An antigen combination and its application

Abstract

The present disclosure discloses an antigen combination and its application. The antigen combination is an antigen combination of the genus Capripoxvirus. By combining the P32 of LSDV or its fragment with the L1R protein, a lumpy skin disease virus antigen combination with good antigenicity and immunogenicity is obtained, which can be used for detecting the genus Capripoxvirus, providing a good antigen raw material for the clinical diagnosis of LSDV and capripoxvirus infection and the development and screening of related neutralizing antibodies.

Description

Technical Field

[0001] The present disclosure belongs to the field of biotechnology detection, and particularly relates to an antigen combination of the genus Capripoxvirus and its application. Background Art

[0002] Lumpy skin disease (LSD) is an acute and subacute infectious disease caused by Lumpy skin disease virus (LSDV) of the genus Capripoxvirus, subfamily Chordopoxvirunae, family Poxiviridae. Clinically, it is mainly characterized by fever, weight loss, lymphadenopathy, skin edema, and the formation of hard nodules or ulcers locally.

[0003] LSD was first discovered in the Zambian region of Africa and then gradually spread northward, mainly prevalent in the sub-Saharan region. Subsequently, it spread to some Asian and European countries, reaching Serbia, Albania, Russia and other countries, and gradually approaching China. Around 2019, the disease was first diagnosed in the Ili region of Xinjiang, China, and the Ministry of Agriculture and Rural Affairs temporarily classified it as a Class II animal disease.

[0004] LSDV can cause primary and secondary pneumonia, leading to abortion in cows and temporary or permanent infertility in bulls, a significant decline in the production performance and lactation performance of dairy cows, and a greatly reduced utilization value of hides. LSDV can be transmitted through the bites of blood-sucking insects such as mosquitoes, flies and lice. The incidence rate ranges from 5% to 45%, and the fatality rate can reach 20%. It seriously affects the economic trade of the cattle industry and is listed as a notifiable animal disease by the World Organization for Animal Health (WOAH).

[0005] LSD is mainly diagnosed through clinical and laboratory diagnostic detection methods. Laboratory diagnosis includes virus isolation and identification, molecular biology and serological diagnostic detection, etc. Clinical diagnostic methods are mainly applicable to the diagnosis of severe LSD cases. For LSD cases in the initial stage of infection, mild or asymptomatic cases, they cannot be distinguished by clinical diagnostic methods, and laboratory detection methods need to be used for confirmation. The virus neutralization test (VN) is the method with the highest specificity in serological detection and is also the gold standard method for detecting LSDV antibodies specified by WOAH. However, due to the low level of neutralizing antibodies produced after LSDV infection, the sensitivity of this method is poor. Moreover, VN requires operators to have a high level of virus operation technology and rich experience, and also needs to be carried out in a BSL-3 laboratory.

[0006] At present, there is no effective treatment for LSD, and vaccination and active serum monitoring remain the most effective measures to control the spread of the virus. Currently, only commercial attenuated live vaccines (LAV) are used to prevent LSD, including homologous attenuated live vaccines and heterologous attenuated live sheeppox vaccines. Whether homologous vaccines or heterologous vaccines, most of them have good clinical protection effects, but some vaccines cannot provide sufficient immune protection, and most vaccines have varying degrees of side effects. Summary of the Invention

[0007] To solve at least one of the above problems, the present disclosure provides an antigen combination for lumpy skin disease of cattle and its application. The antigen combination provided by the present disclosure has good immunogenicity, high specificity in binding to antibodies, and can greatly improve the immune effect.

[0008] According to a first aspect of the present disclosure, there is provided an antigen combination, the antigen combination comprising: a P32 protein or a fragment thereof, and an L1R protein or a fragment thereof.

[0009] In some embodiments, the P32 protein has an amino acid sequence as shown in SEQ ID NO: 1 or an amino acid sequence having 85% or more identity thereto.

[0010] In some embodiments, the fragment of the P32 protein has an amino acid fragment corresponding to positions 26-195, 18-257, and / or 31-179 of the amino acid sequence shown in SEQ ID NO: 1, or an amino acid sequence having 85% or more sequence identity thereto.

[0011] In some embodiments, the fragment of the P32 protein has an amino acid sequence as shown in any one or more of SEQ ID NOs: 4-6, or an amino acid sequence having 85% or more identity thereto.

[0012] In some embodiments, the L1R protein has an amino acid sequence as shown in SEQ ID NO: 2, or an amino acid sequence having 85% or more sequence identity thereto.

[0013] In some embodiments, the antigen combination further comprises an exogenous protein that enhances immunogenicity.

[0014] In some embodiments, the exogenous protein that enhances immunogenicity includes tetanus toxin T cell epitope P2, cholera toxin B subunit, Escherichia coli heat-labile enterotoxin B subunit, Brucella dihydropteroate synthase, particulate protein murine polyomavirus VP1, norovirus capsid protein or a fragment thereof.

[0015] In some embodiments, the exogenous protein enhancing immunogenicity is the tetanus toxin T cell epitope P2.

[0016] In some embodiments, the exogenous protein enhancing immunogenicity has the amino acid sequence shown in SEQ ID NO:8, or an amino acid sequence having a sequence identity of more than 85% thereto.

[0017] In some embodiments, the antigen combination includes a mixture of the P32 protein or a fragment thereof and the L1R protein or a fragment thereof; and / or

[0018] The antigen combination includes the exogenous protein enhancing immunogenicity, a mixture of the P32 protein or a fragment thereof and the L1R protein or a fragment thereof; and / or

[0019] The antigen combination includes a fusion protein of the P32 protein or a fragment thereof and the L1R protein or a fragment thereof; and / or

[0020] The antigen combination includes the exogenous protein enhancing immunogenicity, a fusion protein formed by the P32 protein or a fragment thereof and the L1R protein or a fragment thereof.

[0021] In some embodiments, the weight ratio of the P32 protein or a fragment thereof to the L1R protein or a fragment thereof in the mixture is (1-10):(1-10); and / or

[0022] The weight ratio of the exogenous protein enhancing immunogenicity, the P32 protein or a fragment thereof to the L1R protein or a fragment thereof in the mixture is (1-10):(1-10):(1-10).

[0023] In some embodiments, in the fusion protein, any two of the P32 protein or a fragment thereof, the L1R protein or a fragment thereof and the strongly immunogenic exogenous protein are directly or indirectly linked.

