A switchgrass transcription factor gene PvC3H12 for improving plant cold tolerance and its application

By identifying and overexpressing the CCCH-like zinc finger gene PvC3H12 in switchgrass, the problem of insufficient regulation of low temperature stress in the prior art was solved, and the cold resistance and growth performance of switchgrass was significantly improved.

CN118685425BActive Publication Date: 2025-07-08SICHUAN AGRI UNIV
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
CN202410783965.6
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-06-18
Publication Date
2025-07-08
Estimated Expiration
2044-06-18

AI Technical Summary

Technical Problem

In the prior art, CCCH-like zinc finger proteins are mainly involved in the regulation of salt stress and drought stress, while there are few researches on the regulation of low-temperature stress, resulting in insufficient cold tolerance of switchgrass and other plants, affecting their yield and distribution.

Method used

The CCCH zinc finger gene PvC3H12 was identified and overexpressed in switchgrass, and the cold tolerance of plants was improved by constructing recombinant vectors and recombinant bacteria.

Benefits of technology

Overexpression of the PvC3H12 gene significantly improved the cold tolerance of switchgrass and improved the survival rate and growth performance of plants under low temperature conditions.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN118685425B_ABST
    Figure CN118685425B_ABST
Patent Text Reader

Abstract

The present invention discloses a switchgrass transcription factor gene PvC3H12 for improving plant cold tolerance and its application, belonging to the technical field of genetic engineering. The CDS sequence of the switchgrass transcription factor gene PvC3H12 is as shown in SEQ ID NO.7. This gene is localized in the nucleus and exhibits obvious transcriptional activation activity in yeast, indicating that PvC3H12 is a transcriptional activator. Further research found that overexpression of PvC3H12 significantly improved the cold tolerance of switchgrass. The acquisition of the switchgrass transcription factor gene PvC3H12 of the present invention is expected to improve the cold tolerance of multiple perennial warm-season plants and provide a theoretical basis for cultivating plants with high cold tolerance.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of genetic engineering, and particularly to a switchgrass transcription factor gene PvC3H12 for improving plant cold tolerance and its application. Background Art

[0002] Temperature is one of the main environmental factors affecting plant growth and distribution. Low temperature seriously hinders the normal growth and development of plants, restricts the geographical distribution of vegetation, and affects agricultural production. In recent years, with global climate change, extreme climates have occurred frequently. As a global natural disaster, low-temperature cold damage poses a threat to the growth and survival of crops, resulting in a global food crisis. Therefore, studying the response mechanism of plants to abiotic stress and improving plant cold tolerance have important theoretical significance and practical production value.

[0003] CCCH zinc finger proteins are a class of key regulatory factors involved in plant stress responses, with a typical zinc finger domain composed of three cysteines (C) and one histidine (H) coordinated with zinc ions (Yuan et al., 2015). Studies have shown that this conserved domain (CCCH domain) has functional diversity, including binding to RNA to participate in mRNA transcription, degradation, and splicing, binding to proteins to form protein complexes to participate in regulating the process of plant stress responses, and binding to DNA to participate in regulating the expression of downstream genes (Peng et al., 2012). Currently, reports on CCCH participating in regulating plant stress responses have been made (Guo et al., 2009; Jan et al., 2013; Xie et al., 2022). Identified CCCH proteins involved in regulating plant stress and development processes include AtSZF1, AtSZF2, OsTZF1, OsDOS, PvCCCH72, PvC3H69, and PvSSG, etc. However, these reported CCCH proteins all participate in regulating salt stress, drought stress, and leaf senescence regulation processes, and there are very few CCCH zinc finger proteins that regulate low-temperature stress.

[0004] Switchgrass (Panicum virgatum L.) is a perennial C4 warm-season grass of the genus Panicum in the family Gramineae. Switchgrass has a wide range of applications and development fields. It can be used as forage, ornamental grass, and soil and water conservation plant, and is also an important raw material for biofuels and alternative energy production. Low temperature has become one of the key factors restricting switchgrass yield formation. Improving switchgrass cold tolerance can not only improve switchgrass biomass but also provide a reference background and theoretical support for the increase in the yield of other crops. It is more conducive to improving the genetic value and practicality of perennial grass plants. Summary of the Invention

[0005] The object of the present invention is to provide a switchgrass transcription factor gene PvC3H12 for improving plant cold tolerance and its application, so as to solve the problems existing in the above-mentioned prior art. In switchgrass, a CCCH-type zinc finger gene, PvC3H12, was identified. The acquisition of this gene is expected to improve the cold tolerance of multiple perennial warm-season plants, and at the same time provides a theoretical basis for cultivating plants with high cold tolerance.

