Molecular genetic marker associated with shank length at different ages in chicken and application thereof

By identifying the T/T genotype molecular marker at chr27:6079608bp in the intron region of the chicken IGF2BP1 gene, the problem of shank length trait improvement in broiler breeding was solved, achieving early, rapid, and low-cost breeding results and improving the prediction accuracy of shank length trait in chickens.

CN118667968BActive Publication Date: 2025-11-21CHINA AGRI UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202410839771.3
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-06-26
Publication Date
2025-11-21
Estimated Expiration
2044-06-26

AI Technical Summary

Technical Problem

There is a lack of clear and significant molecular markers in existing broiler breeding, making it difficult to effectively improve the shank length trait in chickens.

Method used

The T/T genotype at the SNP site chr27:6079608bp in the intron region of the chicken IGF2BP1 gene was discovered and used as a molecular marker. Through resequencing technology and GWAS analysis, its significant correlation with the chicken shank length trait was determined. Specific primer pairs were used for genotyping to carry out marker-assisted selection breeding.

Benefits of technology

It enables early, rapid, and low-cost prediction of chicken weight, improving the shank length trait in breeding populations, and has broad application prospects and economic value.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN118667968B_ABST
    Figure CN118667968B_ABST
Patent Text Reader

Abstract

The present application relates to a SNP molecular marker related to shank length of different ages of chicken and application. The present application discloses a SNP site related to shank length of 6 weeks, 8 weeks and 10 weeks of chicken, the site is in the intron region of IGF2BP1 gene, the genomic position is chr27:6079608bp of GRCg6a 104. The SNP marker exists three genotypes, T / T, C / C and T / C, wherein T / T corresponds to higher shank length and body weight. In the chicken with high shank length, T is the dominant allele, by selecting the T / T genotype of the SNP site, early selection of the shank length trait of chicken can accelerate the genetic breeding of chicken.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of molecular biology, specifically to a molecular genetic marker associated with shank length at different ages of chickens and its application. Background Technology

[0002] Chicken is one of the main meat varieties in China, characterized by high protein, low fat, and low cholesterol. In recent years, my country's chicken production has continued to grow, and improving muscle yield and chicken quality has been a long-term focus for breeding scientists. Classical breeding methods have made significant contributions to the improvement of agricultural animal production traits. With the continuous advancement of genomics work and the extensive development of genetic markers, breeding scientists can select chickens with good yield and quality characteristics for breeding based on specific genetic markers. These genetic markers can help breeding scientists more accurately assess and select chickens for genetic potential, accelerating the breeding process.

[0003] SNPs (Single Nucleotide Polymorphisms) are one of the most common forms of genetic variation in genetics. SNPs are characterized by their large quantity, high frequency, and low mutation rate, playing a crucial role in genetic research and molecular selection breeding. However, current molecular breeding practices for broiler chickens still lack molecular markers with clearly defined functions and significant effects. Therefore, identifying high-efficiency, accurate molecular markers is a current research focus. Furthermore, if we can find SNP molecular markers associated with target traits in chickens and ultimately elucidate the molecular mechanisms underlying these sites, it will greatly promote genetic improvement in chickens and bring breakthrough progress to the field of poultry breeding. Summary of the Invention

[0004] To address the shortcomings of existing technologies, the present invention aims to provide a molecular genetic marker associated with shank length at different ages in chickens and its application. The invention discloses a SNP locus associated with shank length in chickens at 6, 8, and 10 weeks of age. This locus is located in the intron region of the IGF2BP1 gene, at chr27:6079608 bp of GRCg6a 104. This SNP marker has three genotypes: T / T, C / C, and T / C, with T / T corresponding to higher shank length and body weight. In chickens with high shank length, T is the dominant allele. By optimizing the T / T genotype at this SNP locus, early selection of the shank length trait can accelerate chicken genetic breeding.

[0005] To achieve the above objectives, the technical solution adopted by the present invention is as follows:

[0006] A SNP molecular marker associated with shank length at different ages of chickens, characterized in that the SNP molecular marker is located at chr27:6079608bp in genomic version GRCg6a 104, and the alleles of the SNP molecular marker are T and C.

[0007] The specific process for obtaining this SNP molecular marker is as follows:

[0008] Resequencing technology was used to sequence 1118 individuals from a hybrid chicken population with shank length records at different ages, and GWAS analysis was performed. A SNP locus significantly associated with shank length at different ages was obtained. This SNP is rs315116280 (chr27:6079608) located in genome version GRCg6a 104. This locus contains three genotypes: T / T, C / C, and T / C.

[0009] Based on the above scheme, the dominant allele of the SNP molecular marker is T. This result was obtained by statistically analyzing the SNP frequency in other low-weight and high-weight chicken breeds during resequencing. It was found that the SNP frequency distribution differed significantly between low-weight and high-weight chicken breeds, with T being the dominant allele in high-weight chickens and C being the dominant allele in low-weight chickens.