[0024] In some embodiments, the indirect connection includes connection through a linker.

[0025] In some embodiments, the linker includes a flexible linker.

[0026] In some embodiments, the amino acid sequence of the flexible linker is selected from one or more of the amino acid sequences shown by (G n S) m , (G) n , (EA 3 K) n or (XP) n , where n and m are each independently selected from integers of 0 to 5.

[0027] In some embodiments, the fusion protein sequentially includes, from the N-terminus to the C-terminus, the P32 protein or a fragment thereof, and the L1R protein or a fragment thereof; or,

[0028] the fusion protein sequentially includes, from the N-terminus to the C-terminus, an exogenous protein enhancing immunogenicity, the P32 protein or a fragment thereof, and the L1R protein or a fragment thereof.

[0029] In some embodiments, the fusion protein has an amino acid sequence as shown in SEQ ID NO:9 or 10, or an amino acid sequence having a sequence identity of more than 85% thereto.

[0030] In some embodiments, the antigen combination is soluble.

[0031] According to another aspect of the present disclosure, there is provided a nucleic acid molecule encoding the antigen combination.

[0032] In some embodiments, the expression vector includes a shuttle plasmid, a baculovirus, etc., such as pFastbac1.

[0033] According to another aspect of the present disclosure, there is provided an expression vector including the nucleic acid molecule.

[0034] According to another aspect of the present disclosure, there is provided a host cell including the nucleic acid molecule.

[0035] In some embodiments, the host cell is selected from prokaryotic cells and / or eukaryotic cells.

[0036] In some embodiments, the prokaryotic cell includes one or more of bacterial cells, Escherichia coli or Streptomyces.

[0037] In some embodiments, the bacterial cell includes Escherichia coli cells, such as one or more of DH5α, DH10bac, XL10-Gold, TG1, Stbl2, BJ5183, HB101 or Turbo.

[0038] In some embodiments, the eukaryotic cell includes one or more of yeast cells, insect cells or mammalian cells.

[0039] In some embodiments, the insect includes Lepidoptera insects.

[0040] In some embodiments, the insects include, but are not limited to, one or more of Bombyx mori Linnaeus, Mamestra brassicae Linnaeus, Spodoptera frugiperda pupae, Trichoplusia ni, and trichogrammatid.

[0041] In some embodiments, the insect cells include, but are not limited to, one or more of sf9 insect cells, sf21 insect cells, SF+ cell line, or High Five cells.

[0042] In some embodiments, the mammals include one or more of mice, rats, chickens, rabbits, dogs, monkeys, cows, sheep, or pigs.

[0043] In some embodiments, the mammalian cells include one or more of 3T3 cells, 10T1 / 2 cells, BHK cells, MDCK cells, COS1 cells, COS7 cells, BSC1 cells, BSC40 cells, BMT10 cells, LT cells, or C2C12 cells.

[0044] According to another aspect of the present disclosure, a pharmaceutical composition is provided, and the pharmaceutical composition includes the antigen combination.

[0045] In some embodiments, the pharmaceutical composition includes pharmaceutically acceptable excipients.

[0046] In some embodiments, the pharmaceutical composition includes a vaccine composition.

[0047] According to another aspect of the present disclosure, a detection kit is provided, which includes the antigen combination.

[0048] In some embodiments, the kit is used for detecting antibodies related to sheep pox virus.

[0049] In some embodiments, the sheep pox virus includes lumpy skin disease virus, goat pox virus, and / or sheep pox virus.

[0050] According to another aspect of the present disclosure, a detection method is provided, and the method includes using the antigen combination to detect antibodies related to sheep pox virus.

[0051] In some embodiments, the sheep pox virus includes lumpy skin disease virus, goat pox virus, and / or sheep pox virus.

[0052] According to another aspect of the present disclosure, there is provided the use of the antigen combination, the nucleic acid molecule, the expression vector or the host cell in the diagnosis, prevention or treatment of sheeppox virus-related infections.

[0053] In some embodiments, the sheeppox virus includes lumpy skin disease virus, goatpox virus and / or sheep pox virus.

[0054] According to another aspect of the present disclosure, there is provided the use of the antigen combination, the nucleic acid molecule, the expression vector or the host cell in the preparation of antibodies.

[0055] In some embodiments, the antibody is a neutralizing antibody against sheeppox virus.

[0056] In some embodiments, the sheeppox virus includes lumpy skin disease virus, goatpox virus and / or sheep pox virus.

[0057] Advantages of the present disclosure:

[0058] (1) The present disclosure first proposes a scheme of combining LSDV P32 recombinant protein or its fragment with L1R recombinant protein or its fragment. Whether for immunization or detection, good effects have been achieved, which are significantly better than the effects of using LSDV P32 protein or its fragment and L1R protein or its fragment alone.

[0059] (2) The present disclosure further tandemly connects the full-length gene sequences of P32 recombinant protein or its fragment and L1R protein or its fragment, adds a universal CD4+ helper T cell epitope sequence (tetanus toxin P2 gene) at the N-terminus, constructs a recombinant plasmid, and performs recombinant expression of the tandem protein. Especially when expressed using a eukaryotic expression system, the obtained tandem protein is soluble, can be correctly folded into a functional conformation, and has a high expression level and high purity, and is suitable for large-scale production.

[0060] (3) The present disclosure uses the tandem fusion protein of P32 recombinant protein or its fragment and L1R protein or its fragment or the mixture of P32 recombinant protein or its fragment and L1R protein or its fragment as a coating antigen to indirectly detect LSDV positive and negative sera by ELISA, and good detection results have been obtained. The difference between positive and negative sera is more obvious than when using a single protein. The antigen combination of P32 recombinant protein or its fragment and L1R protein or its fragment has good application prospects in the detection of LSDV and sheeppox infection.