[0006] To achieve the above object, the present invention provides the following solutions:

[0007] The present invention provides a switchgrass transcription factor gene PvC3H12 for improving plant cold tolerance, and the CDS sequence of the switchgrass transcription factor gene PvC3H12 is shown in SEQ ID NO.7.

[0008] The present invention also provides a recombinant vector containing the switchgrass transcription factor gene PvC3H12.

[0009] The present invention also provides a recombinant bacterium containing the recombinant vector.

[0010] The present invention also provides the application of the switchgrass transcription factor gene PvC3H12, the recombinant vector or the recombinant bacterium in improving plant cold tolerance.

[0011] Further, the plant includes perennial warm-season plants.

[0012] Further, the perennial warm-season plants include switchgrass.

[0013] The present invention also provides a method for improving plant cold tolerance, which includes introducing the switchgrass transcription factor gene PvC3H12 into a target plant to construct a transgenic line with overexpression of PvC3H12.

[0014] Further, the target plant includes perennial warm-season plants.

[0015] Further, the perennial warm-season plants include switchgrass.

[0016] The present invention also provides the application of the switchgrass transcription factor gene PvC3H12, the recombinant vector or the recombinant bacterium in cultivating plants with high cold tolerance.

[0017] The present invention discloses the following technical effects:

[0018] In this invention, a CCCH-type zinc finger gene, PvC3H12, was identified in switchgrass. This gene is 2001 bp long and encodes 667 amino acids. The PvC3H12 protein contains a conserved CCCH zinc finger domain at the 667 amino acid position. qRT-PCR was used to detect the relative expression levels of PvC3H12 under different abiotic stresses (PEG, NaCl, low temperature, and ABA), and it was found that PvC3H12 was specifically induced by cold stress. In addition, PvC3H12 was localized in the nucleus and showed obvious transcriptional activation activity in yeast, indicating that PvC3H12 is a transcriptional activator. Further research found that overexpression of PvC3H12 significantly improved the cold tolerance of switchgrass.

[0019] The acquisition of the switchgrass transcription factor gene PvC3H12 in this invention is expected to improve the cold tolerance of multiple perennial warm-season plants, and at the same time provides a theoretical basis for cultivating plants with high cold tolerance. Brief Description of the Drawings

[0020] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required in the embodiments. Obviously, the drawings in the following description are only some embodiments of the present invention. For those of ordinary skill in the art, without creative efforts, other drawings can also be obtained based on these drawings.

[0021] Figure 1 It is a graph of the relative expression levels of PvC3H12 under different abiotic stresses;

[0022] Figure 2 It is the identification result of the PvC3H12 gene. Among them, A is the subcellular localization map, a represents the green fluorescent protein display map, b represents the DAPI staining display map, c represents the chloroplast autofluorescence display map, d represents the bright field map, and e represents the merged map; B is the result of the yeast self-activation activity experiment, where NCK is the negative control; PCK is the positive control; C is the schematic diagram of the construction of the plant transcriptional activation vector; D is the detection result of the transcriptional activation activity in plant cells;

[0023] Figure 3 It is the identification result of the PvC3H12 overexpression transgenic lines. Among them, A is the PCR detection result, and B is the GUS staining result;

[0024] Figure 4Effect of PvC3H12 overexpression on plant cold tolerance. Among them, A is the phenotypic diagram of overexpression lines and wild-type plants treated at low temperature (4°C), B is the relative water content (RWC) of leaves of overexpressing plants and wild-type plants under low temperature (4°C) treatment, C is the electrolyte leakage (EL) of leaves of overexpressing plants and wild-type plants under low temperature (4°C) treatment, D is the phenotype of overexpression lines and wild-type plants after being treated with -5°C freezing injury and recovered for 20 days, E is the survival rate of overexpression lines and wild-type plants after being treated with freezing injury (-5°C), F is the regreening phenotype of overexpression lines and wild-type plants after wintering in the same period, G is the number of new tillers of overexpression lines and wild-type plants after wintering and regreening in the same period. WT represents wild type, and OE 12-1 / PvC3H12-1 and OE 12-8 / PvC3H12-8 are overexpression lines. Detailed implementation manners

[0025] The various exemplary implementation manners of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, characteristics, and implementation schemes of the present invention.

[0026] It should be understood that the terms used in the present invention are only for describing specific implementation manners and are not used to limit the present invention. Additionally, for the numerical ranges in the present invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any intermediate value within any stated value or stated range, as well as each smaller range between any other stated value or intermediate value within the stated range, is also included in the present invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0027] Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by those of ordinary skill in the art to which the present invention pertains. Although the present invention only describes preferred methods and materials, any methods and materials similar or equivalent to those described herein can also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials related to the documents. In case of conflict with any incorporated document, the content of this specification shall prevail.

