5'UTR element, expression vector and its application

By providing a 5′UTR element with a specific nucleotide sequence, the problems of low expression efficiency and capping efficiency in in vitro synthesized mRNA are solved, efficient mRNA expression and stability are achieved, and the capping efficiency and expression efficiency are improved.

CN118667810BActive Publication Date: 2025-09-26YUNZHOU BIOSCIENCES (GUANGZHOU) INC
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202410554063.5
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-05-06
Publication Date
2025-09-26
Estimated Expiration
2044-05-06

AI Technical Summary

Technical Problem

In the prior art, the 5′UTR sequence of in vitro synthesized mRNA cannot achieve both high expression efficiency and high capping efficiency, which affects the stability and expression efficiency of the mRNA.

Method used

Provided are 5'UTR elements of specific nucleotide sequences, including SEQ ID NO: 1 to SEQ ID NO: 36 and variant sequences thereof, for constructing expression vectors to improve capping efficiency and expression efficiency.

Benefits of technology

It achieves high capping efficiency (over 80%) and high expression efficiency of in vitro synthesized mRNA, which is better than the existing modified 5′UTR sequence.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure SMS_1
    Figure SMS_1
  • Figure SMS_2
    Figure SMS_2
  • Figure SMS_3
    Figure SMS_3
Patent Text Reader

Abstract

The present invention relates to the field of in vitro transcription, and in particular to 5'UTR elements, expression vectors, and their applications. The present invention provides a 5'UTR element, comprising: a nucleotide sequence as shown in any of SEQ ID NOs: 1 to 12; or a nucleotide sequence obtained by substituting, deleting, or adding one or more bases from the nucleotide sequence shown, and having the same or similar functions as the nucleotide sequence shown; or a nucleotide sequence that is at least 80% identical to the nucleotide sequence shown. By providing a 5'UTR sequence, the present invention addresses the problem that, during in vitro mRNA synthesis, the 5'UTR sequence of prokaryotes cannot simultaneously achieve both high mRNA expression efficiency and high capping efficiency.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the field of in vitro transcription, in particular to a 5'UTR element, an expression vector and applications thereof. Background Art

[0002] The 5' UTR refers to the region of the mature mRNA located upstream of the coding region and downstream of the 5' end cap that is not translated into protein. The 5' UTR begins at the transcription start site and ends one nucleotide before the start codon. It may contain regulatory elements that control gene expression. The 5' UTR interacts with RNA-binding proteins to regulate mRNA stability, ribosome recognition, and mRNA secondary structure, largely determining protein expression and translation efficiency.

[0003] The m7G 5′ cap structure is ubiquitous in eukaryotic cells. It connects the first nucleotide at the 5′ end of the mRNA via a triphosphate bond, termed Cap 0 (m7GpppN, also known as Cap 0). Cap 0 is crucial for mRNA translation. An additional methylation modification at the 2′O position of the initiating nucleotide of an mRNA is called Cap 1 (m7GpppNm, also known as Cap 1). Cap 1 modification can reduce immune responses to mRNA application in vivo. The mRNA 5′ cap regulates pre-mRNA splicing, protects mRNA from nuclease degradation, and determines the initiation of protein translation. Therefore, a higher proportion of Cap 1 is desirable in in vitro synthesized mRNA.

[0004] In vitro mRNA synthesis uses enzymes, templates, NTPs, and reaction buffers to mimic the in vivo mRNA synthesis process. The general process involves template preparation and purification, in vitro mRNA transcription, capping reaction, template DNA removal, and mRNA purification. The capping reaction is significantly influenced by the thermodynamic free energy of the 5′UTR. A brief investigation revealed that the lower the thermodynamic free energy of the 5′UTR, the more difficult the capping reaction. This suggests that 5′UTRs with higher thermodynamic free energies have higher capping rates. Under the same conditions, mRNAs with higher capping efficiencies also have higher expression efficiencies. Therefore, the 5′UTR of in vitro transcribed mRNA not only directly influences mRNA expression efficiency but also indirectly influences mRNA stability and expression efficiency by affecting capping efficiency. Summary of the Invention

[0005] In view of this, the present invention provides a 5'UTR element, an expression vector, and its use. By providing a 5'UTR sequence, the present invention addresses the problem that during in vitro mRNA (messenger ribonucleic acid) synthesis, the 5'UTR (5' untranslated region) sequence of an mRNA expression vector cannot simultaneously achieve high mRNA expression efficiency and high capping efficiency.

[0006] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0007] The present invention provides a 5'UTR element, wherein the 5'UTR element has:

[0008] (1) a nucleotide sequence as shown in any of SEQ ID NO: 1 to SEQ ID NO: 12; or

[0009] (2) A nucleotide sequence obtained by substituting, deleting or adding one or more bases of the nucleotide sequence shown in (1), and having the same or similar function as the nucleotide sequence shown in (1); or

[0010] (3) A nucleotide sequence that is at least 80% identical to the nucleotide sequence shown in (1) or (2).

