A fusion protein ELP-EBP for binding endotoxin and its preparation method and method for removing endotoxin in aqueous solution

Abstract

The present invention relates to the field of fusion proteins, and specifically to a fusion protein ELP-EBP for binding endotoxin, wherein the fusion protein ELP-EBP is formed by the fusion of elastin ELPs and endotoxin binding peptide EBPs; the fusion protein ELP-EBP has a temperature-driven phase transition characteristic, which is manifested as: at a temperature lower than the inversion temperature Tt, it is highly soluble; at a temperature higher than Tt, a phase transition occurs to form insoluble aggregates. The present invention also provides a method for preparing the fusion protein ELP-EBP. The present invention also provides a method for removing endotoxins in an aqueous solution by using the fusion protein ELP-EBP through a phase change affinity method.

Description

Technical Field

[0001] The present invention relates to the field of fusion proteins, and more specifically to a fusion protein ELP-EBP for binding to endotoxin, and more specifically to a method for preparing the fusion protein ELP-EBP for binding to endotoxin and a method for removing endotoxin in an aqueous solution by using the fusion protein ELP-EBP through a phase change affinity method. Background Art

[0002] Endotoxin is a lipopolysaccharide (LPS) present in the outer cell wall of Gram-negative bacteria, which helps organize and stabilize the cell membrane. LPS is released into the environment after the bacteria die. Endotoxin is composed of three regions: core polysaccharide, long-chain polysaccharide and lipid A. Lipid A is related to the toxicity of endotoxin, which triggers the production of proinflammatory cytokines, leading to sepsis and septic shock. One endotoxin unit (EU) is equal to 0.1 ng of LPS activity. Endotoxin is highly stable and can resist damage by heat or pH. During the production of biological products, endotoxins may interact with target substances to form stable compounds, complicating separation. Downstream purification processing of recombinant protein products accounts for approximately 45-92% of the total manufacturing cost (Wilding KM, et.al . Endotoxin-Free E. coli -Based Cell-Free Protein Synthesis: Pre-Expression Endotoxin Removal Approaches for on-Demand Cancer Therapeutic Production. Biotechnol J. 2019, 4(3):e1800271.), among which the removal of endotoxins is an important challenge in the biopharmaceutical field. The common source of endotoxin contamination is the water system, such as bacteria growing on the wall of the water distribution pipe.

[0003] There are many methods to remove endotoxins. The molecular weight of LPS monomers is 10~30kDa. Monomers can form aggregates through the interaction of core polysaccharides and long-chain polysaccharides. The molecular weight of aggregates exceeds 1000 kDa and the diameter can reach 0.1 μm. These LPS aggregates can be removed by ultrafiltration. Using an ultrafiltration membrane with a molecular weight cutoff of 100 kDa, 28.9~99.8% of endotoxins can be removed for different protein concentrations and endotoxin levels (Jang H, Kim HS, Moon SC, Lee YR, Yu KY, Lee BK, Youn HZ, Jeong YJ, Kim BS, Lee SH, Kim JS. Effects of protein concentration and detergent on endotoxin reduction by ultrafiltration. BMBRep. 2009, 31;42(7):462-6.). The solvent extraction method is based on the relative solubility difference of endotoxins in two immiscible liquids. Commonly used extractants are 1-octanol and Triton X-114. Anion exchange chromatography can be used to separate negatively charged endotoxins from positively charged molecules, such as basic proteins. Affinity chromatography is currently a relatively efficient and broad-spectrum method for removing endotoxins, which utilizes the specific binding between endotoxins and ligands. Commonly used affinity ligands include diethylaminoethane, polymyxin B, histamine, histidine, poly-L-lysine, polyvinylamine, and chitosan. The membrane adsorption method is an emerging endotoxin removal method. Its mechanism is the same as that of affinity and ion exchange chromatography, except that the matrix is ​​replaced with a filter membrane. The filter membrane can be made of cellulose, cellulose acetate, nylon, polyethylene vinyl acetate, polyvinyl alcohol, and polyvinylidene fluoride. The membrane adsorption method reduces the processing time and significantly reduces the cost of endotoxin removal.