[0028] Without departing from the scope or spirit of the present invention, various improvements and changes can be made to the specific implementation manners of the specification of the present invention, which are obvious to those skilled in the art. Other implementation manners obtained from the specification of the present invention are obvious to those skilled in the art. The specification and examples of the present invention are only exemplary.

[0029] Regarding "comprising", "including", "having", "containing", etc. used herein, they are all open-ended terms, meaning including but not limited to.

[0030] Analysis of Relative Expression Levels of PvC3H12 Gene under Different Abiotic Stresses in Example 1

[0031] 1. Treatment of Switchgrass Materials

[0032] Switchgrass seeds (collected from the Baima Base of Nanjing Agricultural University) were evenly placed in a petri dish lined with filter paper. Before germination, they were watered, and after germination, they were transferred to a hydroponic pot and hydroponically cultured with 1 / 2 Hoagland's solution. When the seedlings grew to about 10 cm, stress treatments were carried out. They were respectively treated with H2O, 15% PEG-6000, 300 mM NaCl, 50 μmol ABA, and low temperature (4°C). Leaves were collected at different time points (0 h, 1 h, 2 h, 4 h, 8 h, 12 h, and 24 h) after the treatments. All the tested materials were immediately frozen in liquid nitrogen after sampling and then stored in a -80°C ultra-low temperature freezer.

[0033] 2. Analysis of Relative Expression Levels of PvC3H12 Gene under Different Abiotic Stresses by RT-PCR Detection

[0034] Total plant RNA was extracted from the stored samples using a plant RNA extraction kit. The plant RNA was reverse transcribed into cDNA using a reverse transcription kit. Primers were designed, and the relative expression level of the PvC3H12 gene was detected by RT-qPCR. Among them, the qRT-PCR kit used was RT-PCR EasyM I (Fujitech Biotechnology Co., Ltd., Chengdu, China). The qRT-PCR experiment was carried out using a Bio-RAD CFX Connect instrument, with PveEF of switchgrass as the internal reference gene.

[0035] The primers included the upstream primer: PveEF-F: CGGTTGGTCGTGTGGAGACT (SEQ ID NO.1);

[0036] The downstream primer: PveEF-R: TGGTGCATCTCAACAGACTTCAC (SEQ ID NO.2).

[0037] The upstream primer: PvC3H12_F: TTCAATGCAAGAGATGCACA (SEQ ID NO.3);

[0038] The downstream primer: PvC3H12_R: CGAATGCTCAGACCAGAAGA (SEQ ID NO.4)

[0039] The total reaction system was 20 μL, containing 5 μL cDNA, 0.8 μL upstream primer, 0.8 μL downstream primer, 10 μL SYBR enzyme, and the rest was made up to 20 μL with RNase-free ddH2O.

[0040] The reaction procedure was 95°C for 30 s; 95°C for 5 s, 58°C for 30 s, for 40 cycles; the melting curve was default. The relative expression level of the gene was calculated using the 2 -ΔΔCt method.

[0041] The detection results were as Figure 1 shown. The relative expression levels of PvC3H12 under different abiotic stresses (PEG, NaCl, low temperature 4°C (Cold), and ABA) were detected by qRT-PCR. It was found that the expression of PvC3H12 was induced by NaCl, Cold, and ABA. In contrast, the responsive expression of PvC3H12 to low temperature (4°C) was significantly higher than that of NaCl and ABA. Thus, it was indicated that PvC3H12 was induced by cold and might be involved in regulating plant cold stress.

[0042] Example 2 Identification of PvC3H12

[0043] 1. Cloning of PvC3H12

[0044] Using the PCR method, with switchgrass cDNA as the template, specific primers for the CDS region (PvCCCH12-CDS F and PvCCCH12-CDS R) were designed for PCR amplification.

[0045] The primers required for PCR amplification were as follows:

[0046] Amplification primer PvCCCH12-CDS F: ATGGGCGACCTTGCTGATC (SEQ ID NO.5);

[0047] PvCCCH12-CDS R: TTTTGGCTCCAAGTGCATCTG (SEQ ID NO.6).

[0048] The PCR reaction system was: 10 μL of 5×Q5 Reaction buffer, 1 μL of 10 mM dNTPs, 1 μL of upstream primer, 1 μL of downstream primer, 4 μL of gDNA, 0.5 μL of Q5 High Fideliey DNA polymerase, 10 μL of 5×Q5 GC Enhancer, and made up to 50 μL with ddH2O.

