Method for detecting mycotoxins based on bimetallic nanoszyme paper-based colorimetry and application thereof

By using a bimetallic nanozyme UiO66-NH2@Pt/Pd material modified with nucleic acid aptamers, combined with a colorimetric reaction and smartphone reading of RGB values, the selectivity and sensitivity issues of paper-based colorimetric detection of fungi toxins have been resolved, enabling rapid and reliable multiplex sample detection.

CN118671333BActive Publication Date: 2026-01-06HUNAN UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202310256836.7
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-03-16
Publication Date
2026-01-06
Estimated Expiration
2043-03-16

AI Technical Summary

Technical Problem

Existing paper-based colorimetric methods for detecting mycotoxins suffer from low selectivity and low sensitivity, making it difficult to achieve rapid and reliable detection of multiple samples.

Method used

A bimetallic nanozyme, UiO66-NH2@Pt/Pd, modified with nucleic acid aptamers, was used to establish a linear response relationship between fungal toxin concentration and color intensity by combining a colorimetric reaction with RGB value readings via a smartphone, enabling qualitative and quantitative detection.

Benefits of technology

It achieves low-cost, easy-to-operate, on-site detection with high selectivity and high sensitivity, and can complete the detection of multiple samples within 20 minutes. The detection limit is 0.09 ng/mL, and it is suitable for the specific detection of aflatoxin B1.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN118671333B_ABST
    Figure CN118671333B_ABST
Patent Text Reader

Abstract

The application discloses a kind of based on bimetallic nanometer enzyme paper-based colorimetric detection mycotoxin method and application, method includes first preparing bimetallic nanometer enzyme UiO66-NH2@Pt / Pd, then nucleic acid aptamer modified UiO66-NH2@Pt / Pd is loaded on paper-based chip, different mycotoxin concentration sample is added dropwise to carry out reaction, then add color developing agent containing TMB and H2O2 and carry out color developing reaction, utilize smart phone to identify color intensity and obtain RGB value, select the linear curve of the highest fitting degree between mycotoxin concentration and RGB value as mycotoxin detection standard curve, then according to the RGB value of measured sample, the content of mycotoxin is detected.The method of the application has the advantages of low cost, simple operation, rapid response, strong anti-interference ability, wide detection range, can be used for on-site detection, etc., can be applied to detect the residue of mycotoxin in environment and food.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of colorimetric sensing technology and relates to a paper-based colorimetric detection method for fungal toxins, specifically a method and application of paper-based colorimetric detection of fungal toxins based on bimetallic nanozymes. Background Technology

[0002] Aflatoxin contamination of the food supply increases the risk of hepatocellular carcinoma (HCC) in the population. Mycotoxin contamination poses a significant threat to global food security, human health, and the environment. Traditional methods, which typically require multiple analytical steps, cumbersome pretreatment, expensive instrumentation, time-consuming procedures, and skilled technicians, limit their widespread application. Therefore, developing low-cost, easy-to-use, and rapid methods for the detection and identification of AFB1 remains urgently needed. Bimetallic nanozyme paper-based colorimetric detection has attracted widespread attention due to its simplicity, cost-effectiveness, visualization, and field application. However, current paper-based detection methods generally suffer from low selectivity, low sensitivity, and difficulty in simultaneously detecting two or more samples. Therefore, developing a rapid, reliable, and simple multiplex assay method for AFB1 compounds is crucial. Summary of the Invention

[0003] The technical problem to be solved by the present invention is to overcome the shortcomings of the prior art and provide a method and application for colorimetric detection of fungal toxins based on bimetallic nanozymes paper, which is low in cost, easy to operate, visible to the naked eye, can be detected on-site, has high selectivity and high sensitivity.

[0004] To solve the above-mentioned technical problems, the present invention adopts the following technical solution.

[0005] A method for colorimetric detection of fungal toxins based on bimetallic nanozymes on a paper substrate includes the following steps:

[0006] S1. Preparation of nucleic acid aptamer-modified bimetallic nanozyme UiO66-NH2@Pt / Pd:

[0007] S1.1. Zirconium chloride, 2-aminoterephthalic acid, benzoic acid and hydrochloric acid are dissolved in N,N-dimethylformamide and heated at 80℃~200℃ to obtain UiO66-NH2 solution.