[0011] In some embodiments of the present invention, the sequence of SEQ ID NO: 1 is: ACTCTTCTGCTCGCCACAGTCTGGAGACGAACGCACC. (A1)

[0012] In some embodiments of the present invention, the sequence of SEQ ID NO: 2 is: ATTGGATTGTGACGAAGAGATTGAGAGAGAACTGACC. (A2)

[0013] In some embodiments of the present invention, the sequence of SEQ ID NO: 3 is: ATAGGATTGTGACGAAGAGATTGAGAGAGAACTGACC. (A3)

[0014] In some embodiments of the present invention, the sequence of SEQ ID NO: 4 is: AATATTAAGGTAAAAAGAGAGTGAGAGAGAACGCACC. (A5)

[0015] In some embodiments of the present invention, the sequence of SEQ ID NO:5 is: AATATTAAGG TAAAAAGAGAGAGGTGAATTAGAGAGTAGCCACC. (A7)

[0016] In some embodiments of the present invention, the sequence of SEQ ID NO:6 is: AATATTATTGTAAAAAGAGAGTGAGAGAGAAGGGACC. (A9)

[0017] In some embodiments of the present invention, the sequence of SEQ ID NO:7 is: AATATTAGGTAAAAAGAGAGTGAGAGAGAAGGGACC. (A10)

[0018] In some embodiments of the present invention, the sequence of SEQ ID NO: 8 is: AATATTAGAGTAAAAAGAGAGTGAGAGAGAAGGGACC. (A11)

[0019] In some embodiments of the present invention, the sequence of SEQ ID NO:9 is: ACATTTGCTTC TGACACAACTGTGTTCACTTCACGCATCAAACAGACACC. (B1)

[0020] In some embodiments of the present invention, the sequence of SEQ ID NO: 10 is: ACATTTGCTT CTGACACAACTGTGTTCACTTCACGCATCAAACGGACACC. (B2)

[0021] In some embodiments of the present invention, the sequence of SEQ ID NO: 11 is: ACATTTGCTT CTGACACAACTACATCAACTTCACTAATCATACGGCCACC. (B8)

[0022] In some embodiments of the present invention, the sequence of SEQ ID NO: 12 is: ACATCTGCTT CTGACACAACTACATCAACTTCACTAATCATACGGCCACC. (B9)

[0023] In some embodiments of the present invention, in the above-mentioned 5′UTR element, the 5′ end of the nucleotide further comprises: GGG base and / or AG base.

[0024] In some embodiments of the present invention, in the above-mentioned 5′UTR element, the 5′UTR element has:

[0025] (4) a nucleotide sequence as shown in any of SEQ ID NO: 13 to SEQ ID NO: 36; or

[0026] (5) A nucleotide sequence obtained by substituting, deleting or adding one or more bases of the nucleotide sequence shown in (4), and having the same or similar function as the nucleotide sequence shown in (4); or

[0027] (6) A nucleotide sequence that is at least 80% identical to the nucleotide sequence shown in (4) or (5).

[0028] In some embodiments of the present invention, the sequence of SEQ ID NO: 13 is: GGGACTCTTCTGCTCGCCACAGTCTGGAGACGAACGCACC. (GGG+A1)

[0029] In some embodiments of the present invention, the sequence of SEQ ID NO: 14 is: AGACTCTTCTGCTCGCCACAGTCTGGAGACGAACGCACC. (AG+A1)

[0030] In some embodiments of the present invention, the sequence of SEQ ID NO: 15 is: GGGATTGGATTGTGACGAAGAGATTGAGAGAGAACTGACC. (GGG+A2)

[0031] In some embodiments of the present invention, the sequence of SEQ ID NO: 16 is: AGATTGGATTGTGACGAAGAGATTGAGAGAGAACTGACC. (AG+A2)

[0032] In some embodiments of the present invention, the sequence of SEQ ID NO: 17 is: GGGATAGGATTGTGACGAAGAGATTGAGAGAGAACTGACC (GGG+A3)

[0033] In some embodiments of the present invention, the sequence of SEQ ID NO: 18 is: AGATAGGATTGTGACGAAGAGATTGAGAGAGAACTGACC(AG+A3)

[0034] In some embodiments of the present invention, the sequence of SEQ ID NO: 19 is: GGGAATATTAAGGTAAAAAGAGAGTGAGAGAGAACGCACC. (GGG+A5)

[0035] In some embodiments of the present invention, the sequence of SEQ ID NO: 20 is: AGAATATTAAGGTAAAAAGAGAGTGAGAGAGAACGCACC. (AG+A5)

[0036] In some embodiments of the present invention, the sequence of SEQ ID NO: 21 is: GGGAATATT AAGGTAAAAAGAGAGAGGTGAATTAGAGAGTAGCCACC. (GGG+A7)