[0061] (4) The present disclosure uses a highly pure LSDV P32N+L1R tandem protein, especially a eukaryotically expressed tandem protein, as an immunogen to prepare polyclonal antibodies. Through neutralization tests, it is determined that the prepared polyclonal antibodies have good neutralization effects, and the neutralization effects are far higher than those of polyclonal antibodies prepared with the P32N+L1R tandem protein without adding P2, as well as those prepared with the single antigens of P32N protein and L1R protein. The present disclosure adds a universal CD4+ helper T cell epitope sequence to the N-terminus of the tandem protein, which promotes the activation of specific CD4+ helper T cells to recognize the antigen peptide-MHC II complex, enhances the activation and proliferation of B cells, helps to generate a continuous immune response, facilitates the secretion of high levels of neutralizing antibodies, and greatly improves the immune effect and the screening success rate of neutralizing antibodies, providing a powerful tool for the research and screening of LSDV and sheeppox-related neutralizing antibodies. BRIEF DESCRIPTION OF THE DRAWINGS

[0062] Figure 1 Shows the PCR identification results of the P1, P2, and P3 generations of recombinant baculoviruses of P32N and L1R.

[0063] Figure 2 Shows the SDS-PAGE detection and identification diagrams of the P32N and L1R recombinant tandem proteins and the P32N and L1R single recombinant proteins.

[0064] Figure 3 Shows the Western-blot analysis results of the P32N and L1R recombinant tandem proteins. Among them, 1 is the protein Marker; among them, 2 is the purified P32N and L1R recombinant tandem protein.

[0065] Figure 4 Shows the specificity identification of the P32N and L1R recombinant tandem proteins. Among them, 1 is the protein Marker; 2 is the inactivated LSDV positive serum; 3 is the inactivated GPTV positive serum; 4 is the inactivated SPPV positive serum; 5 is the inactivated PPRV vaccine virus positive serum; 6 is the inactivated Akabane disease (AKAV) positive serum; 7 is the bovine negative serum.

[0066] Figure 5 Shows the immunogenicity analysis and comparison of the P32N and L1R recombinant tandem proteins with the single recombinant proteins.

[0067] Figure 6 Shows the neutralization titers of the polyclonal antisera of the P32N, L1R, and P32N+L1R recombinant proteins measured by IFA. Among them Figure 6 A represents the IFA result of the polyclonal antiserum of the recombinant protein P32N; Figure 6 B represents the IFA result of the polyclonal antiserum of the recombinant protein L1R; Figure 6 C represents the IFA result of the polyclonal antiserum of the recombinant tandem protein P32N+L1R with the P2 gene sequence.Figure 6 D represents the IFA result of the recombinant P32N+L1R polyclonal antiserum without the P2 gene sequence. The ratio is the dilution of the polyclonal antiserum. Detailed implementation manners

[0068] To make the purpose, technical solutions and advantages of the present disclosure clearer and more understandable, the following further details the present disclosure in combination with embodiments. The specific embodiments described herein are only used to explain the present disclosure and do not constitute any limitation to the present disclosure. In addition, in the following description, the descriptions of well-known structures and technologies are omitted to avoid unnecessarily confusing the concepts of the present disclosure. Such structures and technologies are also described in many publications.

[0069] In order to better prevent and control the LSDV epidemic and quickly and accurately diagnose LSDV infection, the present disclosure has developed a recombinant tandem protein that can react with LSD antibodies, and has conducted immunogenicity and antigenicity tests. The recombinant tandem protein not only achieved good test results in the indirect ELISA for detecting LSDV antibodies, but also the neutralization test results showed that the polyclonal antibody prepared from this antigen had a good neutralization effect.

[0070] According to the technical solution of the present disclosure, certain amino acids in the amino acid sequence can be conservatively substituted without changing the activity or function of the protein, as shown in Table 1.

[0071] Table 1. Amino acids for conservative substitution

[0072] Residue Conservative substitution Residue Conservative substitution Ala Ser Leu Ile; Val Arg Lys Lys Arg; Gln Asn Gln; His Met Leu; Ile Asp Glu Phe Met; Leu; Tyr Gln Asn Ser Thr; Gly Cys Ser Thr Ser; Val Glu Asp Trp Tyr Gly Pro Tyr Trp; Phe His Asn; Gln Val Ile; Leu Ile Leu; Val

[0073] In addition, due to the degeneracy of bases, the bases of the polynucleotide sequence can be substituted without changing the activity or function of the polynucleotide sequence. The LSDV recombinant tandem protein provided by the present disclosure is soluble and can form a correctly folded functional conformation during eukaryotic cell expression, which is closer to the structure and function of the real protein, avoiding the biosafety risks brought by using real viruses.

[0074] The LSDV recombinant tandem protein provided by the present disclosure has good specificity and can detect both LSDV and sheep pox virus simultaneously, and does not cross-react with the positive serum of PPRV vaccine virus, the positive serum of Akabane disease (AKAV), and the negative serum of cattle.

[0075] After the N-terminus of the P32 protein is tandemly expressed with the L1R protein in the present disclosure, the immunogenicity of the recombinant protein is greatly improved.

[0076] The LSDV recombinant tandem eukaryotic protein provided by the present disclosure can also be used for the indirect ELISA to detect LSDV antibodies and for the neutralization test to screen neutralizing antibodies.

[0077] Definition

[0078] Unless otherwise defined, all technical and scientific terms used in this disclosure have the same meaning as commonly used in the art to which this disclosure pertains. For the purpose of interpreting this specification, the following definitions will apply, and where appropriate, terms used in the singular form will also include the plural form, and vice versa.

[0079] Unless the context clearly indicates otherwise, the expressions "a" and "an" used herein include plural referents.

[0080] The expression "about" as used herein is as understood by a person of ordinary skill in the art and varies within a certain range depending on the context in which it is used. If a person of ordinary skill in the art does not understand the use of the term based on the context in which it is used, "about" will mean up to plus or minus 10% of a particular value.

[0081] The term "Lumpy skin disease virus (LSDV)" used in this disclosure is a double-stranded DNA virus. Currently, only one serotype has been discovered. It has common major antigens with goatpoxvirus (GTPV) and sheep poxvirus (SPPV), both belonging to the genus Capripoxvirus, and there are cross-neutralizing antibodies, making it impossible to distinguish them serologically. Among them, the P32 protein is a major structural protein located on the surface of the LSDV envelope, containing major antigenic epitopes, having strong immunogenicity, and being able to stimulate the host to produce antibodies at the initial stage of virus infection to prevent virus spread, but unable to prevent virus replication at the inoculation site. In addition, it is reported that the A27L and L1R proteins of LSDV can trigger immune responses in other poxviruses (such as goatpox and cowpox) and are targets of neutralizing antibodies. The L1R protein is a myristoylated transmembrane protein, approximately 23 - 29 kD in size, present on the outer membrane surface of virus particles and expressed in the late stage of infection. The A27L protein is present on the surface of mature virus particles within cells and plays an important role in virus-cell binding and membrane fusion.