[0008] S1.2 Add potassium chloroplatinate and sodium chloropalladium to UiO66-NH2 solution, then add ascorbic acid solution. After drying the resulting mixture, obtain UiO66-NH2@Pt / Pd.

[0009] S1.3 Disperse the UiO66-NH2@Pt / Pd obtained in step S1.2 in sodium acetate-acetic acid buffer solution to obtain solution A. Then add the nucleic acid aptamer to solution A and mix to obtain nucleic acid aptamer modified UiO66-NH2@Pt / Pd, which is solution B.

[0010] S2. Preparation of detection unit: Cut filter paper into multiple paper-based chips, then soak them in solution B, and then take them out and dry them to obtain bimetallic nanozyme paper-based detection chip;

[0011] S3. Sample detection: Samples containing different concentrations of mycotoxins are dropped onto multiple bimetallic nanozyme paper-based detection chips and reacted for 5 min to 30 min. Then, an acetate-sodium acetate buffer solution containing TMB and H2O2 is dropped on and a colorimetric reaction is carried out for 1 min to 20 min.

[0012] S4. Detection and Identification: Take a picture of the colorimetric bimetallic nanozyme paper-based detection chip with a mobile phone, read the color intensity and convert it into RGB values, establish the detection linear response relationship between fungal toxin concentration and RGB, and select the curve with the highest fitting degree as the fungal toxin detection standard curve.

[0013] S5. Based on the mycotoxin detection standard curve obtained in step S4 and the RGB values ​​measured on the sample containing mycotoxin, the concentration of mycotoxin in the sample is obtained.

[0014] In the above-described method for colorimetric detection of mycotoxins based on bimetallic nanozyme paper, preferably, in step S3, when a sample without mycotoxins is added to the bimetallic nanozyme paper-based detection chip for incubation, an acetate-sodium acetate buffer solution containing TMB and H2O2 is added to react, and the bimetallic nanozyme paper-based detection chip turns light blue; when a sample containing mycotoxins is incubated on the paper-based detection chip, an acetate-sodium acetate buffer solution containing TMB and H2O2 is added to react, and the blue color of the bimetallic nanozyme paper-based detection chip deepens, thereby qualitatively detecting whether the sample contains mycotoxins.

[0015] In the above-described method for colorimetric detection of mycotoxins based on bimetallic nanozyme paper substrate, preferably, the mycotoxin is aflatoxin B1, the nucleotide sequence of the nucleic acid aptamer is shown in SEQ ID No. 1, and the linear regression equation for the detection of mycotoxin concentration and the RGB values ​​of the bimetallic nanozyme paper substrate detection chip is as follows:

[0016] R / G = 0.6060 -0.0617 lgC (1)

[0017] In equation (1), R / G represents the RGB values ​​converted by the smartphone, C is the concentration of mycotoxins in the sample to be tested, in ng / mL, and the correlation coefficient R in equation (1) is... 2 =0.983, the linear range for the detection of mycotoxins is 0.1 ng / mL to 1000 ng / mL, and the limit of detection is 0.09 ng / mL.

[0018] The nucleotide sequence SEQ ID No. 1 of the above-mentioned nucleic acid aptamer is shown below:

[0019] GGGCACGTGTTGTCTCTCTGTGTCTCGTGCCC

[0020] In the above-mentioned method for colorimetric detection of fungal toxins based on bimetallic nanozymes on paper, preferably, in step S1.1, the ratio of zirconium chloride, 2-aminoterephthalic acid, benzoic acid, hydrochloric acid and N,N-dimethylformamide is 1 mol: 1 mol to 5 mol: 10 mol to 20 mol: 0.5 mol to 2 mol: 30 mL to 45 mL.

[0021] In the above-mentioned method for colorimetric detection of fungal toxins based on bimetallic nanozymes on paper, preferably, in step S1.1, the heating time is 15h to 30h.

[0022] In the above-described method for colorimetric detection of mycotoxins based on bimetallic nanozymes on paper, preferably, in step S1.2, the mass concentration ratio of potassium chloroplatinate, sodium chloropalladium, UiO66-NH2, and ascorbic acid in the mixed solution is 1-10:1-2:1:10-30.

[0023] In the above-described method for colorimetric detection of mycotoxins based on bimetallic nanozymes on paper, preferably, in step S1.3, the concentration of UiO66-NH2@Pt / Pd in ​​the sodium acetate-acetic acid buffer solution is 50 μg / mL to 100 μg / mL, the pH of the sodium acetate-acetic acid buffer solution is 2 to 5, the sodium acetate concentration is 0.1 M to 0.3 M, and the concentration of the nucleic acid aptamer in solution A is 0.5 μM to 2 μM.