[0037] In some embodiments of the present invention, the sequence of SEQ ID NO: 22 is: AGAATATTA AGGTAAAAAGAGAGAGGTGAATTAGAGAGTAGCCACC. (AG+A7)

[0038] In some embodiments of the present invention, the sequence of SEQ ID NO: 23 is: GGGAATATTATTGTAAAAAGAGAGTGAGAGAGAAGGGACC. (GGG+A9)

[0039] In some embodiments of the present invention, the sequence of SEQ ID NO: 24 is: AGAATATTATTGTAAAAAGAGAGTGAGAGAGAAGGGACC. (AG+A9)

[0040] In some embodiments of the present invention, the sequence of SEQ ID NO: 25 is: GGGAATATTAGGGTAAAAAGAGAGTGAGAGAGAAGGGACC. (GGG+A10)

[0041] In some embodiments of the present invention, the sequence of SEQ ID NO: 26 is: AGAATATTTAGGGTAAAAAGAGAGTGAGAGAGAAGGGACC. (AG+A10)

[0042] In some embodiments of the present invention, the sequence of SEQ ID NO: 27 is: GGGAATATTAGAGTAAAAAGAGAGTGAGAGAGAAGGGACC. (GGG+A11)

[0043] In some embodiments of the present invention, the sequence of SEQ ID NO: 28 is: AGAATATTAGAGTAAAAAGAGAGTGAGAGAGAAGGGACC. (AG+A11)

[0044] In some embodiments of the present invention, the sequence of SEQ ID NO: 29 is: GGGACATTT GCTTCTGACACAACTGTGTTCACTTCACGCATCAAACAGACACC. (GG G+B1)

[0045] In some embodiments of the present invention, the sequence of SEQ ID NO:30 is: AGACATTTGC TTCTGACACAACTGTGTTCACTTCACGCATCAAACAGACACC. (AG+B1)

[0046] In some embodiments of the present invention, the sequence of SEQ ID NO:31 is: GGGACATTT GCTTCTGACACAACTGTGTTCACTTCACGCATCAAACGGACACC. (GG G+B2)

[0047] In some embodiments of the present invention, the sequence of SEQ ID NO:32 is: AGACATTTGC TTCTGACACAACTGTGTTCACTTCACGCATCAAACGGACACC. (AG+B2)

[0048] In some embodiments of the present invention, the sequence of SEQ ID NO:33 is: GGGACATTT GCTTCTGACACAACTACATCAACTTCACTAATCATACGGCCACC. (GG G+B8)

[0049] In some embodiments of the present invention, the sequence of SEQ ID NO:34 is: AGACATTTGC TTCTGACACAACTACATCAACTTCACTAATCATACGGCCACC. (AG+B8)

[0050] In some embodiments of the present invention, the sequence of SEQ ID NO:35 is: GGGACATCT GCTTCTGACACAACTACATCAACTTCACTAATCATACGGCCACC. (GG G+B9)

[0051] In some embodiments of the present invention, the sequence of SEQ ID NO:36 is: AGACATCTGC TTCTGACACAACTACATCAACTTCACTAATCATACGGCCACC. (AG+B9)

[0052] The present invention also provides an expression cassette comprising the above 5'UTR element.

[0053] The present invention also provides an expression vector comprising: the above 5'UTR element and / or the above expression cassette and acceptable gene elements.

[0054] In some embodiments of the present invention, in the above expression vector, the gene elements include: one or more of a promoter, a Kozak sequence, a luciferase gene, a 3'UTR element, and a polyadenylation tail.

[0055] In some embodiments of the present invention, in the above expression vector, the promoter includes: T7 promoter.

[0056] In some embodiments of the present invention, in the above expression vector, the luciferase gene includes: Gaussia luciferase gene or firefly luciferase gene.

[0057] In some embodiments of the present invention, the above expression vector further comprises a backbone plasmid: pmRVac.

[0058] The present invention also provides a host for transforming and / or transfecting the above expression vector.

[0059] The present invention also provides the use of the above 5'UTR element, the above expression cassette, the above expression vector and / or the above host in in vitro transcription of mRNA.

[0060] The present invention also provides the above 5'UTR element, the above expression cassette, the above expression vector and / or the above host for improving the expression efficiency and / or capping efficiency of in vitro transcribed mRNA.

[0061] The present invention also provides a method for in vitro transcription of mRNA, which comprises linearizing the above expression vector, transcribing mRNA in vitro, and performing a capping reaction to obtain the mRNA.

[0062] The present invention provides a 5'UTR element, wherein the 5'UTR element has:

[0063] (1) a nucleotide sequence as shown in any of SEQ ID NO: 1 to SEQ ID NO: 12; or

[0064] (2) A nucleotide sequence obtained by substituting, deleting or adding one or more bases of the nucleotide sequence shown in (1), and having the same or similar function as the nucleotide sequence shown in (1); or

[0065] (3) A nucleotide sequence that is at least 80% identical to the nucleotide sequence shown in (1) or (2).