[0082] As used herein, the term "vaccine" includes any non-pathogenic immunogen that, when administered to a host, induces protective immunity against a specific pathogen. Vaccines can take many forms. A vaccine can be a whole organism that shares important antigens with the pathogen but is not itself pathogenic. Vaccines can also be prepared from killed pathogens or attenuated pathogens. Vaccines can also be prepared from macromolecules isolated and purified from pathogenic organisms. For example, a toxoid vaccine contains an inactive form of a soluble bacterial toxin - causing the production of antitoxin antibodies rather than immunity to the intact bacteria. A subunit vaccine contains only a single immunogenic protein isolated from the pathogen of interest. A hapten-conjugated vaccine links certain carbohydrate or polypeptide epitopes isolated from the pathogen of interest to an immunogenic carrier such as tetanus toxoid. These strategies essentially use epitopes as haptens to induce antibody production, which then recognizes the same epitopes on the native pathogen.

[0083] As used herein, the term "recombinant subunit vaccine" is a type of vaccine that contains only the antigenic portions of a pathogen, i.e., the antigens that can induce an immune response. Subunit vaccines can be made from discrete virus particles in cell culture or recombinant DNA expression, in which case they are called recombinant subunit vaccines.

[0084] As used herein, the term "pharmaceutical composition" refers to any composition containing at least one bioactive agent, such as including the fusion protein. When used herein, the term "pharmaceutical composition" also refers to a composition containing an active pharmaceutical ingredient to be delivered to a subject to, for example, achieve a therapeutic, prophylactic, diagnostic, arresting, or prognostic effect. In certain embodiments, the pharmaceutical composition contains an active pharmaceutical ingredient and a pharmaceutically acceptable excipient. As used herein, the components of the term "pharmaceutically acceptable excipient" refer to substances that are suitable for use in humans and / or animals without undue adverse side effects (such as toxicity, irritation, and allergic reactions), i.e., substances with a reasonable benefit / risk ratio. Some examples of pharmaceutically acceptable excipients are cellulose and its derivatives (such as methylcellulose, ethylcellulose, hydroxypropylmethylcellulose, sodium carboxymethylcellulose, etc.), gelatin, talc, solid lubricants (such as stearic acid, magnesium stearate), calcium sulfate, vegetable oils (such as soybean oil, sesame oil, peanut oil, olive oil, etc.), polyols (such as propylene glycol, glycerol, mannitol, sorbitol, etc.), emulsifiers (such as Tween), wetting agents (such as sodium lauryl sulfate), buffers, chelating agents, thickening agents, pH regulators, transdermal enhancers, coloring agents, flavoring agents, stabilizers, antioxidants, preservatives, bacteriostatic agents, pyrogen-free water, etc.

[0085] As used herein, the term "sequence identity" refers to a measure of the degree of identity between two amino acid or nucleotide sequences (e.g., a query sequence and a reference sequence), typically expressed as a percentage. Generally, prior to calculating the percentage identity between two amino acid or nucleotide sequences, the sequences are aligned and gaps (if any) are introduced. If, at a given alignment position, the amino acid residue or base in both sequences is the same, the two sequences are considered to be identical or a match at that position; if the amino acid residue or base in the two sequences is different, the two sequences are considered to be non-identical or a mismatch at that position. In some algorithms, the percentage of sequence identity is obtained by dividing the number of matching positions by the total number of positions in the alignment window. In other algorithms, the number and / or length of gaps are also taken into account. Commonly used sequence alignment algorithms or software include DANMAN, CLUSTALW, MAFFT, BLAST, MUSCLE, etc. For the purposes of the present disclosure, the publicly available alignment software BLAST (obtainable from https: / / www.ncbi.nlm.nih.gov / ) may be used, with default settings, to obtain an optimal sequence alignment and calculate the sequence identity between two amino acid or nucleotide sequences. As used herein, "at least 85% sequence identity" includes contiguous segments of at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity over the entire length of the sequence.

[0086] The term "codon optimization" refers to the modification of the codons of a nucleic acid molecule in a gene or coding region without changing the amino acid sequence of the polypeptide, to reflect the typical codon usage of the host organism. Such optimization includes replacing at least one, or more than one, or a substantial number of codons with one or more codons more frequently used in the genes of the host organism. In some embodiments, codon optimization is used to fine-tune the expression level of a construct of interest. Codon optimization includes, but is not limited to, the process of selecting codons for a coding sequence to accommodate the codon preference of an expression host organism. Many organisms exhibit a bias or preference for using specific codons to encode the insertion of specific amino acids into a growing polypeptide chain. Codon preference or codon bias, which varies in codon usage between organisms, is permitted by the degeneracy of the genetic code and is well documented between many organisms. Codon bias is generally correlated with the translational efficiency of messenger RNA (mRNA), which in turn is thought to depend particularly on the properties of the codons being translated and the availability of specific transfer RNA (tRNA) molecules. The prevalence of the tRNA selected in a cell is typically a reflection of the codons most frequently used in peptide synthesis. Thus, genes can be customized for optimal gene expression in a given organism based on codon optimization.

[0087] As used herein, the term "linker" refers to a (peptide) linker of natural and / or synthetic origin, composed of linear amino acids. The various parts in the fusion proteins of the present disclosure can be linked by linkers, where each linker is fused to and / or otherwise linked (e.g., via peptide bonds) to at least two polypeptides or domains. Linkers are classified, for example, as flexible linkers, rigid linkers, etc. A "rigid linker" is composed of amino acid residues that are prone to forming stable secondary structures. In many cases, due to its ability to form relatively stable secondary structures, it can more effectively separate functional domains and maintain their independent functions compared to flexible linkers. A "flexible linker" is composed of small non-polar amino acids (such as glycine) or polar amino acids (such as serine or threonine). Small amino acids can provide more flexibility, enabling the linked functional domains not to interfere with each other and thus better play their roles. Polar amino acids such as serine and threonine can form hydrogen bonds with water molecules, so they can ensure the stability of the linker in aqueous solutions while reducing adverse reactions between the linker and protein regions.