[0024] In the above-described method for colorimetric detection of fungal toxins based on bimetallic nanozymes on paper, preferably, in step S2, the drying temperature is 2℃~40℃ and the drying time is 5min~25min.

[0025] In the above-described method for colorimetric detection of mycotoxins based on bimetallic nanozymes on paper, preferably, in step S3, the concentration of hydrogen peroxide in the acetate-sodium acetate buffer solution containing TMB and H2O2 is 5 mM to 20 mM, the concentration of TMB is 0.5 mM to 2 mM, the pH of the acetate-sodium acetate buffer solution is 2 to 5, and the concentration of sodium acetate is 0.1 M to 0.3 M.

[0026] As a general technical concept, the present invention also provides an application of the above-mentioned method for colorimetric detection of mycotoxins based on bimetallic nanozymes on paper in the detection of mycotoxins in the environment or food.

[0027] In this invention, TMB refers to 3,3',5,5'-tetramethylbenzidine.

[0028] In this invention, the concentration unit M represents mol / L.

[0029] The detection principle of this invention is mainly as follows:

[0030] This invention utilizes a bimetallic nanozyme material, UiO66-NH2@Pt / Pd, exhibiting excellent peroxidase-like activity. This nanozyme catalyzes the oxidation of TMB to a blue color in the presence of H2O2. By functionalizing UiO66-NH2@Pt / Pd with nucleic acid aptamers, the aptamers adsorb onto the bimetallic nanozyme material via electrostatic interactions, masking some of the active sites of UiO66-NH2@Pt / Pd. This results in a decrease in the peroxidase-like activity of UiO66-NH2@Pt / Pd, thereby inhibiting the decomposition of hydrogen peroxide and weakening its oxidation ability towards the substrate 3,3',5,5'-tetramethylbenzidine. On the other hand, because the nucleic acid aptamers can specifically recognize the target analyte, the higher affinity causes the aptamers to desorb from UiO66-NH2@Pt / Pd, gradually restoring its enzyme-like activity, causing the color of the paper-based sensor chip to change from light blue to dark blue. By combining nucleic acid aptamers to enhance the selectivity of UiO66-NH2@Pt / Pd and regulate its enzyme activity, the nucleic acid aptamer-functionalized UiO66-NH2@Pt / Pd is integrated with paper-based analytical equipment. The color changes generated by the paper-based detection chip are read and identified by a smartphone and converted into readable RGB values. Based on the above colorimetric detection strategy, a paper-based carrier detection platform is established to achieve colorimetric detection of fungal toxins (such as aflatoxin B1), thereby achieving the goal of on-site visualization, qualitative and quantitative detection of target substances.

[0031] The applicant discovered that while bimetallic particles exhibit good enzyme activity, their tendency to aggregate and migrate through their pores leads to agglomeration. Adding MOFs can immobilize the metal particles, ensuring the stability and accuracy of the detection. Typically, MOF-based nanozyme colorimetric assays are used in solution-based systems, which are difficult to preserve in practice and require numerous consumables. While paper-based systems are easier to preserve, have lower manufacturing costs, and are simpler to operate, they are primarily used for flow measurement methods, utilizing capillary adsorption to move the sample across the paper material for detection. MOFs loaded with bimetallic materials have limited flowability, making their application on paper-based systems generally considered difficult. This invention creatively applies MOFs loaded with bimetallic materials to immobilized paper-based systems, turning their flowability deficiency into an advantage. Compared to existing paper-based flow measurement colorimetric techniques, this immobilized paper-based in-situ detection technology has lower requirements for material flowability, largely avoiding false positives. Furthermore, the device is simpler and can simultaneously read data from multiple sites, enabling more convenient and efficient detection.