[0004] However, there is no single purification method that is suitable for all endotoxin removal scenarios. Ultrafiltration is very suitable for removing endotoxins from salts, small molecules or water, but it is not suitable for most protein products. Extraction has a high removal efficiency for samples with high endotoxin contamination, but may result in a high proportion of product loss. Ion exchange chromatography is only suitable for molecules with weak positive charges (such as plasmid DNA extraction). Affinity chromatography and mixed-mode chromatography methods provide sufficient endotoxin removal rates for therapeutic monoclonal antibodies, etc., and can maintain high product recovery rates. Membrane adsorption based on affinity and ion exchange reduces working time and initial cost, and has high product recovery rates. However, affinity adsorption and ion chromatography have low endotoxin binding capacity, which limits sample processing volume and removal efficiency. In addition, the ligand and its binding capacity are also key factors affecting affinity endotoxin removal. Many ligands have good endotoxin binding efficiency, but are nephrotoxic and neurotoxic (such as TMB), and have disadvantages such as low recombinant protein recovery and difficulty in intravenous application. The required contact time between the solution and the ligand is also an important influencing factor, because the longer the contact time means that a larger column is required, and the investment is greater. The pore size of the matrix also affects the endotoxin removal efficiency. Smaller pores increase the retention time of endotoxins in the column due to size exclusion, while larger pores reduce ionic interactions. Although a number of commercial porous nanoparticles and microparticles with affinity ligands have been used for endotoxin removal from proteins and biological solutions (Schneier M, et al . Current technologies to endotoxin detection and removal for biopharmaceutical purification. Biotechnol Bioeng.2020, 117(8):2588-2609.), but the main disadvantages of porous matrices are: (1) deformation of the matrix will cause column bed consolidation; (2) continuous accumulation of colloidal substances will cause chromatographic column blockage; (3) low material transport efficiency in the matrix pores. These shortcomings will lead to problems such as decreased flow rate and reduced processing efficiency, making the cost of large-volume material processing too high. Therefore, the development of endotoxin removal methods with good biocompatibility and suitable for large volumes and large flows has good medical prospects.

[0005] Elastin-like polypeptides (ELPs) are oligomeric repeating sequences of the pentapeptide Val-Pro-Gly-Xaa-Gly (where Xaa is any amino acid except proline) that have reversible temperature-dependent phase inversion properties. t), ELPs are highly soluble in water, but when the temperature is above T t When heated to 35°C, ELPs undergo a sharp (2-3°C range) phase transition to desolvate and aggregate. This heat-driven reverse transition feature of ELPs remains unchanged in many fusion proteins and is used as a protein tag for purifying fusion proteins. Many studies have shown that Tt values ​​decrease with increasing ionic strength, ELPs concentration and length. The amino acid properties of the fusion protein also affect Tt. The more hydrophobic amino acid residues, the lower the Tt, and vice versa. Studies have shown that the Tt of ELP fusion proteins is different from that of free ELPs. Proteins with more charged surface area increase Tt, while hydrophobic proteins reduce Tt. To keep Tt in the range of 35-55°C, proteins with more surface charge should be fused to longer ELPs, while hydrophobic proteins should be fused to shorter ELPs. In addition, the phase transition pH should be controlled as far away from the pI of the fusion protein as possible to prevent protein denaturation or isotropic sedimentation. The solubilization buffer of ELPs fusion proteins is usually PBS or HEPES, and salts are added to trigger the phase transition of ELPs. These salts are usually sodium chloride (1 M - 3 M), ammonium sulfate (0.4-1 M), or sodium citrate (0.15-0.5 M) (FongBA, et al . Optimization of ELP-intein mediated protein purification by salt substitution. Protein ExprPurif. 2009, 66(2):198-202. ).