[0088] Examples and drawings are provided below to assist in understanding the present disclosure. However, it should be understood that these examples and drawings are only used to illustrate the present disclosure and do not constitute any limitation. The actual protection scope of the present disclosure is set forth in the claims. It should be understood that any modifications and changes can be made without departing from the spirit of the present disclosure.

[0089] Examples

[0090] 1. Materials

[0091] 1.1 Bacterial Strains

[0092] E. coli competent cells DH5α and DH10Bac were purchased from Beijing TransGen Biotech Co., Ltd. The pFastbac1 vector and sf9 cells were preserved by the Animal Inspection and Quarantine Laboratory of the Chinese Academy of Inspection and Quarantine.

[0093] 1.2 Sera

[0094] The LSDV positive serum inactivated with 0.3% TNBP and 1% triton X-100 was kindly provided by the China Animal Husbandry Research Institute. The GPTV positive serum, SPPV positive serum, PPRV vaccine virus positive serum, and Akabane disease (AKAV) positive serum inactivated with 0.3% TNBP and 1% triton X-100 were preserved by the China Animal Disease Control and Prevention Center. Bovine negative control serum was purchased from Gibco.

[0095] 2. Reagents

[0096] The SIM SF serum-free medium was purchased from Beijing Sino Biological Inc., and the Ni-NTA agarose gel resin and plasmid extraction kit were purchased from QIAGEN. The BCA protein concentration assay kit was purchased from Beijing Solarbio Science & Technology Co., Ltd. The fetal bovine serum was purchased from Gibico. The BamH I / Xho I restriction endonuclease, T4 ligase, and TaKaRa LAPCR TM Kit were purchased from TaKaRa. The DNA extraction kit DNeasy Blood and Tissue Kit was purchased from Qiagen. The agarose gel DNA purification kit, IPTG, X-gal, and ampicillin were purchased from Beijing TransGen Biotech Co., Ltd. Rabbit anti-bovine IgG HRP and rabbit anti-goat IgG HRP were both purchased from Bioworld Technology.

[0097] 3. Instruments

[0098] The ordinary PCR instrument of ABI company (AB Applied Biosystems), the desktop centrifuge of sigma company (3-18k), the constant temperature shaking incubator (HZQ-F100), the fluorescence microscope (ZEISS, AXIO), the Liuyi electrophoresis instrument, and the dual infrared laser scanning imaging system (Proteinsimple).

[0099] Example 1 Preparation and Identification of Multiple Antigen Proteins of Lumpy Skin Disease Virus

[0100] The amino acids of the full-length P32, full-length L1R, and full-length A27L of the lumpy skin disease virus Xinjiang strain (OP508345.1) published in GenBank are shown in Table 2.

[0101] Table 2. Full-length Amino Acid Sequences of P32 and L1R

[0102]

[0103]

[0104] After bioinformatics analysis, different truncated forms of P32 were taken, as shown in Table 3.

[0105] Table 3. Amino Acid Sequences of Truncated Forms of P32

[0106]

[0107] Perform small-scale expression and preliminary performance testing. Beijing Tsingke Biotechnology Co., Ltd. artificially synthesized the coding nucleic acid sequences of P32 and its fragments, A27L, and L1R (the nucleotide sequences are shown in SEQ ID NO: 15-20), inserted them into the pfastbac1 vector, transformed DH10bac competent cells, extracted the plasmid, and transfected the insect cells sf9 for small-scale expression.

[0108] After determining the concentration of the antigen expressed in small scale using a BCA protein quantification kit, adjust it to 1 mg / mL. Dilute it 1:1000 with the coating buffer and coat it at 100 μL / well overnight at 4°C. After blocking the next day, detect the LSDV positive serum and bovine negative serum diluted 1:100 times to perform indirect ELISA to detect the protein antigenicity. The antigenicity is expressed as P / N, which is the ratio of the OD 450nm value of the positive serum to the OD450 nm value of the negative serum. Select the one with a higher P / N for subsequent experiments. The results are shown in Table 4.

[0109] Table 4 Results of indirect ELISA for the first round of antigen screening

[0110] Name Protein 1 Protein 2 Protein 3 Protein 4 Protein 5 Protein 6 Protein P32 P32N P32N0 P32N1 A27L L1R OD450nm value of positive serum 3.486 2.694 2.198 1.576 2.963 3.543 OD450nm value of negative serum 2.795 0.703 0.864 0.584 1.054 1.018 P / N value 1.25 3.83 2.54 2.69 2.81 3.48

[0111] It can be seen from the preliminary indirect ELISA results shown in Table 4 that the non-specific reaction of Protein 1 is obvious. The P / N values of Proteins 2, 3, and 4 are significantly better than that of Protein 1, and the P / N values of Proteins 5 and 6 are also greater than 2.1.

[0112] Example 2 Preparation, Identification and Screening of Recombinant Antigens of Lumpy Skin Disease Virus

[0113] Physically mix or tandem express the antigen proteins expressed in small scale to further improve the P / N value of the antigen.

[0114] 1. Physical mixing of LSDV recombinant antigen proteins

[0115] To better test the antigenicity of each antigen, coat the antigen proteins expressed in small scale by mixing them in pairs, and then perform indirect ELISA to detect the LSDV positive serum and negative serum. Select the combination with a higher P / N value as the optimal combination. The results are shown in Table 5.

[0116] Table 5 Screening of antigen protein combinations by physical mixing and results of indirect ELISA

[0117] Protein combination (1:1) OD450nm value of positive serum OD450nm value of negative serum P / N value P32N:L1R 1.964 0.316 6.22 P32N0:L1R 3.421 1.019 3.36 P32N1:L1R 1.854 0.679 2.73 P32N:A27L 1.672 0.442 3.78 P32N0:A27L 2.538 0.857 2.96 P32N1:A27L 3.261 1.073 3.04 A27L:L1R 2.727 1.258 2.18

[0118] 2. Tandem expression of LSDV recombinant antigen

[0119] Further design and synthesis of tandem proteins were carried out. The tandem mode was all carried out in series using a flexible linker (SEQ ID NO: 7: GGGS). The specific tandem gene design is as follows:

[0120] Protein 7: P32N + L1R;

[0121] Protein 8: P32N0 + L1R;

[0122] Protein 9: P32N1 + L1R;

[0123] Protein 10: P32N + A27L;

[0124] Protein 11: P32N0 + A27L;

[0125] Protein 12: P32N1 + A27L;

[0126] Protein 13: A27L + L1R;

[0127] According to a method similar to that in Example 1, the coding nucleic acid sequences of the above proteins were synthesized and inserted into the pfastbac1 vector. After small-scale expression and purification of the recombinant baculovirus, indirect ELISA was used to detect the protein antigenicity with LSDV positive serum. The one with the largest P / N was the best. The results are shown in Table 6.