[0049] The PCR reaction conditions were: 98°C for 3 min, 98°C for 1 min, 66°C for 30 s, 72°C for 1 min, for 30 cycles, 72°C for 3 min, and stored at 10°C.

[0050] After the PCR reaction, the PCR products were detected by 1% agarose gel electrophoresis and then recovered. The amplified CDS sequence fragments were digested with EcoR1 and Hind3 restriction enzymes and then ligated into the pENTR vector using T4 ligase. The samples were sent to the company for sequencing, and the results were compared with the reference genes of the switchgrass genome.

[0051] The digestion reaction system was as follows: 20 μL of pENTR vector, 1 μL of EcoRI, 1 μL of HindIII, 5 μL of 10× Cutsmart, and ddH2O was added to make up to 50 μL. The reaction conditions were 37°C for 2 h.

[0052] PvC3H12 is a CCCH-type zinc finger gene. This gene is 2001 bp long and encodes 667 amino acids. The PvC3H12 protein contains a conserved CCCH zinc finger domain at the 667 amino acid position.

[0053] The CDS sequence (SEQ ID NO.7) of the amplified PvC3H12 gene:

[0054]

[0055] 2. Construction of recombinant bacteria

[0056] The linear fragment of the recombinant vector containing the cloned gene was constructed into the pCAMBIA1305.2 vector to form the p1305.2 - PvCCCH12 expression vector. Then the expression vector was transferred into Agrobacterium tumefaciens AGL1 for standby.

[0057] 3. Subcellular localization and transcriptional activation experiments of the PvC3H12 gene

[0058] Through subcellular localization experiments, it was found that PvC3H12 was localized in the nucleus ( Figure 2 Figure A), and further yeast self - activation experiments and transcriptional activation experiments in plant cells were used to find that PvC3H12 had transcriptional activation activity. These results indicated that PvC3H12 was a transcription factor and a transcriptional activator ( Figure 2 Figure B - D).

[0059] Example 3 Phenotypic analysis of PvC3H12 transgenic plants under low - temperature stress

[0060] 1. Obtaining of switchgrass transgenic lines

[0061] To further verify the function of PvC3H12 in regulating plant cold tolerance, in the present invention, PvC3H12 was overexpressed in switchgrass to construct PvC3H12 over - expression transgenic lines.

[0062] The seeds of switchgrass were disinfected with 6% sodium hypochlorite solution for 2 hours and then washed 6 times with sterile water. The disinfected switchgrass seeds were spread on the MS induction medium for callus induction. When the callus had grown for 2 months, the Agrobacterium tumefaciens carrying the p1305.2 - PvCCCH12 expression vector was used to infect the switchgrass callus, and then screened on the 50 mg / L hygromycin - resistant medium and further differentiated into seedlings.

[0063] 2. Identification of transgenic switchgrass

[0064] When the differentiated switchgrass seedlings were transplanted into the soil, GUS staining and PCR identification methods were used to determine the positive transgenic switchgrass seedlings.

[0065] GUS staining: The differentiated switchgrass seedlings were transplanted into the soil, then cut off 1 - cm - long leaves, placed in the GUS basic solution, and 1×X - gluc was added. It was placed in the dark at 37°C for 36 h. Then the staining solution was sucked out, and decolorized with 70% alcohol for 3 days and photographed.

[0066] PCR identification: Genomic DNA of wild type and transgenic lines was extracted. Using the genomic DNA as a template, primers HTPII-F: CAAACTGTGATGGACGACACCG (SEQ ID NO.8) and HTPII-R: TATATGCTCAAC ACATGAGCG (SEQ ID NO.9) were selected to amplify the hygromycin gene fragment inserted into the genome.

[0067] The PCR reaction system was 10 μL of 2×PhantaFlash Master Mix, 1 μL of gDNA, 1 μL of HTPII-F (10 μM), 1 μL of HTPII-R (10 μM), and ddH2O was added to make up 20 μL.

[0068] PCR reaction conditions: 98°C for 3 min, 98°C for 1 min, 58°C for 30 s, 72°C for 1 min, 30 cycles, 72°C for 3 min, and stored at 10°C.

[0069] The results of PCR identification and GUS staining are shown respectively as Figure 3 follows. From the PCR identification results, it can be seen that the hygromycin gene fragment was not detected in wild type switchgrass, while bright bands of the hygromycin gene were detected in all transgenic lines ( Figure 3 A); from the GUS staining results, it can be seen that no staining reaction occurred in the leaves of wild type switchgrass, while the leaves of transgenic lines showed blue after decolorization. The above indicates that transgenic switchgrass overexpressing PvC3H12 was successfully obtained.