[0006] There is an urgent need to design a method for removing endotoxins from aqueous solutions to solve the problems of biocompatibility, small processing volume and low flow rate in removing endotoxins from aqueous solutions. Summary of the invention

[0007] The purpose of the present invention is to overcome the shortcomings of the prior art and provide a fusion protein ELP-EBP for binding endotoxins, a preparation method thereof, and a method for removing endotoxins from an aqueous solution. Elastin-like polypeptides (ELPs) and endotoxin-binding peptides (EBPs) are fused to form a bifunctional fusion protein ELP-EBP. The ELP-EBP has this temperature-dependent phase transition property and endotoxin binding activity, so as to solve the problems of biocompatibility, small processing volume and low flow rate in removing endotoxins from aqueous solutions.

[0008] In order to achieve the above-mentioned purpose, the present invention designs a fusion protein ELP-EBP for binding endotoxin, wherein the fusion protein ELP-EBP is formed by the fusion of elastin ELPs and endotoxin binding peptide EBPs; the fusion protein ELP-EBP has a temperature-driven phase transition characteristic, which is manifested as: at a temperature lower than the inversion temperature Tt, it is highly soluble; at a temperature higher than Tt, a phase change occurs to form insoluble aggregates.

[0009] The fusion protein ELP-EBP for binding endotoxin provided by the present invention also has the following technical features: the elastin ELPs are derived from natural elastin of humans, mammals, yeast and filamentous fungi.

[0010] The fusion protein ELP-EBP for binding endotoxin provided by the present invention also has the following technical features: the elastin ELPs is derived from human and its sequence is SEQ NO 1.

[0011] The fusion protein ELP-EBP for binding endotoxin provided by the present invention also has the following technical features: the endotoxin binding peptide EBPs is derived from horseshoe crab Fc protein, human liver endotoxin binding protein, or an artificially synthesized polypeptide with endotoxin binding activity.

[0012] The fusion protein ELP-EBP for binding endotoxin provided by the present invention also has the following technical features: the endotoxin binding peptide EBPs is derived from horseshoe crab Fc protein, and its sequence is SEQ NO 2.

[0013] The present invention also provides a method for preparing the fusion protein ELP-EBP, which is as follows: S1. Synthesizing a host codon-optimized DNA sequence according to the fusion protein ELP-EBP protein sequence; S2. Loading the coding DNA of the fusion protein ELP-EBP into an expression vector to form an expression component; S3. Transfecting the fusion protein ELP-EBP expression component into a host cell to form an ELP-EBP expression host; S4. Obtaining a pure fusion protein ELP-EBP by culturing the fusion protein ELP-EBP expression host and separating and purifying it.

[0014] The method for preparing the fusion protein ELP-EBP of the present invention also has the following technical features, wherein the expression host is Escherichia coli, Bacillus, yeast, filamentous fungi, insect cells and mammalian cells.

[0015] The present invention also provides a method for removing endotoxins in an aqueous solution by a phase change affinity method using the fusion protein ELP-EBP, the method being as follows: S1. Adding the fusion protein ELP-EBP to a solution containing endotoxins; S2. Adjusting the solution temperature to below Tt, so that the fusion protein ELP-EBP is uniformly dissolved in the solution, and the endotoxin-binding peptide EBPs is fully bound to the endotoxins; S3. Raising the solution temperature to above Tt, so that the fusion protein ELP-EBP is desolvated and aggregated; S4. At a temperature above Tt, centrifugally remove the fusion protein ELP-EBP, and retain the supernatant, and the endotoxin in the supernatant can be adsorbed and removed by the fusion protein ELP-EBP.

[0016] The method of removing endotoxins in an aqueous solution by a phase change affinity method using the fusion protein ELP-EBP described in the present invention also has the following technical features, wherein the added concentration of the fusion protein ELP-EBP is 0.05~10 mg / ml, 0.1~5.0 mg / ml or 0.2~2.0 mg / ml.