[0010] Based on the above scheme, the SNP molecular marker is located at base 101 of the nucleotide sequence shown in SEQ ID NO.1. The sequence shown in SEQ ID NO.1 is the 6079508bp–6079708bp fragment in chr27 of genome version GRCg6a 104.

[0011] Application of a SNP molecular marker associated with shank length at different ages in chickens in marker-assisted selection breeding.

[0012] Based on the above scheme, the marker-assisted selection breeding of chickens specifically involves selecting chickens with long shanks through SNP loci for breeding.

[0013] Based on the above scheme, the application of the SNP molecular markers related to shank length at different ages of chickens in marker-assisted selection breeding of chickens includes the following steps:

[0014] Step 1: Detect the genotype of the sample chickens at the SNP molecular marker;

[0015] Step 2: Select chicken breeds with the genotype T / T for breeding.

[0016] Based on the above scheme, step 1 is performed by direct sequencing or by first amplifying the fragment containing the SNP molecular marker and then sequencing.

[0017] Primer pairs for amplifying fragments containing the above-mentioned SNP molecular markers are characterized in that the nucleotide sequences of the primer pairs are as shown in SEQ ID NO.2 and SEQ ID NO.3;

[0018] F:GTTTTTTGGTAACAAACTGA(SEQ ID NO.2)

[0019] R:AGGAAGGAGGTAAAAAAAA(SEQ ID NO.3)

[0020] The primer pair is used to amplify a fragment containing the SNP molecular marker from the sequence shown in SEQ ID No. 1.

[0021] The molecular genetic marker associated with shank length at different ages in chickens described in this invention and its application have the following beneficial effects:

[0022] A GWAS study was conducted on a hybrid population of 1118 chickens with shank length records at different ages using resequencing technology. Analysis of the GWAS results revealed a SNP (chr27:6079608) significantly associated with shank length. SNP frequency analysis of this locus in low-weight and high-weight chicken breeds showed significant differences in frequency distribution between the two groups. In high-weight chickens, A was the dominant allele, while in low-weight chickens, G was the dominant allele. The fact that high-weight chickens weigh more than low-weight chickens indicates that this SNP locus can be used as a molecular marker for the selection of superior chicken breeds. In lower-weight populations, selecting individuals with allele T can increase the overall weight of the population. This invention, by detecting SNP molecular markers, can predict body weight early, rapidly, cost-effectively, and efficiently, showing broad application prospects in chicken breed improvement and promising significant economic value. Attached Figure Description

[0023] The present invention includes the following figures:

[0024] Figure 1 Manhattan plot of 6-week-old tibia length GWAS results;

[0025] Figure 2 Manhattan plot of GWAS results for tibial length at 8 weeks of age;

[0026] Figure 3 Manhattan plot of 10-week-old tibia length GWAS results. Detailed Implementation

[0027] The following embodiments further illustrate the content of the present invention, but should not be construed as limiting the present invention. Any modifications or substitutions made to the methods, steps, or conditions of the present invention without departing from the spirit and essence of the invention are within the scope of the present invention.

[0028] Example 1: Genome-wide association analysis of tibia length at different ages in chickens

[0029] 1. Test materials

[0030] Using individuals from a hybrid chicken population as the research subject, the left tibia length of 1118 individuals was measured at 6, 8, and 10 weeks of age, and the measurement was strictly carried out in accordance with the internal standards of the chicken farm.

[0031] 2. Test Methods

[0032] 2.1 Phenotypic determination

[0033] When chickens reach 6, 8, and 10 weeks of age, measure the shank length of the left leg using a measuring tape. Extend the chicken's left leg and, starting from the end of the leg (ankle), move upwards to the top of the tibia (leg bone). Place the measuring tape close to the outside of the chicken's leg and measure in a straight line along the top of the tibia to the ankle. Ensure the measuring tool is perpendicular to the chicken's leg and record the length; this is the shank length.

[0034] 2.2 Chicken whole-genome SNP genotyping method based on resequencing technology

[0035] Sequencing data were aligned to the GRCg6a 104 reference genome using GTX Align, and SNP loci were detected using Basevar. The genotype probability of all individuals was estimated using STITCH. For SNP loci obtained through genotyping, filtering was performed based on MAF < 0.05, locus call rate < 0.95, and info score < 0.4, retaining a total of 7,901,521 high-quality SNPs.

[0036] 2.3 Genome-wide association analysis

[0037] Genome-wide association analysis was performed on tibia length phenotypes in 1118 chickens at different weeks of age using fastGWA.

[0038] 2.4 SNP sites significantly associated with tibia length trait

[0039] Detection of significant loci at the genomic level: significant loci are identified based on FDR < 0.05.

[0040] 3. Results and Analysis

[0041] This invention used 1118 chickens from a hybrid population as subjects. Using resequencing technology, 7,901,521 SNPs were obtained, and GWAS analysis was performed on the tibia length at different ages of chickens. A SNP locus (chr27: 6079608) significantly correlated with tibia length at different ages was identified. Figure 1-3 As shown.