[0066] The beneficial effects of the present invention include:

[0067] (1) The capping efficiency of the 5′UTR sequence in the present invention is very high in in vitro synthesized mRNA.

[0068] (2) The capping efficiency of the 5′UTR sequence in the present invention is as high as over 80%.

[0069] (3) The expression efficiency of the 5′UTR sequence of the present invention in in vitro synthesized mRNA is higher than that of the existing modified 5′UTR sequence.

[0070] (4) Therefore, the expression efficiency and capping efficiency of the 5′UTR sequence of the present invention are extremely high among the known 5′UTR sequences in in vitro synthesized mRNA. BRIEF DESCRIPTION OF THE DRAWINGS

[0071] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for describing the embodiments or the prior art.

[0072] Figure 1 Shown is the map of mRNA expression vector;

[0073] Figure 2 The figure shows the intensity of cell expression effect of each designed 5′UTR AG version;

[0074] Figure 3 The intensity diagram of the expression effect of each designed 5′UTR GGG version in cell experiments is shown;

[0075] Figure 4 Shows a comparison data graph of the expression effect intensity of some embodiments and comparative examples;

[0076] Figure 5 The first group of GGG version mRNA fluorescence intensity images of mice in vivo imaging are shown;

[0077] Figure 6 The second group of GGG version mRNA fluorescence intensity images of mice in vivo imaging are shown;

[0078] Figure 7 The fluorescence intensity diagram of the first group of AG version mRNA in vivo imaging of mice is shown;

[0079] Figure 8 The second group of AG version mRNA fluorescence intensity images of mice in vivo imaging are shown;

[0080] Figure 9 The comparison of luminescence intensity of GGG version mRNA mice in vivo imaging;

[0081] Figure 10 Shown is a comparison of the luminescence intensity of AG version mRNA mice in vivo imaging. DETAILED DESCRIPTION

[0082] The invention discloses a 5'UTR element, an expression vector and applications thereof.

[0083] It should be understood that the expression "one or more of" includes individually each of the items recited after the expression and various combinations of two or more of the recited items, unless otherwise apparent from the context and usage. The expression "and / or" in conjunction with three or more recited items should be understood to have the same meaning, unless otherwise apparent from the context.

[0084] The terms "comprising", "having" or "containing", including their grammatical synonyms, should generally be understood as open and non-restrictive, e.g., not excluding other unrecited elements or steps, unless otherwise specifically stated or understood from the context.

[0085] It should be understood that the order of steps or the order in which certain actions are performed are not important as long as the present invention remains operable. Additionally, two or more steps or actions may be performed simultaneously.

[0086] The use of any and all examples or exemplary language, such as "such as" or "including," herein is intended merely to better illustrate the invention and does not limit the scope of the invention unless otherwise claimed. No language in this specification should be construed as indicating any non-claimed element as essential to the practice of the invention.

[0087] In addition, the numerical ranges and parameters used to define the present invention are approximate values. The relevant numerical values ​​in the specific examples have been presented as accurately as possible. However, any numerical value inherently inevitably contains standard deviations due to individual testing methods. Therefore, unless otherwise expressly stated, all ranges, amounts, values, and percentages used in this disclosure should be understood to be modified by the word "about." As used herein, "about" generally means that the actual value is within plus or minus 10%, 5%, 1%, or 0.5% of a specified value or range.

[0088] Regarding the detection of expression efficacy mentioned in the present invention: mRNA will translate into the corresponding protein within the cell. The Gaussia luciferase expression vector is capable of translating this protein within the cell, which reacts with the substrate coelenterazine to emit fluorescence. A microplate chemiluminescence detection instrument can detect the intensity of the chemiluminescence and convert it into a numerical value. Based on the magnitude of this numerical value, the expression level of Gaussia luciferase mRNA expression vectors containing different 5′ UTRs within the cell, i.e., the strength of the expression efficacy, can be compared.

[0089] The detection of capping efficiency mentioned in the present invention: The capping process during in vitro mRNA synthesis will form a variety of intermediate products. The molecular weights of all intermediate products and final products are calculated. The substances with corresponding molecular weights can be detected using the liquid chromatography-mass spectrometry method. The total value of all intermediate products and final products can be counted to calculate the ratio of capped products to all intermediate products and final products in the capping process, and the capping efficiency can be obtained.

[0090] There are many types of 5' caps for mRNA, the most important of which is Cap 1. The description of improving capping efficiency in this invention refers to increasing the proportion of Cap 1.