[0017] The method of removing endotoxins in an aqueous solution by a phase change affinity method using the fusion protein ELP-EBP described in the present invention also has the following technical characteristics, wherein the Tt is 10°C~30°C, 15°C~25°C, 18°C~22°C; the binding time is 3min-180min, 3min-60min, 3min-30min; the phase change time is 3min-180min, 3min-60min, 3min-30min.

[0018] Compared with the prior art, the present invention has the following advantages:

[0019] 1. The present invention fuses elastin with temperature-driven phase change characteristics with endotoxin-binding peptides to form a method for removing endotoxins from aqueous solutions through phase change. In this method, ELP-EBP is t It can be evenly dissolved in the pretreatment solution below the temperature and fully combined with endotoxin, overcoming the difficulties of traditional methods such as chromatography and membrane filtration, such as matrix deformation, limited material contact time, blockage, and large product loss. It is less affected by factors such as material viscosity and solute content and has better adaptability.

[0020] 2. ELP-EBP is a protein component, non-toxic and harmless, and has better safety and biocompatibility than traditional extraction methods for removing endotoxins.

[0021] 3. The method of the present invention can remove endotoxins in the solution through simple temperature change, centrifugation or filtration, has little impact on the material, is convenient and fast, is not limited by volume, and can be easily scaled up.

[0022] 4. The phase change reaction of ELP-EBP is rapid, the precipitation is thorough, and the low residue can reduce the adverse reactions of the final product. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 .for pELP-SUSHI-1 Schematic diagram and enzyme digestion identification diagram. pELP-SuShi-1 Schematic diagram of plasmid; B is expression pELP-SuShi-1 1% agarose gel electrophoresis of the products digested with SacI+HindIII. Plasmids 1#, 2# and 3# are from three independent strains.

[0024] Figure 2 . Schematic diagram of the purification and SDS-PAGE analysis of ELP-SuShi-1 fusion protein. M is the molecular weight marker of the expressed protein; 1 is the supernatant of ES1 bacterial lysate induced by 0.4mM IPTG; 2 is the supernatant of ES1 bacterial lysate without IPTG induction; 3 is the precipitate of ES1 bacterial lysate induced by 0.4mM IPTG; 4 is ELP-EBP purified by Ni2+ column affinity; 5 is ELP-EBP purified by ITC. DETAILED DESCRIPTION

[0025] The terms used in the present invention, unless otherwise specified, generally have the meanings that are commonly understood by those of ordinary skill in the art.

[0026] In the following examples, various processes and methods not described in detail are conventional methods well known in the art.

[0027] The reagents used in the following examples were purchased from common commercial sources, and the experimental operations and experimental conditions not specified were referred to the conventional operations and conventional conditions in the art.

[0028] The specific implementation of the present invention is described below in conjunction with embodiments and drawings.

[0029] Example 1: Construction of ELP-EBP expression vector.

[0030] Based on the Southeast Asian horseshoe crab coagulation factor C protein sequence (Genbank accession number: Q26422.1) and domain function (Tan NS, et. al.Definition of endotoxin binding sites in horseshoe crab factor C recombinantsushi proteins and neutralization ofendotoxin by sushi peptides. FASEB J.2000 Sep;14(12):1801-13.), the equilibrium dissociation constant (Kd) with endotoxin was selected as 1.4×10 -10 The SuShi-1 region of M is used as the endotoxin binding domain. The amino acid sequence of SuShi-1 is SEQ ID NO.1. The coding sequence of SuShi-1 after E. coli codon optimization is SEQ ID NO.2. To facilitate gene construction and subsequent protein purification, a Sac I restriction site, a linker and a 6×His tag sequence are added to the 5' end of SEQID NO.2, and a HindIII restriction site is added to the 3' end. The sequence is as follows:

[0031] 5' DNA sequence (SEQ ID NO.3):

[0032] GAGCTC AACAACAACAACAATAACAATAACAACAACCTCGGTCATCACCATCACCATCATCAC (the underlined sequence is the Sac I site)