[0032] Compared with the prior art, the advantages of the present invention are as follows:

[0033] (1) This invention discloses a method for colorimetric detection of fungal toxins based on bimetallic nanozymes on paper. On the one hand, MOFs (UiO66-NH2) have the characteristics of uniform pore size, reasonable framework structure design and large specific surface area. However, due to their particle size and flowability, their practical application in transverse flow immunoassay (using capillary adsorption to move the sample on the paper material to achieve the detection purpose) is limited. This invention loads metal nanoparticles onto MOFs, which is an advantageous method to enhance the inherent properties of MOFs, endow them with new functions and minimize the use of precious metals. It prevents metal particles from aggregating and migrating through their pores, so that the nanozyme material can be evenly and stably distributed on the paper device, ensuring the stability and accuracy of the detection. In addition, the -NH2 on the MOF material UiO66-NH2 provides a good coordination site for metal ions or metal ligand complexes. Therefore, metal particle materials can be loaded onto MOFs and used in immobilized paper devices, which can turn the disadvantages of MOFs in transverse flow immunoassay into advantages. Meanwhile, compared with single-metal nanozymes, bimetallic nanomaterials endow nanozymes with higher catalytic activity. Depositing Pt and Pd metal particles onto UiO66-NH2 forms a bimetallic nanozyme, UiO66-NH2@Pt / Pd, with significant peroxidase-like activity. This allows for the catalytic oxidation of chromogenic substrates with hydrogen peroxide even at low concentrations (e.g., 10 μg / mL), exhibiting high detection sensitivity. Furthermore, this analytical method is rapid, enabling the detection of pollutants within 20 minutes, significantly shortening the detection time. On the other hand, the catalytic activity of nanozymes can be significantly altered after anchoring with nucleic acid aptamers, thus affecting the chromogenic reaction of the substrate. Upon adding the target analyte, based on the specific affinity between the aptamer and the target analyte, a certain relationship exists between the color change and the target analyte concentration, thereby enabling the determination of the target analyte. By loading materials onto a paper base, it eliminates the need for large-scale testing equipment, enabling rapid and convenient on-site testing. It boasts advantages such as high sensitivity, simple operation, strong anti-interference ability, wide detection range, and low detection limit. It can be applied to the specific detection of fungal toxins (such as aflatoxin B1), demonstrating significant practical value and promising application prospects.

[0034] (2) The method of this invention utilizes UiO66-NH2@Pt / Pd nanozymes with excellent peroxidase-like catalytic activity, which are prepared through a simple method. Compared to natural enzymes, nanozymes have advantages such as better stability, lower production costs, convenient preparation, and high catalytic efficiency. Due to their high catalytic efficiency, they are used as probes to improve sensitivity. In addition, compared to existing nanozyme synthesis methods, the method of this invention is simpler and more economical and efficient in the current resource-scarce environment. At the same time, the nanozyme colorimetric sensing technology combined with the smartphone camera platform, which is not limited by special instruments and laboratories, has become an attractive candidate technology for on-site detection in a portable and user-friendly mode, enabling the simultaneous detection of multiple samples. Furthermore, with the current emphasis on sustainable development goals, portable paper-based sensors overcome the limitations of solvent media due to their degradable and affordable properties. Therefore, based on this, arranging paper-based chips on a tray allows for the simultaneous reading and detection of multiple samples. The UiO66-NH2@Pt / Pd-based paper-based detection chip is simple to prepare and inexpensive, significantly reducing detection costs. Furthermore, utilizing widely available smartphones to read the paper's color enables rapid, accurate, and visualized on-site detection. The device is compact and portable, meeting the needs of the general public for operation and suitable for widespread application, overcoming the limitations of high costs, inability to perform on-site detection, and requirement for professional technicians in large indoor instruments. This paper-based colorimetric sensor demonstrates significant application potential for rapid on-site detection of AFB1. Attached Figure Description

[0035] Figure 1 This is a transmission electron microscope image of the MOF material UiO66-NH2 prepared in Example 1 of the present invention.

[0036] Figure 2 This is a transmission electron microscope image of the bimetallic nanozyme UiO66-NH2@Pt / Pd prepared in Example 1 of the present invention.

[0037] Figure 3 The image shows the X-ray photoelectron spectrum of the bimetallic nanozyme UiO66-NH2@Pt / Pd prepared in Example 1 of this invention.

[0038] Figure 4 The image shows the UV-vis diagram of the catalytic activity of the bimetallic nanozyme UiO66-NH2@Pt / Pd prepared in Example 1 of this invention.

[0039] Figure 5The images show the UV-vis images of the bimetallic nanozyme UiO66-NH2@Pt / Pd prepared in Example 1 of this invention, the bimetallic nanozyme UiO66-NH2@Pt / Pd loaded with nucleic acid aptamers, and the bimetallic nanozyme UiO66-NH2@Pt / Pd loaded with nucleic acid aptamers after incubation with a fungal toxin sample solution, obtained by adding TMB and H2O2 to an acetate-sodium acetate buffer solution.