[0091] The sequence involved in the present invention is as follows:

[0092] GGG+A4: GGGACTCTTCTGCTCGCCACAGTCTCGAGACGAACGCAC C. (as shown in SEQ ID NO: 37)

[0093] GGG+A6: GGGAATATTAAGGTAAAAAGAGAGTGAGAGAGAAGCCAC. (as shown in SEQ ID NO: 38)

[0094] GGG+A8: GGGAATATTAAGGTAAGTTAGAGAGAGGTGAATTAGAG AGTAGCCACC. (As shown in SEQ IDNO:39)

[0095] GGG+B3:GGGACATTTGCTTCTGACACAACTGTGTTCACTTATTAGC TCAAACAGACACC. (As shown in SEQID NO:40)

[0096] GGG+B4:GGGACATTTGCTTCTGACACAACTGTGTTCACTTATTAGCTGAAACAGACACC. (As shown in SEQID NO:41)

[0097] GGG+B5: GGGACATTTGCTTCTGACACAACTAAATAAACTTCACAA ATCAAACGGACACC. (as shown in SEQ ID NO: 42)

[0098] GGG+B6:GGGACATTTGCTTCTGACACAACTAAATAAACTTCACAA ATCATACGGCCACC. (As shown in SEQID NO:43)

[0099] GGG+B7:GGGACATTTGCTTCTGACACAACTAAATAAACTTCACTA ATCATACGGCCACC. (As shown in SEQID NO:44)

[0100] GGG+B10: GGGACATCTGCTTCTGACACAACTACATCAACTTCACT AATTTTACGGCCACC. (As shown in SEQID NO:45)

[0101] AG+A4: AGACTCTTCTGCTCGCCACAGTCTCGAGACGAACGCACC (as shown in SEQ ID NO: 46)

[0102] AG+A6: AGAATATTAAGGTAAAAAGAGAGTGAGAGAGAAGCCACC. (as shown in SEQ ID NO:47)

[0103] AG+A8: AGAATATTAAGGTAAGTTAGAGAGAGGTGAATTAGAGAGTAGCCACC. (as shown in SEQ ID NO:48)

[0104] AG+B3: AGACATTTGCTTCTGACACAACTGTGTTCACTTATTAGCTCAACAGACACC. (as shown in SEQ ID NO:49)

[0105] AG+B4: AGACATTTGCTTCTGACACAACTGTGTTCACTTATTAGCTGAAACAGACACC. (as shown in SEQ ID NO:50)

[0106] AG+B5: AGACATTTGCTTCTGACACAACTAAATAAACTTCACAAATCAAACGGACACC. (as shown in SEQ ID NO:51)

[0107] AG+B6: AGACATTTGCTTCTGACACAACTAAATAAACTTCACAAATCATACGGCCACC. (as shown in SEQ ID NO:52)

[0108] AG+B7: AGACATTTGCTTCTGACACAACTAAATAAACTTCACTAATCATACGGCCACC. (as shown in SEQ ID NO:53)

[0109] AG+B10: AGACATCTGCTTCTGACACAACTACATCAACTTCACTAATTTTACGGCCACC. (as shown in SEQ ID NO:54)

[0110] C1: ACTCTTCTGGTCCCCACAGACTCAGAGAGAACCCACC. (as shown in SEQ ID NO:55)

[0111] GGG+C1: GGGACTCTTCTGGTCCCCACAGACTCAGAGAGAACCCACC. (as shown in SEQ ID NO:56)

[0112] GGG+C2: GGGAAATAAGAGAGAAAAGAAGAGTAAGAAGAAATAT AAGACCCCGGCGCC. (As shown in SEQ IDNO:57)

[0113] C3: AGACTCTTCTGGTCCCCACAGACTCAGAGAGAACCCACCCAAC CGCGGTTCGCGGCCGCT. (As shown in SEQ ID NO:58)

[0114] C4: AGGGGAAATAAGAGAGAAAAGAAGAGTAAGAAGAAATATAA GA. (As shown in SEQ ID NO:59)

[0115] C5: AGACTCTTCTGGTCCCCACAGACTCAGAGAGAACCCACCCCCC GGCGCC. (As shown in SEQ ID NO:60)

[0116] C6: AGGGCAGTAATAGAATGCTTTCAGGAAGATGACAGAATCAGG AGAAAGATGCTGTTTTGCACTATCTTGATTTGTTACAGCAGCCAACTTA TTGGCATGATGGAGTGACAGGAAAAACAGCTGGC. (As shown in SEQ ID NO:61)

[0117] C7: AGGGGCAAAAATCAAAATCAATCATCATCACAACATCAACAATCAATCATCAACACATCATCAAGACACCACC. (As shown in SEQ ID NO:62)

[0118] The sequence of AG+C1 is: AGACTCTTCTGGTCCCCACAGACTCAGAGAGAAC CCACC. (as shown in SEQ ID NO: 63)

[0119] In the examples and comparative examples of the present invention, all the raw materials and reagents used can be purchased from the market.