[0033] 5' amino acid sequence (SEQ ID NO.4): SSNNNNNNNNNNLGHHHHHHH ("SSNNNNNNNNNNLG" sequence is Linker, "HHHHHHH" sequence is His tag)

[0034] 3' DNA sequence (SEQ ID NO.5): TAA AAGCTT (The underlined sequence is the Hind III cleavage point)

[0035] The DNA sequence after the above sequences were combined (SEQ ID NO. 6) is:

[0036] GAGCTCGAACAACAACAACAATAACAACAACAACCTCGGTCATCACCATCACCATCATCACAAAGGCTGCCCGCTGCTGCCGAGCGATAGCCAGGTTGCAGGAAGTGCGCAACCCGCCGGATAACCCGGCAGACCATTGATTATAGCTGCAGCCCGGGCTTTAAACTGAAAGGCATGGCGCGTATTAGCTGCCTGCCGAACGGCCAGTGGAGCAACTTTCCGCCGAAATGCATCCGCTAATAA AAGCTT

[0037] Suzhou Jinweizhi Biotechnology Co., Ltd. was commissioned to synthesize SEQ NO.6 and loaded into pUC-GW In the carrier, pUC- SuShi-1 The SuShi-1 fragment was cut out from the stored ELP expression vector pELP by double digestion with SacI+Hind III and cloned into pE To form the expression vector of ELP-SuShi-1 fusion protein pELP-SuShi-1 ( Figure 1 ). pELP- SuShi-1 The amino acid sequence of the ELP-SuShi-1 fusion protein is SEQ ID NO.7.

[0038] The corresponding DNA sequence is SEQ ID NO.8.

[0039] Plasmid pELP-SUSHI-1 Transfect BL-21(DE3) competent bacteria to obtain pELP-SUSHI-1 Plasmid expression strain ES1.

[0040] See also Figure 1 ,for pELP-SUSHI-1 Schematic diagram and enzyme digestion identification diagram. pELP-SuShi-1 Schematic diagram of plasmid; B is expression pELP-SuShi-1 1% agarose gel electrophoresis of the products digested with SacI+HindIII. Plasmids 1#, 2# and 3# are from three independent strains.

[0041] Example 2: Affinity purification of ELP-EBP based on 6×His tag.

[0042] Take the ELP-SuShi-1 expression strain ES1 glycerol bacteria, streak it on the LB plate, and culture it at 37℃ overnight. Take a single colony and inoculate it into LB medium, and culture it at 37℃, 220rpm for 12-16 hours. Then scale up the culture into fresh LB medium at 1:50, continue to culture at 37℃, 220rpm until OD600 reaches 0.8~1.0, add IPTG to a final concentration of 0.5mM, and then continue to culture at 23℃, 220rpm for 20 hours.

[0043] The culture was centrifuged at 1000g for 10min at 4℃ to collect the bacteria. The bacteria were washed once with PBS, and then lysate (10 mM Tris-HCl, pH 8.5, 2 mM EDTA, 0.1 mg / mL lysozyme) was added, and the cells were broken by ultrasound (25W, 10s on, 10s off, 10min), and the bacterial lysate was centrifuged at 15000g for 20min at 4℃ to collect the supernatant. The supernatant of bacterial lysis was filtered through a 0.22µm filter and purified by Ni-NTA affinity chromatography at a flow rate of 2ml / min. The balance solution used was (50 mM NaH2PO4 pH 8.0, 300 mM NaCl, 10 mM imidazole), the washing solution was (50 mM NaH2PO4 pH 8.0, 300 mM NaCl, 20 mM imidazole), and the eluent was (50 mM NaH2PO4 pH 8.0, 300 mM NaCl, 250 mM imidazole). The eluent was dialyzed against PBS overnight. The protein was concentrated to a protein concentration of about 5mg / ml using an ultrafiltration tube with a molecular weight cutoff of 10kDa. The ELP-EBP protein concentration was determined by ultraviolet spectrophotometry and calculated based on the A280 extinction coefficient of 0.138 (1g / L).