[0040] Figure 6 This is an interface display diagram of the smartphone reading the RGB values ​​and linear curves of the color after color rendering in Embodiment 1 of the present invention.

[0041] Figure 7 This is a graph showing the anti-interference capability of the method for detecting mycotoxins based on bimetallic nanozymes on paper in Example 2 of the present invention. Detailed Implementation

[0042] The present invention will be further described below with reference to the accompanying drawings and specific preferred embodiments, but this does not limit the scope of protection of the present invention. Unless otherwise specified, the raw materials and instruments used in the following embodiments are commercially available.

[0043] In the following examples, the sodium acetate-acetic acid buffer solution is mainly prepared by sodium acetate and acetic acid in a certain proportion. Preferably, the molar ratio of acetic acid to sodium acetate is 1:5 to 7, but it is not limited to this. The sodium acetate-acetic acid buffer solution is also commercially available.

[0044] Example 1

[0045] A method for colorimetric detection of fungal toxins based on bimetallic nanozymes paper substrate according to the present invention includes the following steps:

[0046] S1. Preparation of nucleic acid aptamer-modified bimetallic nanozyme UiO66-NH2@Pt / Pd:

[0047] S1.1. Zirconium chloride, 2-aminoterephthalic acid, benzoic acid, and hydrochloric acid were dissolved in 34 mL of N,N-dimethylformamide and heated at 120 °C for 24 h to obtain UiO66-NH2. The ratio of zirconium chloride, 2-aminoterephthalic acid, benzoic acid, hydrochloric acid, and N,N-dimethylformamide was 1 mol: 1 mol: 20 mol: 0.5 mol: 34 mL. Figure 1 As shown, the UiO66-NH2 crystal has a polyhedral geometry with an average diameter of approximately 100 nm.

[0048] S1.2 Potassium chloroplatinate and sodium chloropalladium are added to a UiO66-NH2 solution and mixed. Then, ascorbic acid solution is added dropwise. After drying the resulting mixture, UiO66-NH2@Pt / Pd is obtained, where the mass concentration ratio of potassium chloroplatinate, sodium chloropalladium, UiO66-NH2, and ascorbic acid in the mixture is 10:2:1:20. Figure 2 As shown, particles were deposited on the original UiO-66-NH2 surface, such as Figure 3 The X-ray photoelectron spectrum shows that the material contains Pt and Pd elements, proving that PtCl 6- PdCl 2- It was deposited on the surface of UiO-66-NH2.

[0049] S1.3. The UiO66-NH2@Pt / Pd obtained in step S1.2 is uniformly dispersed in a sodium acetate-acetic acid buffer solution to obtain solution A, wherein the concentration of UiO66-NH2@Pt / Pd is 50 μg / mL, the pH of the sodium acetate-acetic acid buffer solution is 4, and the concentration of sodium acetate is 0.2 M. Then, the nucleic acid aptamer is added to solution A and mixed to obtain nucleic acid aptamer-modified UiO66-NH2@Pt / Pd, which is solution B, wherein the concentration of the nucleic acid aptamer is 1 μM.

[0050] S2. Preparation of paper-based detection chip: Cut filter paper into multiple paper-based chips, then soak them in solution B, and then take them out and dry them at 35°C for 5 minutes to obtain bimetallic nanozyme paper-based detection chip (referred to as paper-based detection chip).

[0051] S3. Sample Detection: Samples containing different concentrations of mycotoxins (specifically aflatoxin B1) were added to multiple different paper-based detection chips and reacted for 15 minutes. The concentrations of aflatoxin B1 were 0.1 ng / mL, 1 ng / mL, 10 ng / mL, 50 ng / mL, 100 ng / mL, 500 ng / mL, and 1000 ng / mL. An acetate-sodium acetate buffer solution containing 3,3',5,5'-tetramethylbenzidine (TMB) and H2O2 was added, and a colorimetric reaction was performed for 3 minutes. In the acetate-sodium acetate buffer solution containing TMB and H2O2, the concentration of TMB was 0.5 mM, the concentration of H2O2 was 10 mM, the pH of the acetate-sodium acetate buffer solution was 4, and the concentration of sodium acetate was 0.2 M.