[0120] The present invention will be further described below in conjunction with the embodiments:

[0121] Example 1

[0122] 1. The inventors discovered poor intracellular expression using the GGG version of the 5′UTR sequence of the α-globin of human hemoglobin. Testing the mRNA capping efficiency revealed a Cap 1 ratio of 0%. Inputting this 5′UTR sequence into the RNA structure and energy prediction website (http: / / rna.tbi.univie.ac.at / / cgi-bin / RNAWebSuite / RNAfold.cgi) revealed a low thermodynamic free energy, suggesting that this low thermodynamic free energy may hinder capping. To verify the relationship between mRNA 5′UTR capping efficiency and its thermodynamic free energy, and to identify 5′UTR sequences with high capping efficiency, the inventors developed the present invention.

[0123] 2. Based on the length of the 5′UTR sequence of the α-globin of human hemoglobin and the inventors' speculation about the relationship between the thermodynamic free energy of the 5′UTR sequence and capping efficiency, the inventors designed nine 5′UTR sequences with the same length as the 5′UTR sequence of the α-globin of human hemoglobin (37 nt), one 5′UTR sequence with a length of 44 nt, and one 5′UTR sequence with a length of 45 nt, for a total of 11 5′UTRs, which were designated as Experimental Group A. Furthermore, to explore whether the length of the 5′UTR affects the relationship between its own thermodynamic free energy and capping efficiency, the inventors designed 10 5′UTR sequences with a length of 50 nt, which were designated as Experimental Group B. To explore whether the relationship between the thermodynamic free energy of the 5′UTR sequence and capping efficiency has the same effect under different in vitro transcription processes, the 5′UTR sequences of Groups A and B were prefixed with GGG or AG, allowing in vitro mRNA synthesis using different transcription processes, and are referred to as GGG version or AG version.

[0124] 3. The thermodynamic free energy values ​​of the GGG version 5′UTR are shown in Table 1:

[0125] Table 1 Prediction of thermodynamic free energy of designed 5′UTR

[0126]

[0127]

[0128]

[0129] 4. Apply the new 5′UTR sequence to the mRNA expression vector containing the Gaussia luciferase gene. Figure 1 As shown, the mRNA expression vector includes T7 promoter, 5′UTR, Kozak sequence, Gaussia luciferase gene, 3′UTR, polyadenylation tail, pmRVac vector and other parts.

[0130] 5. Construct the corresponding mRNA expression vector using genetic engineering methods and transform the expression vector into E. coli. Grow the transformed E. coli on LB plates containing agar and kanamycin. Pick a single colony and inoculate it in LB liquid medium containing kanamycin and culture it overnight. Extract the plasmid using a plasmid extraction kit. Verify the correct base sequence of the target region in the plasmid, from the T7 promoter to the polyadenylation tail, by Sanger sequencing.

[0131] 6. Inoculate the glycerol bacteria corresponding to the plasmid with the correct sequence verified by Sanger sequencing into LB liquid medium containing kanamycin, culture overnight, preserve the bacterial solution with glycerol, and extract the plasmid using an endotoxin-free plasmid extraction kit for the remaining bacterial solution.

[0132] 7. Take the plasmid from step 6 and cut it with restriction endonuclease to linearize it. Purify the linearized plasmid using a DNA purification and recovery kit. After purification, perform agarose gel electrophoresis on the sample to confirm that the enzyme cutting is complete.

[0133] 8. Using the linearized DNA from step 7 as a template, synthesize mRNA by in vitro transcription and perform capping to obtain mature mRNA containing a 5′ end cap structure (GGG version) or synthesize mature mRNA containing a cap structure in vitro by co-transcriptional capping (AG version). Purify the mRNA using an mRNA purification kit. Determine the concentration of the mRNA sample and perform gel electrophoresis on a denaturing agarose gel to verify the integrity of the mRNA.

[0134] 9. Transfect the mRNA from step 8 into HEK293T cells and culture at 37°C. At four time points after transfection (6, 24, 48, and 72 hours), aspirate the cell culture supernatant and mix it with the substrate and reaction buffer. The expressed product, Gaussia luciferase, will react with its substrate, coelenterazine, to produce an enzymatic reaction, generating chemiluminescence. Measure the chemiluminescence intensity using a microplate chemiluminescence analyzer and convert it into a numerical value to indicate the expression efficiency of the product. The chemiluminescence intensity of the expression product can be used to determine the expression efficiency of the mRNA with different 5′ UTRs.

[0135] 10. Use liquid chromatography-mass spectrometry to measure the mRNA capping efficiency.

[0136] According to the intracellular expression effect data and capping efficiency data, 5'UTR sequences with better intracellular expression efficiency than the 5'UTR of comparative example C1 and Cap 1 capping efficiency greater than 80% were screened.

[0137] Cap 1 efficiency is calculated as the percentage of the mass spectrometry peak area of ​​Cap 1 to the sum of the peak areas of the substrate, all intermediates, and the final product during the capping process. A Cap 1 ratio greater than 80% is considered excellent, and a higher percentage is better.