[0044] Example 3: Purification of ELP-EBP based on the Inverse Transition Cycling (ITC) method.

[0045] The ITC method separates ELP-EBP protein from impurities by cyclically precipitating ELP-EBP under high salt and high temperature conditions and dissolving it at 4°C. The operation process is briefly described as follows: NaCl is added to the concentrated dialysate of ELP-EBP obtained by affinity purification to a final concentration of 2M, centrifuged at 18,000×g for 15 min at room temperature, and the precipitate is collected; the precipitate is resuspended with an equal volume of PBS and gently mixed at 4°C for 10 min to dissolve the precipitate. Centrifuge at 4°C, 18000×g for 10 min, and collect the supernatant. Repeat this process twice to obtain ELP-EBP with a purity of more than 95%. Finally, ELP-EBP is dissolved in PBS, and the protein concentration is adjusted to 5mg / ml, and stored at 4°C for later use.

[0046] Figure 2 . Schematic diagram of the purification and SDS-PAGE analysis of ELP-SuShi-1 fusion protein. M is the molecular weight marker of the expressed protein; 1 is the supernatant of ES1 bacterial lysate induced by 0.4mM IPTG; 2 is the supernatant of ES1 bacterial lysate without IPTG induction; 3 is the precipitate of ES1 bacterial lysate induced by 0.4mM IPTG; 4 is ELP-EBP purified by Ni2+ column affinity; 5 is ELP-EBP purified by ITC.

[0047] Example 4: Removal of endotoxin from ELP-EBP using Triton X-114.

[0048] 1% Triton X-114 was added to the purified 5mg / ml ELP-SuShi-1, and the mixture was gently mixed at 4℃ for 60 min; then the mixture was gently mixed at 30℃ for 40 min; then the mixture was centrifuged at 14000rpm for 5 min at room temperature, and the supernatant was collected. The extraction was repeated twice with 1% Triton X-114, and the supernatant was dialyzed against PBS to remove Triton X-114, and then concentrated by ultrafiltration, and the protein concentration was finally adjusted to 5mg / ml. The endotoxin content of the 5mg / ml ELP-SuShi-1 solution was 1.4EU / ml using the micro-dynamic colorimetric method of horseshoe crab reagent (Xiamen Horseshoe Crab Reagent Biotechnology Co., Ltd., MKC0505) according to the instructions of the kit (see Table 1).

[0049] Table 1. Removal of endotoxin from ELP-EBP by Triton X-114.

[0050]

[0051] Example 5: Removal of endotoxin from liquid using ELP-EBP by ITC method.

[0052] 100EU / ml endotoxin standard was purchased from Huzhou Shenke Biotechnology Co., Ltd. Endotoxin was diluted to 50EU / ml, 40EU / ml, 20EU / ml, and 10EU / ml with pyrogen-free water, and 0.9ml of each concentration of endotoxin solution was added to a 1.5ml centrifuge tube without endotoxin. At the same time, 100ul of 5mg / ml ELP-SuShi-1 was added, and gently mixed and placed at 4℃ for 1 hour, then incubated at 30℃ for 10min, and finally centrifuged at 30℃, 12000g, for 10min, and the supernatant was taken. The endotoxin content in the supernatant of LPS samples of various concentrations was determined by Limulus amebocyte lysate. The results are shown in Table 2. After being treated with ELP-SuShi-1, the endotoxin content of LPS samples of different concentrations was reduced to about 0.3EU / ml, and the removal efficiency reached more than 97% (see Table 2).

[0053] Table 2. Removal of endotoxin from aqueous solutions using ELP-EBP.

[0054]

[0055] Example 6: Comparison of removal efficiency of ELP-EBP at different concentrations.