[0128] Table 6. Indirect ELISA results of tandem trial expression proteins

[0129]

[0130] According to the results shown in Table 6, it can be found that the P / N value of Protein 7 is significantly better than that of other proteins.

[0131] Based on the above screening results, it was found that both detection after co - coating with P32N and L1R or ELISA detection after tandem expression had good antigenicity. When detecting LSDV positive serum, the P / N value could reach more than 6. Therefore, P32N and L1R were set as the main research objects for eukaryotic expression and expression of tandem proteins, and subsequent application detection was carried out.

[0132] Example 3 Optimization and Identification of Recombinant Antigen of Lumpy Skin Disease Virus

[0133] 1. Immunogenicity of Physical Mixing and Co - immunization of LSDV Recombinant Antigens

[0134] After mixing 50 μg of LSDV-P32N and 50 μg of LSDV-L1R recombinant proteins, they were mixed with an equal volume of Freund's complete adjuvant and then used to immunize 2 eight-week-old BALB / c mice by intraperitoneal injection. At the same time, 2 negative mice were immunized with Freund's complete adjuvant emulsified with PBS; 14 days later, a second immunization was carried out. The positive group mice were immunized with Freund's incomplete adjuvant emulsified with an equal volume of a mixture of 50 μg of LSDV-P32N and 50 μg of LSDV-L1R recombinant proteins, and the negative group mice were treated in the same way; 28 days later, a third immunization was carried out. The positive group mice were immunized with a mixture of 50 μg of LSDV-P32N and 50 μg of LSDV-L1R recombinant proteins, and the negative group mice were immunized with PBS. Mouse sera were collected after the first and second immunizations respectively, and mouse blood was collected 14 days after the third immunization, and the sera were collected.

[0135] The purified LSDV-P32N protein and LSDV-L1R protein were respectively diluted to 1 mg / mL, mixed in equal volume at 1:1, and then diluted 1:1000 with the coating buffer (0.05 M carbonate buffer, pH 9.6). 100 μL of the diluted solution was added to each well to coat the enzyme-linked immunosorbent assay (ELISA) plate and incubated overnight at 4 °C; washed 3 times with PBS, 2 - 3 minutes each time, blocked with 5% bovine serum albumin (BSA) at 37 °C for 2 h; washed 3 times with PBS, 2 - 3 minutes each time; the antiserum obtained after the first, second, and third immunizations of the combined immunization of LSDV-P32N protein and LSDV-L1R protein was diluted 1:100 with 5% BSA and added to the corresponding protein wells respectively, incubated at 37 °C for 1 h, and the negative serum was treated in the same way; washed 5 times with PBST, 2 - 3 minutes each time; added HRP-labeled goat anti-mouse secondary antibody (dilution ratio 1:5000) diluted with 5% BSA, incubated at 37 °C for 1 h; washed 5 times with PBST, 2 - 3 minutes each time, added 100 μL of TMB chromogenic solution to each well, developed color in the dark for 15 min, added 2 mol / L H 2 SO 4 Stop the reaction and measure the OD 450nm value.

[0136] The specific antibody titers in the sera of immunized mice after the first, second, and third immunizations were determined by indirect ELISA. As Figure 5 shown, compared with the control group, specific antibodies were induced in mice immunized with the mixture of LSDV P32N protein and L1R protein, and the titer of the sera of the immunized group mice increased with the extension of time. The OD 450nm value of the sera could reach about 2.0 after the third immunization, while the OD 450nm of the control group was below 0.1.

[0137] 2. Optimization and identification of tandem expression of LSDV recombinant antigen

[0138] 2.1 Construction of fusion protein

[0139] Select the N-terminal dominant antigenic epitope region P32N of the P32 gene (nucleotide sequence length 510 bp), link it with the full-length L1R sequence (nucleotide sequence length 738 bp) through a flexible linker (SEQ ID NO: 7: GGGS) to form a fusion protein, and add a universal CD4+ helper T cell epitope sequence (tetanus toxin T cell epitope P2, amino acid sequence as shown in SEQ ID NO: 8, nucleotide sequence as shown in SEQ ID NO: 21) at the N-terminal of the fusion protein to construct a recombinant plasmid. The specific sequence is shown in Table 7.

[0140] Table 7. Amino acid sequences and nucleotide sequences involved in the tandem genes

[0141]

[0142]

[0143] The nucleotide sequences described in Table 7 were codon-optimized based on the nucleotide sequences shown in SEQ ID NO: 22 or 23, artificially synthesized by Beijing Tsingke Biotechnology Co., Ltd., and inserted into the pfastbac1 vector. BamH I and Xho I restriction enzyme sites were introduced at both ends of the sequence, and 10 His and 3 Flag were also introduced at the N-terminal of the sequence to construct the pFastBac-LSDV-P32N+L1R recombinant plasmid. The Escherichia coli DH5α competent cells were transformed, and the plates were cultured overnight. The next day, positive clones were picked for sequencing, and the plasmid was extracted from the positive bacterial liquid with correct sequencing for standby.

[0144] At the same time, using the same method, the pFastBac-LSDV-P32N and pFastBac-LSDV-L1R recombinant plasmids were constructed respectively. After obtaining positive clones, the plasmids were extracted for standby.

[0145] 2.2 Construction and identification of recombinant baculovirus shuttle plasmid

[0146] 2.2.1 Construction of recombinant baculovirus shuttle plasmid

[0147] Take 1 μL of the correct-sequenced donor plasmid pFastBac-LSDV-P32N+L1R and add it to 100 μL of DH10bac competent cells, mix gently, and place on ice for 30 min; heat shock in a 42 °C water bath for 45 s, immediately ice-bath for 2 min; supplement 900 μL of pre-warmed LB medium and culture on a shaker at 37 °C and 225 r / min for 4 h to resuscitate the bacteria; take the cultured bacterial liquid and use LB medium to make 10 -1 、10 -2 and 10 -3Three dilutions were made, and then 100 μL of each was taken, added with x-gal and IPTG, and spread on a triple-antibody (gentamicin, kanamycin, and tetracycline) screening plate, followed by culturing in the dark at 37 °C for 48 h; white colonies were selected for identification.