[0052] S4. Detection and Identification: A mobile phone is used to photograph the colorimetric paper-based detection chip, the color intensity is read and converted to RGB values, a linear response relationship between mycotoxin concentration and RGB is established, and the curve with the highest fitting degree is selected as the standard curve for mycotoxin detection. When a sample without mycotoxins is added to the bimetallic nanozyme paper-based detection chip for incubation, an acetate-sodium acetate buffer solution containing TMB and H2O2 is added for reaction, and the bimetallic nanozyme paper-based detection chip turns light blue. When a sample containing mycotoxins is incubated on the paper-based detection chip, an acetate-sodium acetate buffer solution containing TMB and H2O2 is added for reaction, and the blue color of the bimetallic nanozyme paper-based detection chip deepens, thus qualitatively detecting whether the sample contains mycotoxins.

[0053] S5. Based on the mycotoxin detection standard curve obtained in step S4 and the measured RGB values ​​of the sample containing mycotoxin, the concentration of mycotoxin in the sample is obtained.

[0054] In this embodiment, the nucleotide sequence of the nucleic acid aptamer is shown in SEQ ID No. 1, specifically as follows:

[0055] GGGCACGTGTTGTCTCTCTGTGTCTCGTGCCC

[0056] Figure 4 This is a UV-vis image of the catalytic activity of the bimetallic nanozyme UiO66-NH2@Pt / Pd in ​​Example 1 of this invention. Figure 4 As can be seen, the catalytic activity of the bimetallic nanozyme UiO66-NH2@Pt / Pd in ​​this embodiment was evaluated. The results showed that the absorbance value of TMB+H2O2+UiO66-NH2@Pt / Pd was much higher than that of TMB+H2O2, indicating that UiO66-NH2@Pt / Pd has excellent enzyme-like catalytic activity. Moreover, the concentration of added UiO66-NH2@Pt / Pd is only 10 μg / mL, which requires a very low amount and has a short reaction time, showing great potential and advantages in practical applications.

[0057] Figure 5The images show the UV-vis images of the bimetallic nanozyme UiO66-NH2@Pt / Pd, the nucleic acid aptamer-loaded bimetallic nanozyme (Apt+UiO66-NH2@Pt / Pd), and the nucleic acid aptamer-loaded bimetallic nanozyme (AFB1+Apt+UiO66-NH2@Pt / Pd) after incubation with a mycotoxin sample solution, obtained by adding TMB and H2O2 in an acetate-sodium acetate buffer solution. The results show that the activity of the nanozyme is significantly reduced after the addition of the nucleic acid aptamer, while the activity of the nanozyme increases after the addition of the analyte mycotoxin. The aptamer and the mycotoxin together constitute the lock and key of the nanozyme activity, thereby linking the nanozyme activity with the mycotoxin, enabling convenient detection of mycotoxins.

[0058] Figure 6 This is an interface display diagram showing the conversion of RGB values ​​and linear curves of colors after the smartphone reads and displays the colors in Embodiment 1 of the present invention. Figure 6 It can be seen that the R / G value decreases with increasing mycotoxin concentration, and the R / G value shows a good linear relationship with the logarithm of aflatoxin B1 concentration. The regression equation for the detection of the logarithm of aflatoxin B1 concentration and the R / G value is as follows:

[0059] R / G = 0.6060 -0.0617 lgC (1)

[0060] In equation (1), R / G represents the RGB values ​​converted by the smartphone, C is the concentration of mycotoxins in the sample to be tested, in ng / mL, and the correlation coefficient R in equation (1) is... 2 =0.983, the linear range for the detection of mycotoxins is 0.1 ng / mL to 1000 ng / mL, and the limit of detection is 0.09 ng / mL.

[0061] As can be seen from the embodiments, the method of the present invention for the colorimetric detection of fungal toxins based on bimetallic nanozymes on paper can be used for the qualitative and quantitative detection of aflatoxin B1, and the concentration of aflatoxin B1 in the test sample can be calculated according to the detection linear regression equation.

[0062] Example 2

[0063] The present invention relates to the application of a bimetallic nanozyme-based paper-based colorimetric detection method for fungal toxins in the detection of fungal toxins in the environment and food.