[0056] The removal efficiency of ELP-EBP at different concentrations was tested with a 50EU / ml endotoxin standard. Take a 1.5ml endotoxin-free centrifuge tube, 0.9ml of 50EU / ml endotoxin standard, add 0.1ml of ELP-EBP treated with Triton X-114 at 5mg / ml, 2.5mg / ml, 1.25mg / ml, 0.625mg / ml, and 0.313mg / ml, gently mix and place at 4℃ for 1 hour, then incubate at 30℃ for 10min, and finally centrifuge at 30℃, 12000g, for 10min, and take the supernatant. The endotoxin content in the supernatant of LPS samples of various concentrations was determined by Limulus amebocyte lysate. The results are shown in Table 3. When the final concentration of ELP-EBP is ≥0.125mg / ml, endotoxin in the solution can be effectively removed. It is possible that at low concentrations, the efficiency of ELP-EBP high-temperature phase transition to form aggregate precipitation is reduced, resulting in a decrease in endotoxin removal efficiency (see Table 3).

[0057] Table 3. Removal of endotoxin from aqueous solutions for ELP-EBP (0.5 mg / ml).

[0058]

[0059] The above is a detailed description of the embodiments, which is convenient for those skilled in the art to correctly understand and use the present invention. It is only a specific implementation mode of the present invention, but the protection scope of the present invention is not limited thereto. Any improvement or modification of the technical solution obtained by those skilled in the art based on the present invention on the basis of the prior art without innovative work, only through analysis, analogy or limited enumeration, etc., should be within the protection scope determined by the claims.

Claims

1. A method for removing endotoxins from an aqueous solution by a phase change affinity method, characterized in that The method is as follows: S1. Adding a fusion protein ELP-EBP to a solution containing endotoxin; the fusion protein ELP-EBP is formed by fusion of elastin ELPs and endotoxin binding peptide EBPs; the fusion protein ELP-EBP has a temperature-driven phase transition characteristic, which is characterized by: being highly soluble at a temperature lower than the inversion temperature Tt; and undergoing a phase transition to form an insoluble aggregate at a temperature higher than Tt; the amino acid sequence of the endotoxin binding peptide EBPs is SEQ ID NO.1, the endotoxin binding peptide EBPs is optimized and encoded by Escherichia coli codons, and the amino acid sequence of the optimized endotoxin binding peptide EBPs is SEQ ID NO.2, and a Sac I restriction site, a Linker and a 6×His tag sequence are added to the 5' end of the optimized endotoxin binding peptide EBPs, respectively, and a Hind III restriction site is added to the 3' end; S2. The solution temperature is adjusted to below Tt, so that the fusion protein ELP-EBP is uniformly dissolved in the solution and the endotoxin-binding peptide EBPs is fully bound to the endotoxin; S3. Raising the solution temperature to above Tt to desolvate and aggregate the fusion protein ELP-EBP; S4. Above the Tt temperature, centrifuge to remove the fusion protein ELP-EBP and retain the supernatant. The endotoxin in the supernatant can be adsorbed and removed by the fusion protein ELP-EBP.

2. A method for removing endotoxins from an aqueous solution by a phase change affinity method as claimed in claim 1, characterized in that The added concentration of the fusion protein ELP-EBP is 0.05-10 mg / ml.

3. A method for removing endotoxins from an aqueous solution by a phase change affinity method as claimed in claim 1, characterized in that The Tt is 10°C-30°C; the binding time is 3min-180min; and the phase change time is 3min-180min.

4. A method for removing endotoxins from an aqueous solution by a phase change affinity method as claimed in claim 1, characterized in that The elastin ELPs are derived from natural elastin from humans, mammals, yeast and filamentous fungi.

5. A method for removing endotoxins from an aqueous solution by a phase change affinity method as claimed in claim 1, characterized in that The endotoxin binding peptide EBPs is derived from horseshoe crab Fc protein, human liver endotoxin binding protein, and artificially synthesized polypeptide with endotoxin binding activity.

6. A method for removing endotoxins from an aqueous solution by a phase change affinity method as claimed in claim 5, characterized in that The endotoxin binding peptide EBPs is derived from horseshoe crab Fc protein, and its sequence is SEQ NO.2.

Images