[0042] Example 2: Frequency distribution of SNP (chr27: 6079608) in different chicken breeds

[0043] 1. Test materials

[0044] Low-weight chicken breeds: Bearded Chicken (n=15), Camellia Chicken (n=30), Daweishan Miniature Chicken (n=33) and Tibetan Chicken (n=154).

[0045] High-weight chicken breeds include: Lingnan Yellow-feathered Broiler (n=16), White-feathered Broiler (n=20), Kebao Chicken (n=33), and Recessive White-feathered Chicken (n=113).

[0046] 2. Test Methods

[0047] 2.1 Data Collection

[0048] The whole-genome resequencing data from the above four low-weight chicken breeds and four high-weight chicken breeds were downloaded from the NCBI SRA database (https: / / ncbi.nlm.nih.gov / sra).

[0049] 2.2 SNP typing using GATK

[0050] The gVCF was constructed based on the GRCg6a 104 reference genome using the gtx wgs command on the GTX server. Then, the gtx gi and gtx joint commands were used to perform joint variant detection on all gVCF samples and obtain genotype VCF files.

[0051] 2.3 SNP Filtration and Quality Control

[0052] After the combined variant detection was completed, SNPs were extracted using the SelectVariants tool in the GATK software package. Subsequently, the whole genome resequencing data were quality controlled using the VariantFiltration tool in the GATK software package according to the following hard filtering parameters: MQ < 40.0, FS > 60.0, SOR > 3.0, MQRankSum < -12.5, ReadPosRankSum < -8.0, QUAL < 30. After the above quality control, a total of 44,272,587 resequencing SNPs were obtained.

[0053] 2.4 Calculation of allele frequencies of chr27:6079608 in different chicken breeds

[0054] The allele frequencies of chr27:6079608 in different chicken breeds were calculated using vcftools--freq2.

[0055] 2.5 Amplification of the target fragment

[0056] DNA was extracted from blood tissue samples of the hybrid population using a total DNA extraction kit from Beijing Tiangen Biotech Co., Ltd. The extracted DNA concentration and purity were determined by measuring the OD values ​​(OD260 / OD280 and OD260 / OD230 ratios) using a NanoDrop 2000 spectrophotometer, and DNA integrity was assessed by agarose gel electrophoresis. Using the genome of the hybrid population samples as a template, primers were designed using Oligo7 software, and sequence amplification was performed using Novizan 2×Taq Master Mix. The reaction system was as follows: 95℃, pre-denaturation for 3 min; 95℃, denaturation for 15 s, 60℃, annealing for 15 s, 72℃, extension for 15 s, 30 cycles; 72℃, complete extension for 5 min. Finally, agarose gel electrophoresis was used to determine the fragment size of the product.

[0057] 3. Results and Analysis

[0058] Table 1 shows the SNP frequency distribution of SNP (chr27: 6079608) in different low-weight and high-weight chicken breeds, with significant differences between the two breeds. T is the dominant allele in high-weight chickens, while C is the dominant allele in low-weight chickens.

[0059] Table 1. SNP frequency (chr27: 6079608) in different low-weight and high-weight chicken breeds.

[0060]

[0061] Analysis revealed a SNP molecular marker associated with shank length at different ages in chickens. In a low-weight population, breeding individuals with the T / T allele could increase the body weight of the breeding population.

[0062] Although the present invention has been described in detail above with general descriptions, specific embodiments, and experiments, modifications or improvements can be made to it, which will be obvious to those skilled in the art. Therefore, all such modifications or improvements made without departing from the spirit of the present invention fall within the scope of protection claimed by the present invention.

[0063] The contents not described in detail in this specification are existing technologies known to those skilled in the art.

Claims

1. Application of a SNP molecular marker associated with tibia length at different ages of chickens in tibia length trait-assisted selection breeding of chickens at 6, 8 and 10 weeks of age; The SNP molecular marker is located at chr27:6079608 bp in genome version GRCg6a; The alleles of the SNP molecular marker are T and C.

2. The application as described in claim 1, characterized in that: The assisted selection breeding specifically involves using SNP loci to assist in the selection of chickens with long shanks for breeding.

3. The application as described in claim 2, characterized in that, Includes the following steps: Step 1: Detect the genotype of the sample chickens at the SNP molecular marker; Step 2: Select chicken breeds with the genotype T / T for breeding.

4. The application as described in claim 3, characterized in that, Step 1 is performed by direct sequencing or by first amplifying the fragment containing the SNP molecular marker and then sequencing.

Citation Information

Patent Citations

  • IGF2BP1 gene molecular marker related to chicken body size character as well as application and breeding method of IGF2BP1 gene molecular marker

    CN115198022A

  • Local chicken 40K whole genome SNP liquid phase chip and application thereof

    CN117604115A