[0148] 2.2.2 Extraction and Identification of Recombinant Baculovirus Shuttle Plasmid

[0149] White single colonies were picked from the plate and inoculated into 100 ml of LB liquid medium containing gentamicin (7 μg / mL), kanamycin (50 μg / mL), and tetracycline (10 μg / mL), and cultured at 37 °C and 180 r / min for 12 h. The cells were collected by centrifugation at 12,000 r / min for 1 min at room temperature, the supernatant was discarded, and then the recombinant baculovirus shuttle plasmid was extracted using the plasmid mini-prep kit from Qiagen (containing solutions I, II, and III); 300 μL of pre-cooled solution I was added to resuspend the cells, and vortexed to make them completely dispersed; 300 μL of solution II was added, gently inverted and mixed evenly, and left on ice for 5 min; 300 μL of pre-cooled solution III was slowly added, gently inverted and mixed evenly, left on ice for 10 min, and centrifuged at 12,000 r / min for 15 min at 4 °C; the supernatant was aspirated into another centrifuge tube and centrifuged at 12,000 r / min for 15 min at 4 °C; the supernatant was aspirated into another centrifuge tube, an equal volume of pre-cooled isopropanol at -20 °C was added, gently inverted and mixed evenly, placed at -20 °C for 30 min, and centrifuged at 12,000 r / min for 15 min at 4 °C; the supernatant was discarded, 1 mL of pre-cooled 75% ethanol at -20 °C was gently added to wash the precipitate, the liquid was discarded, and washed again by the same method; the ethanol was blotted dry as much as possible, and the precipitate was dried in a ventilated place for 15 min; 50 μL of RNAse water was added to dissolve the precipitate at 37 °C for 30 min, and then the extracted plasmid was stored at 4 °C and named bacmid-LSDV-P32N+L1R.

[0150] Since the bacmid DNA genome of baculovirus is very large (>135 kb), it is difficult to identify whether the foreign gene has been successfully transposed by double digestion reaction, and generally the PCR method is used for identification. In this study, by analyzing the structure of bacmid DNA, PCR amplification was performed using the M13 forward primer and M13 reverse primer with the extracted bacmid-LSDV-P32N+L1R plasmid as the template. The primer sequences are as follows:

[0151] M13F: CGCCAGGGTTTTCCCAGTCACGAC (SEQ ID NO: 13)

[0152] M13R: CACACAGGAAACAGCTATGAC (SEQ ID NO: 14)

[0153] The reaction system is as follows:

[0154] 1 μL of bacmid-LSDV-P32N+L1R DNA (100 ng / μL), 4 μL of dNTP (2.5 mM), 5 μL of 10× Taq enzyme buffer, 2 μL of M13(F), 2 μL of M13(R), 1 μL of Taq enzyme (5 U / μL), ddH 2 O is supplemented to 50 μL.

[0155] The reaction conditions are shown in Table 8.

[0156] Table 8. Reaction conditions

[0157]

[0158] 2.3 Preparation and identification of recombinant baculovirus

[0159] 2.3.1 Preparation of recombinant baculovirus

[0160] Transfect sf9 cells with the recombinant baculovirus shuttle plasmid (bacmid-LSDV-P32N+L1R). The specific steps are as follows: One day before transfection, inoculate sf9 cells in a 6-well cell culture plate. When the cell monolayer grows to 70%-80%, prepare for transfection; Take two sterilized 1.5 mL centrifuge tubes. In one tube, add 6 μL of Cellfectin Reagent and 94 μL of Grace basal medium, and mix gently. In the other tube, add 50 μL of the bacmid DNA to be transfected and 50 μL of Grace basal medium, and mix gently. Let it stand at room temperature for 5 min; Mix the two tubes of liquid gently and let it stand at room temperature for 20 min; During this period, aspirate the medium in the wells of the cell culture plate, wash the cells twice with Grace basal medium, and aspirate the liquid; Add 800 μL of Grace basal medium to the 1.5 mL centrifuge tube, gently add it to the cell surface, and place the cell culture plate in an incubator at 27°C; After culturing for 5 h, discard the supernatant, add 2 mL of Grace complete medium and continue to culture for 3-5 days; After obvious cytopathic effect is observed, collect the supernatant, centrifuge to remove cell debris, and aliquot and store at 4°C appropriately. This is the P1 generation of recombinant baculovirus.

[0161] Inoculate serum-free sf9 cells in a T75 cell culture flask to make the monolayer spread to 70%-80%. After 2 h, inoculate the P1 generation of baculovirus into the cells at a volume ratio of 1:50, and place it in an incubator at 27°C for about 3 d. Obvious cytopathic effect can be seen. At this time, collect the cell supernatant and centrifuge at 5000 r / min for 5 min to remove the cell pellet, and aliquot and store at 4°C appropriately. This is the P2 generation of recombinant baculovirus.

[0162] 2.3.2 Identification of Recombinant Baculovirus (bacmid-LSDV-P32N+L1R)

[0163] 2.3.2.1 Virus Identification and Sequence Analysis

[0164] Extract the virus culture solution of each passage, extract nucleic acid, and use ordinary PCR to amplify the extracted nucleic acid sample to detect whether the virus is successfully packaged. The target bands were amplified by PCR for the baculoviruses of P1, P2, and P3 generations, and the sizes were consistent with the expectations. The electrophoresis detection results are shown in Figure 1 .

[0165] 2.3.2.2 Identification of Expression Characteristics

[0166] Perform a small-scale trial expression on the obtained P2-generation virus to determine the expression characteristics of the virus. Infect the P2-generation cells with sf9-generation cells at a ratio of 1:50, collect the cells, then resuspend them with 3 mL of buffer, place them in a 10 mL vial for sonication for 3 s with a 5 s interval, and the sonication duration is about 7 min. Then centrifuge at 15,000 rpm at 4 °C for 1 h. Take the supernatant and bind it to the treated Beads for 2 h, then wash the miscellaneous proteins, wash 5 mL each time for 3 times, and finally resuspend with 500 μL of buffer, and perform SDS-GEL identification.