[0138] The results of the mRNA capping efficiency test for the GGG and AG versions are shown in Table 2. The mRNA Cap 1 ratios for the designed 5′UTRs all exceeded 80%. These experimental results suggest that the mRNA capping efficiency of the GGG version is affected to some extent by the thermodynamic free energy of its 5′UTR sequence, whereas the capping efficiency of the AG version of the mRNA may not be affected by the thermodynamic free energy of its 5′UTR sequence.

[0139] Table 2 Results of mRNA capping rate detection of the designed GGG and AG versions of 5′UTR

[0140]

[0141]

[0142]

[0143] 11. Use cell experiments to detect differences in mRNA expression.

[0144] HEK293T cells were transfected with Gaussia luciferase mRNA of various versions of 5′UTR using 12-well cell culture dishes at a transfection dosage of 0.3 μg / well. 20 μL of cell culture supernatant was collected at 6 h, 24 h, 48 h, and 72 h after transfection, mixed with the substrate coelenterazine and reaction buffer, and placed in a microplate chemiluminescence detector for chemiluminescence intensity detection.

[0145] The results of the intracellular expression effect verification experiment are as follows Figure 2 、 Figure 3 As shown in Tables 3 and 4.

[0146] Among them, the AG version of mRNA, with AG+C1 as the positive control and untransfected HEK293T cells as the blank control, the expression efficiency of AG+A1, AG+A2, AG+A3, AG+A4, AG+A5, AG+A6, AG+A7, AG+A10, AG+B1, and AG+B2 exceeded that of AG+C1.

[0147] Since the capping rate of GGG+C1 is extremely low, the expression efficiency of its mRNA expression vector in cells is affected by the capping rate and cannot be truly reflected. Therefore, a known better 5'UTR was used as a comparison for the expression efficiency in cells, which is C2. Among the modified vectors of the GGG version, using GGG+C2 as a positive control and untransfected HEK293T cells as a blank control, the following expression efficiencies exceeded GGG+C2: GGG+A1, GGG+A2, GGG+A3, GGG+A5, GGG+A7, GGG+A9, GGG+A10, GGG+A11, GGG+B1, GGG+B7, and GGG+B8.

[0148] Table 3 Data table of the cell expression effect intensity of each designed 5′UTR AG version

[0149]

[0150]

[0151] Table 4 Data table of expression effect intensity of each designed 5′UTR GGG version in cell experiments

[0152]

[0153]

[0154]

[0155]

[0156] The results of the intracellular expression effect verification experiment were analyzed for significant differences in the two groups of data in Tables 3 and 4, and the data at the 48-h time point were used for univariate analysis. The results are shown in Tables 5 and 6.

[0157] Table 5 GGG version significant difference analysis table

[0158]

[0159]

[0160] Table 6 AG version significant difference analysis table

[0161]

[0162] According to the results of the intracellular expression effect verification experiment, Table 5 and Table 6 show significant differences between the two groups of data. There are 8 GGG groups with significant differences: GGG+A1, GGG+A2, GGG+A5, GGG+A7, GGG+A9, GGG+A10, GGG+B1, and GGG+B8. There are 11 AG groups: AG+A1, AG+A3, AG+A4, AG+A5, AG+A6, AG+A7, AG+A10, AG+B1, AG+B2, AG+B4, and AG+B10. Based on the experimental results of the two groups, we determined that the related sequences with statistically significant differences are: A1, A2, A3, A4, A5, A6, A7, A9, A10, B1, B2, B4, B8, and B10. Although the differences between A11 and B9 and the control group were not significant, the cell experiment data showed that their expression effects were better than those of the control group.

[0163] Comparative Example

[0164] This comparative example selected 6 Gaussia luciferase mRNA expression vectors with good intracellular expression efficiency of 5'UTR (AG+C1, C3, C4, C5, C6, C7) and compared them with 4 5'UTRs (AG+A2, AG+A5, AG+A7, AG+A10) with high expression efficiency randomly selected from the sequence group with statistically significant differences in the embodiment of the present invention. The transfection dosage was 0.5 μg, and the experimental steps and other variables were consistent with the embodiment. Untransfected HEK293T cells were used as blank controls. The experimental results are shown in Tables 7 and Figure 4 As shown, the intracellular expression efficiency of AG+A2, AG+A5, AG+A7, and AG+A10 of the present invention is better than that of the comparative example.

[0165] Table 7 Comparison of expression effect intensity between some examples and comparative examples

[0166]

[0167]

[0168] The significant differences between Examples AG+A2, AG+A5, AG+A7, and AG+A10 and each comparative example were analyzed, and the data at the 48-h time point were used for single-factor analysis. The results are shown in Tables 8, 9, 10, and 11.

