using homologous recombination.
[0071] The reaction system was as follows: 8 μL linearized vector, 2 μL insert fragment, 4 μL 5×Cell buffer, 2 μL Exnase II, and sterile water to a final volume of 4 μL (X = linearized vector concentration / (0.02 × vector base number); Y = insert fragment concentration / (0.04 × linearized fragment base number)); reaction conditions: 37℃, 30 min. The ligation product was transformed into competent *E. coli* DH5α cells, plated on LB agar plates (50 mg / L Kan), and incubated overnight at 37℃ inverted to form single colonies. The next day, single colonies were picked for PCR identification. The reaction program was as follows: 95℃ pre-denaturation for 3 min, 95℃ denaturation for 30 s, 55℃ annealing for 30 s, 72℃ extension at 2 kb / min for 35 cycles, and 72℃ extension for 5 min. Single colonies of the correct size were selected for testing.
[0072] Example 3. Obtaining the OsbHLH004 mutant and overexpression plants
[0073] Rice (Nipponbare) callus was used as the experimental material. The OsbHLH004 gene-editing vector and plant expression vector were transformed into Agrobacterium EHA105 via freeze-thaw conversion. Single clones of Agrobacterium (containing the OsbHLH004 gene-editing vector and plant expression vector) were picked and incubated overnight at 28°C and 200 rpm in 2 mL of Rif+Spe LB liquid medium with gentle shaking. Then, 1 mL of the bacterial suspension was transferred to 10 mL of resistant LB medium and cultured for 5 h. The culture was centrifuged at 4000 rpm for 10 min at room temperature, the supernatant was discarded, and the bacterial cells were resuspended in 50 mL of AAM-As resuspension. Appropriately sized rice callus tissue was picked and immersed in the Agrobacterium suspension for 30 min. A layer of sterile filter paper soaked in AAM was placed on the medium beforehand, and the callus tissue was spread evenly on the medium and incubated in the dark at 28°C for 2 days. Two days later, the callus was rinsed with sterile water until the liquid became clear. Then, it was shaken for 30 minutes with sterile water containing 500 mg / L Cef solution. The rinsed callus was spread evenly on sterile filter paper and air-dried for 2 hours. It was then transferred to selection medium and screened for approximately two weeks. Newly grown resistant callus was transferred to differentiation medium containing 50 mg / L hygromycin. After 2-3 weeks, the greened rice callus was transferred to rooting medium to induce rooting. Finally, the expression of the target gene in wild-type and transgenic plants was detected by qRT-PCR to preliminarily screen for overexpression-positive plants. For mutant-positive plants, gDNA was extracted from the T0 generation plants for PCR identification and sequencing.
[0074] Identification of the Osbhlh004 mutant: Genomic DNA was extracted from leaves of T0 generation transgenic plants and used as a template. Based on target information, specific primers F-1 (GGCATGGAGCTAATGGACGA, SEQ ID No. 21) and primer R-1 (TGTACGGGTTGCACACTTCA, SEQ ID No. 22), and F-2 (ACACGCTTGCCTCGCCGCC, SEQ ID No. 23) and primer R-2 (CGGCGCGGCGGCGAGCGTCC, SEQ ID No. 24) were designed for PCR amplification. Amplification products with a single and clear target band were recovered (the PCR amplification products of positive plants were 328 bp and 582 bp, respectively) and sent to the company for sequencing to screen for mutant lines. T0 generation plants were continuously self-crossed to obtain T2 generation plants. T2 generation plants were again screened for hygromycin and identified by PCR to select independent lines without the vector and with homozygous mutations, such as... Figure 2 As shown, four mutant lines were ultimately obtained, named Osbhlh004-1, Osbhlh004-2, Osbhlh004-3, and Osbhlh004-4, respectively. Two mutations occurred at target sequence 1: Osbhlh004-1 had an addition of one base (+T), and Osbhlh004-2 had a deletion of one base (-G). Two mutations also occurred at target sequence 2: Osbhlh004-3 had an addition of one base (+T), and Osbhlh004-4 had an addition of one base (+A). All four mutants resulted in frameshift mutations in the encoded protein.
[0075] Identification of OsbHLH004 overexpression plants: RNA was extracted from 14-day-old wild-type and transgenic sterile rice seedlings. Using 1 μg of RNA as a template, first-strand cDNA was synthesized according to the instructions of a cDNA synthesis kit (Yeasen). Specific quantitative PCR primers (F: TCAGCTGCTTCGATGACTTCGC, SEQ ID No. 25; R: CCCTCTTCTTGTCATCCTGTAGGC, SEQ ID No. 26) were designed using the OsbHLH004 gene cDNA. The expression of OsbHLH004 in wild-type and transgenic lines was detected by qRT-PCR. Figure 3 The germination rate of the overexpression lines after 5 days of water absorption was detected experimentally. Figure 4 ).
[0076] Example 4. Regulation of seed dormancy by OsbHLH004 mutants and overexpression plants
[0077] Panicles were marked at the midpoint of the spikelets of wild-type rice, Osbhlh004, and OsbHLH004, and immediately immersed in water after collection at 30-35 DAP. In each germination experiment, at least four panicles were immersed in plastic pots containing distilled water and cultured in a growth chamber at 28°C; the experiment was repeated three times. Grains were transplanted into fresh water daily, and the number of germinating grains in each panicle was counted daily to calculate the germination rate until most seeds had germinated. Germination was defined as a plumule length equal to half the seed length.
[0078] Experiments showed that the germination rate of freshly collected spikelet mutants 30 days after pollination was slower than that of the wild type; while the germination rate of different overexpression lines was faster than that of the wild type, and the degree of increase in germination rate of overexpression lines was closely related to the upregulation level of OsbHLH004 transcription. These results indicate that OsbHLH004 negatively regulates seed dormancy. Figures 5-6 ).
[0079] While the disclosure is as stated above, its scope of protection is not limited thereto. Those skilled in the art can make various changes and modifications without departing from the spirit and scope of this disclosure, and all such changes and modifications will fall within the protection scope of this invention.
Claims
1. A method for regulating seed dormancy or germination in rice, characterized by, The method includes: upregulating or downregulating the expression of OsbHLH004 protein with the amino acid sequence shown in SEQ ID No. 2 in rice; Upregulating the expression of the OsbHLH004 protein can promote rice seed germination or reduce its dormancy. Specifically, downregulating the expression of the OsbHLH004 protein can prolong the dormancy of rice seeds or delay their germination.
2. The method according to claim 1, characterized in that, The upregulation of OsbHLH004 protein expression was achieved by introducing and expressing a gene encoding the protein in rice, the nucleotide sequence of which is shown in SEQ ID No.
1.
3. The method according to claim 1, characterized in that, The downregulation of OsbHLH004 protein expression was achieved by knocking out, silencing, or mutating the gene encoding the protein in rice.
4. The method according to claim 3, characterized in that, The nucleotide sequence of the gene encoding the OsbHLH004 protein is shown in SEQ ID No.
1.
5. The method according to claim 3, characterized in that, The knockout or silencing of the gene is achieved using a CRISPR gene editing system, and the nucleotide sequence of the sgRNA used in the gene editing is shown in SEQ ID No. 15 or SEQ ID No. 16.
Citation Information
Patent Citations
Application of protein OsMADS27 in regulating plant seed germination time and regulating plant seed dormancy
CN110028563A
Wild rice drought-resisting gene and its coded protein and application
CN1772899A