[0064] The paper-based detection chip prepared in Example 1 was used to analyze fungal toxins in actual samples to evaluate the detection accuracy of the paper-based colorimetric detection method for fungal toxins based on bimetallic nanozymes of the present invention. The target analytes in actual samples were detected using this colorimetric detection method and compared with the detection results of commercially available kits.

[0065] The sample to be tested was a moldy wheat sample. The specific steps were as follows: after pretreatment such as extraction by shaking with methanol-water solution, the supernatant was taken, and the aflatoxin B1 in the test solution was determined using the colorimetric detection method of Example 1. The results were compared with those of a commercial kit, and the results are listed in Table 1. The detected concentration of aflatoxin B1 in the sample was basically consistent with the results of the commercial kit, indicating that the colorimetric analysis method has high reliability.

[0066] Table 1. Detection verification results of aflatoxin B1 in the test samples.

[0067]

[0068]

[0069] As shown in Table 1, the method for colorimetric detection of mycotoxins based on bimetallic nanozymes using paper-based substrate, according to the present invention, exhibits a relative standard deviation of approximately 2.46% to 3.89% within the measurable concentration range, indicating ideal measurement results. Compared to traditional colorimetric detection techniques, the method of the present invention is simple, rapid, and highly accurate. Table 1 also shows that the method for colorimetric detection of mycotoxins based on bimetallic nanozymes using paper-based substrate can be used to detect aflatoxin B1 in actual samples, achieving excellent detection accuracy.

[0070] Anti-interference capability assessment

[0071] To evaluate the anti-interference capability of the bimetallic nanozyme-based paper-based colorimetric detection method for mycotoxins of the present invention, common interfering substances, such as aflatoxin B2 (AFB2), aflatoxin G1 (AFG1), aflatoxin G2 (AFG2), and zearalenone (ZON), were measured colorimetrically using the colorimetric detection method of Example 1. The detection results are as follows: Figure 7 As shown. By Figure 7 It is evident that the method for detecting mycotoxins based on bimetallic nanozymes on paper substrate of the present invention has strong specificity for aflatoxin B1 and almost no response to other interfering substances. This indicates that the method for detecting mycotoxins based on bimetallic nanozymes on paper substrate of the present invention has good anti-interference ability and good selectivity for target mycotoxins.

[0072] The above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention in any way. Although the present invention has been disclosed above with reference to preferred embodiments, it is not intended to limit the present invention. Any person skilled in the art can make many possible variations and modifications to the technical solutions of the present invention using the methods and techniques disclosed above, or modify them into equivalent embodiments with equivalent changes, without departing from the spirit and technical essence of the present invention. Therefore, any simple modifications, equivalent substitutions, equivalent changes, and modifications made to the above embodiments based on the technical essence of the present invention without departing from the content of the technical solutions of the present invention shall still fall within the protection scope of the technical solutions of the present invention.

Claims

1. A method for colorimetric detection of mycotoxins based on bimetallic nanoszyme paper, characterized in that, The method comprises the following steps: S1, preparation of nucleic acid aptamer modified bimetallic nanoscale enzyme UiO66-NH2@Pt / Pd: S1.1, dissolve zirconium chloride, 2-amino terephthalic acid, benzoic acid and hydrochloric acid in N,N-dimethylformamide, and obtain a UiO66-NH2 solution after heating at 80-200 DEG C; S1.2, add potassium chloroplatinate and sodium chloroplatinate to the UiO66-NH2 solution, then add ascorbic acid solution, dry the obtained mixture to obtain UiO66-NH2@Pt / Pd; S1.3, disperse the UiO66-NH2@Pt / Pd prepared in step S1.2 in sodium acetate-acetic acid buffer solution to obtain solution A, then add nucleic acid aptamer to solution A and mix to obtain nucleic acid aptamer modified UiO66-NH2@Pt / Pd, which is solution B; S2, preparation of detection unit: cut filter paper into multiple paper-based chips, then soak in solution B, and then take out and dry to obtain bimetallic nanoscale enzyme paper-based detection chip; S3, sample detection: add samples containing different concentrations of mycotoxins to multiple bimetallic nanoscale enzyme paper-based detection chips respectively, react for 5-30 min, then add acetic acid-sodium acetate buffer solution containing TMB and H2O2, and carry out color development reaction for 1-20 min; S4, detection and identification: take a photo of the color-developed bimetallic nanoscale enzyme paper-based detection chip by using a mobile phone, read the color intensity and convert it into RGB value, establish the detection linear response relationship between mycotoxin concentration and RGB, and select the curve with the highest fitting degree as the standard curve for mycotoxin detection; S5, according to the standard curve for mycotoxin detection obtained in step S4 and the RGB value measured for the sample to be tested containing mycotoxin, the concentration of mycotoxin in the sample to be tested is obtained.