[0169] Table 8 Analysis of significant differences between AG+A2 and comparative examples

[0170]

[0171]

[0172] Table 9 Analysis of significant differences between AG+A5 and comparative examples

[0173]

[0174] Table 10 Analysis of significant differences between AG+A7 and comparative examples

[0175]

[0176] Table 11 Analysis of significant differences between AG+A10 and comparative examples

[0177]

[0178]

[0179] Based on the cell experiments and significance difference analysis results of the above examples (AG+A2, AG+A5, AG+A7, AG+A10) and the comparative examples (AG+C1, C3, C4, C5, C6, C7), it can be concluded that the expression effects of AG+A5 and AG+A7 were significantly higher than those of the comparative examples C1, C3, C4, C5, C6, and C7. The expression effect of AG+A10 was partially significantly different from that of the comparative examples. The expression effect of AG+A2 was not significantly different from that of the comparative examples.

[0180] Comparative Example Description: Comparative Example C1 is the 5′UTR sequence of wild-type human hemoglobin α-globin. C2-C7 are 5′UTR sequences published in the literature or NCBI, and their thermodynamic free energy prediction data are shown in Table 12.

[0181] Table 12 Comparative example thermodynamic free energy prediction and capping efficiency data

[0182]

[0183] Verification example Firefly luciferase

[0184] Mouse experiments:

[0185] Since Gaussia luciferase is secreted, it will be secreted outside the cells after being expressed in mice and spread throughout the body with the blood, which is not conducive to signal collection. Therefore, the non-secreted firefly luciferase gene was used to explore its expression in mice. 2+ In the presence of ATP and O2, it can catalyze the oxidative decarboxylation of D-luciferin and emit visible light with a wavelength of 550-580nm.

[0186] From the results of Gaussia luciferase cell experiments, a 5′UTR with good expression was selected to construct a firefly luciferase mRNA expression vector. There are two versions: AG and GGG. The same method was used to construct firefly luciferase gene expression vectors containing different 5′UTRs to obtain mRNA. To ensure that firefly luciferase mRNA enters mouse cells more stably, the inventors used lipid nanoparticles (LNPs) to encapsulate the mRNA to form LNP-mRNA. The LNP concentration, encapsulation efficiency, particle size, potential, aggregation index, and other parameters were measured. The LNP quality test data are shown in Table 13.

[0187] Table 13 LNP quality test data

[0188]

[0189] Eight-week-old ICR mice were weighed and injected with LNP-mRNA via the tail vein at a dose of 0.25 mg / kg. Six hours later, the substrate solution was injected intraperitoneally, and in vivo imaging experiments were performed after anesthesia.

[0190] The experimental results are as follows Figures 5 to 10 As shown in Table 14:

[0191] Table 14 Luminescence intensity data of mouse in vivo imaging

[0192]

[0193]

[0194] The significance analysis of the mouse in vivo imaging luminescence intensity data table was performed. The results are shown in Table 15:

[0195] Table 15. Comparative significance difference analysis between GGG+A2 and GGG+C1

[0196]

[0197] Table 16 Analysis of significant differences between AG+A2 and AG+C1

[0198]

[0199] From the above in vivo mouse experiments and the results of the significant difference analysis, it can be seen that the expression effect of Example GGG+A2 in mice is slightly better than that of Comparative Example GGG+C2; the expression effect of Example AG+A2 is slightly better than that of Comparative Example AG+C1, and the difference is not significant.

[0200] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications should also be regarded as within the scope of protection of the present invention.

Claims

1. 5' UTR element, characterized in that The nucleotide sequence of the 5'UTR element is shown in SEQ ID NO:

2. 2.5' UTR element, characterized in that The nucleotide sequence of the 5'UTR element is shown in SEQ ID NO: 15 or SEQ ID NO:

16.

3. An expression cassette, characterized in that include: The 5'UTR element according to claim 1 or 2.

4. An expression vector, characterized in that include: The 5'UTR element according to claim 1 or 2 and / or the expression cassette according to claim 3 and acceptable genetic elements.

5. The expression vector according to claim 4, wherein The gene elements include one or more of a promoter, a Kozak sequence, a luciferase gene, a 3'UTR element and a polyadenosine tail.

6. Use of the 5'UTR element according to claim 1 or 2, the expression cassette according to claim 3 and / or the expression vector according to claim 4 or 5 in in vitro transcription of mRNA.

7. The 5'UTR element according to claim 1 or 2, the expression cassette according to claim 3, and / or the expression vector according to claim 4 or 5, improves the expression efficiency and / or capping efficiency of in vitro transcribed mRNA.

8. A method for in vitro transcription of mRNA, characterized in that The expression vector according to claim 4 or 5 is linearized, and then mRNA is transcribed in vitro and capped to obtain the mRNA.

Citation Information

Patent Citations

  • Nucleic acid molecule and application thereof as promoter

    CN116555259A

  • Artificial optimization design 5UTR sequence for improving translation expression of exogenous gene

    CN117230062A