[0070] 3. Phenotypic analysis of PvC3H12 transgenic plants under low temperature stress

[0071] Wild type switchgrass plants and PvC3H12 transgenic plants with relatively consistent growth were treated under low temperature stress (4°C). The phenotypes were observed and photographed at 0 day, 10 days, and 20 days of treatment, and samples were taken to measure the electrolyte leakage (EL) and relative water content (RWC) of leaves. At the same time, 0.3 g of samples were immediately frozen in liquid nitrogen and then stored in an ultra-low temperature freezer at -80°C for subsequent detection of gene expression levels.

[0072] Measurement of EL: Cut 0.2 g of leaves with scissors, rinse the dirt on the leaf surface with deionized water, wrap it with absorbent paper and immerse it in a 50 mL centrifuge tube filled with distilled water (30 mL of distilled water is appropriate). Then seal it and place it on a shaker, shake at room temperature for 24 h, and measure the initial conductivity value C0 of the solution with a conductivity meter; then seal the sample and put it into an autoclave for 20 min, take it out immediately and remove the lid, wait for it to cool and then cover the lid again, put it into the shaker and shake for 24 h, take it out and measure the conductivity value C1 of its solution, relative conductivity = C0 / C l ×100%

[0073] Determination of RWC: Take 0.2 g of leaves and immediately accurately weigh the fresh weight (FW) with a ten-thousandth balance; then wrap them with absorbent paper and immerse them in a 50 mL centrifuge tube filled with distilled water, seal it and soak for 24 h (the distilled water in the centrifuge tube should be able to cover the absorbent paper). Take out and gently dry the surface floating water with absorbent paper, and quickly weigh its saturated water holding weight (TW); finally, dry it at 80 °C for at least 72 h and then weigh its dry weight (DW). Leaf relative water content = (FW - DW) / (TW - DW) × 100%.

[0074] The phenotypes and physiological index results of PvC3H12 transgenic plants under low temperature stress are as follows Figure 4 . After 20 days of treatment at low temperature (4 °C), the leaves of wild-type plants showed obvious wilting compared with the transgenic lines, and the relative water content (RWC) of plant leaves was also significantly lower than that of the overexpression lines, while the EL value of wild-type was significantly higher than that of the overexpressed plants ( Figure 4 A-C). After treatment at -5 °C and recovery for 20 days, the survival rate of the PvC3H12 overexpression line was significantly higher than that of the wild-type, and after overwintering, the number of tillers of the overexpression line turning green and growing was significantly higher than that of the wild-type plants at the same period ( Figure 4 D-G). These results indicate that overexpression of PvC3H12 significantly improves the cold tolerance of switchgrass.

[0075] The above-described embodiments are only descriptions of the preferred modes of the present invention, and do not limit the scope of the present invention. Without departing from the design spirit of the present invention, various deformations and improvements made by those of ordinary skill in the art to the technical solutions of the present invention should fall within the protection scope determined by the claims of the present invention.

Claims

1. Use of the switchgrass transcription factor gene PvC3H12 for improving plant cold tolerance, a recombinant vector containing the switchgrass transcription factor gene PvC3H12, or a recombinant bacterium containing the switchgrass transcription factor gene PvC3H12 in improving plant cold tolerance, characterized in that The CDS sequence of the switchgrass transcription factor gene PvC3H12 is shown in SEQ ID NO.7; the plant is switchgrass.

2. A method for improving the cold tolerance of plants, characterized in that, It includes introducing the switchgrass transcription factor gene PvC3H12 into a target plant to construct a transgenic line with overexpression of PvC3H12; the CDS sequence of the switchgrass transcription factor gene PvC3H12 is shown in SEQ ID NO.7; the plant is switchgrass.

3. Use of the switchgrass transcription factor gene PvC3H12 for improving plant cold tolerance, a recombinant vector containing the switchgrass transcription factor gene PvC3H12, or a recombinant bacterium containing the switchgrass transcription factor gene PvC3H12 in cultivating plants with high cold tolerance, characterized in that The CDS sequence of the switchgrass transcription factor gene PvC3H12 is shown in SEQ ID NO.7; the plant is switchgrass.

Citation Information

Patent Citations

  • Poncirus trifoliata cold resistant gene PtrTZF1 and application thereof to plant cold resistant heredity improvement

    CN109553671A

  • Application of tomato SlC3H39 gene as negative regulatory factor in improvement of low temperature resistance of tomato

    CN114292943A

  • Tobacco low-temperature-resistant gene NtZFP66L1 and application thereof

    CN116716315A