2. The method for colorimetric detection of mycotoxins based on bimetallic nanoszyme paper according to claim 1, characterized in that, In step S3, when the sample without mycotoxin is added to the bimetallic nanoscale enzyme paper-based detection chip for incubation, acetic acid-sodium acetate buffer solution containing TMB and H2O2 is added for reaction, and the bimetallic nanoscale enzyme paper-based detection chip is light blue; when the sample to be tested containing mycotoxin is incubated on the paper-based detection chip, acetic acid-sodium acetate buffer solution containing TMB and H2O2 is added for reaction, and the bimetallic nanoscale enzyme paper-based detection chip becomes darker blue, thereby qualitatively detecting whether the sample to be tested contains mycotoxin.

3. The method for colorimetric detection of mycotoxins based on bimetallic nanoszyme paper according to claim 1, characterized in that, The mycotoxin is aflatoxin B1, the nucleotide sequence of the nucleic acid aptamer is shown in SEQ ID No. 1, and the detection linear regression equation of mycotoxin concentration and color-developed RGB value of the bimetallic nanoscale enzyme paper-based detection chip is: R / G = 0.6060 - 0.0617 lgC (1) In formula (1), R / G represents the RGB value of color conversion read by a smart phone, C is the concentration value of the mycotoxin in the sample to be detected, the unit is ng / mL, the correlation coefficient R of formula (1) is 0.983, the linear range of the detection of the mycotoxin is 0.1 ng / mL-1000 ng / mL, and the detection limit is 0.09 ng / mL. 2 =0.983, the linear range of the detection of the mycotoxin is 0.1 ng / mL-1000 ng / mL, and the detection limit is 0.09 ng / mL.

4. The method for paper-based colorimetric detection of mycotoxins based on bimetallic nanoszymes according to any one of claims 1 to 3, characterized in that, In step S1.1, the ratio of zirconium chloride, 2-amino terephthalic acid, benzoic acid, hydrochloric acid and N,N-dimethylformamide is 1 mol:1 mol-5 mol:10 mol-20 mol:0.5 mol-2 mol:30 mL-45 mL.

5. The method for paper-based colorimetric detection of mycotoxins based on bimetallic nanoszymes according to any one of claims 1 to 3, characterized in that, In step S1.1, the heating time is 15-30 h.

6. The method for paper-based colorimetric detection of mycotoxins based on bimetallic nanoszymes according to any one of claims 1 to 3, characterized in that, In step S1.2, the mass concentration ratio of the potassium chloroplatinate, sodium chloropalladate, UiO66-NH2 and ascorbic acid in the mixed solution is 1-10:1-2:1:10-30.

7. The method for paper-based colorimetric detection of mycotoxins based on bimetallic nanoszymes according to any one of claims 1-3, characterized in that, In step S1.3, the concentration of the UiO66-NH2@Pt / Pd in the sodium acetate-acetic acid buffer solution is 50 μg / mL-100 μg / mL, the pH of the sodium acetate-acetic acid buffer solution is 2-5, the concentration of sodium acetate is 0.1 M-0.3 M, and the concentration of the aptamer in the A solution is 0.5 μM-2 μM.

8. The method for paper-based colorimetric detection of mycotoxins based on bimetallic nanoszymes according to any one of claims 1 to 3, characterized in that, In step S2, the temperature of the drying is 2°C-40°C, and the time of the drying is 5 min-25 min.

9. The method for paper-based colorimetric detection of mycotoxins based on bimetallic nanoszymes according to any one of claims 1 to 3, characterized in that, In step S3, in the acetic acid-sodium acetate buffer solution containing TMB and H2O2, the concentration of the hydrogen peroxide is 5 mM-20 mM, the concentration of the TMB is 0.5 mM-2 mM, the pH of the acetic acid-sodium acetate buffer solution is 2-5, and the concentration of sodium acetate is 0.1 M-0.3 M.

10. Use of the method for detecting fungal toxins in the environment or food based on the bimetallic nanoscale enzyme paper-based colorimetric detection of fungal toxins according to any one of claims 1-9.