[0167] The detection results are shown in Figure 2 , and there is a band of the recombinant tandem protein P32N+LIR at about 50 KD, which is consistent with the expected target band size. This LSDV recombinant fusion protein is soluble and can form a correctly folded functional conformation during the expression in eukaryotic cells, which is closer to the structure and function of the real protein and avoids the biosafety risks brought by using real viruses.

[0168] 2.4 Recombinant Expression of Single Recombinant Proteins P32 and L1R

[0169] Construct bacmid-LSDV-P32N and bacmid-LSDV-L1R using the methods in 2.2 - 2.3, and transfect sf9 cells to obtain recombinant baculoviruses. Perform a trial expression with the P3 generation, and purify the recombinant LSDV-P32N (20 KD) and LSDV-L1R (26 KD) single recombinant proteins. The SDS-PAGE detection results are shown in Figure 2 .

[0170] 2.5 Large-scale Expression and Purification of LSDV-P32N+L1R Recombinant Tandem Protein and LSDV-P32N and LSDV-L1R Recombinant Single Proteins

[0171] The P3 generation of baculovirus was used to infect sf9 suspension cells in the logarithmic growth phase in a culture flask at a volume ratio of 1:50. The cells were placed in an incubator at 28 °C and cultured at 120 rpm. After inducing expression for 48 - 72 h, the transfected cells were collected by centrifugation at 1000×g for 20 min. The cell pellet was resuspended in a resuspension buffer containing 20 mM hepes buffer, pH 7.4, 300 mM NaCl, and PMSF protease inhibitor, and sonicated on ice for 3 min. Centrifugation was carried out at 160000 rpm and 4 °C for 20 min. The supernatant was taken and impurities were removed using a 0.22 μm filter. Anti-flag tag affinity magnetic beads were added to the supernatant for binding. The bound protein was washed twice with the resuspension buffer, and then the target protein was eluted with an elution buffer (0.1 mg / mL 3×flag peptide, 20 mM HEPES and 300 mM NaCl, pH 7.4). The eluate was further purified using a Superdex 200 10 / 300GL pre-packed column. Impurity proteins were eluted with a buffer containing 20 mM imidazole (20 mM Tris-HCl, 300 mM NaCl, 20 mM imidazole, pH 7.5), and the target protein was eluted with 200 mM imidazole (20 mM Tris-HCl, 300 mM NaCl, 200 mM imidazole, pH 7.5). The eluate of the LSDV recombinant tandem protein peak was collected, and the target protein was concentrated using a 10KD ultrafiltration concentrator tube. After the purity reached the requirement, the protein concentration was determined by the BCA method, and the concentration was adjusted to 1 mg / mL with PBS. After aliquoting, it was stored at -80 °C for standby.

[0172] The P32N and L1R single recombinant proteins were separately purified using the same purification method. After determining the protein concentration by the BCA method, the concentration was adjusted to 1 mg / mL with PBS. After aliquoting, it was stored at -80 °C for standby.

[0173] 3. Identification of LSDV recombinant tandem protein

[0174] 3.1 SDS-PAGE analysis of the expression product

[0175] Samples of the eluted recombinant protein were taken for SDS-PAGE electrophoresis.

[0176] (1) Preparation of 12% separating gel (15.08 mL): 5.1 mL of purified water, 6.0 mL of 30% acrylamide stock solution, 3.8 mL of Tris-HCl (1.5 moL / L, pH 8.8), 150 μL of 10% SDS, 150 μL of 10% ammonium persulfate, 5 μL of TEMED, ddH 2Make up to 15 mL with O. Mix each component of the separating gel. In the installed glass plate, immediately add the separating gel solution to about 1.5 cm from the top of the glass plate, and gently cover the separating gel solution with a water layer to prevent the inhibition of gel polymerization by oxygen in the air. Let it stand at room temperature (15 - 25 °C) for about 30 min. When a very obvious interface appears after the gel polymerization is completed, the upper water layer can be poured off, and the excess liquid can be blotted as dry as possible with filter paper.

[0177] (2) Prepare 5% stacking gel: 1.0 mL of 30% acrylamide stock solution, 750 μL of Tris-HCl (1 moL / L, pH 6.8), 60 μL of 10% SDS, 60 μL of 10% ammonium persulfate, 6 μL of TEMED, make up to 6 mL with ddH 2 O. Mix each component of the stacking gel, immediately add the stacking gel solution to the top of the glass plate, and carefully insert the comb as soon as possible to avoid generating bubbles. Let it stand at room temperature (15 - 25 °C) for about 30 min, and then carefully pull out the comb.

[0178] (3) Electrophoresis: Add Tris-glycine buffer to the electrophoresis tank. Take an appropriate amount of recombinant protein sample, add an equal volume of 2×SDS loading buffer, mix well, boil in a water bath for 5 min, load 20 μL, electrophorese at 80 V until bromophenol blue enters the separating gel, then increase the voltage to 120 V and continue electrophoresis until bromophenol blue reaches the bottom of the gel.

[0179] (4) Staining: After electrophoresis, remove the gel, rinse it with purified water, soak the gel in Coomassie brilliant blue staining solution (dissolve 0.25 g of Coomassie brilliant blue in 45 mL of methanol: 45 mL of water: 10 mL of glacial acetic acid) with 5 times the gel volume, and place it on a shaker at room temperature (15 - 25 °C) for staining for 2 h.

[0180] (5) Decolorization: After rinsing the stained gel with pure water, place it in a mixture of 30% methanol and 10% glacial acetic acid, shake it for decolorization, and change the decolorizing solution 3 - 4 times during this period. When the blue background is completely decolorized, immerse the gel in pure water to terminate decolorization.

[0181] 3.2 Western-blot analysis of the expression product

[0182] Take the purified recombinant tandem protein sample of LSDV for SDS-PAGE. After completion, take out the gel and prepare a polyacrylamide gel-membrane "sandwich" in the following order: filter paper-gel-PVDF membrane-filter paper. Gently roll a clean glass rod over the gel-membrane "sandwich" to remove the air bubbles between the layers. The sponge pads, filter papers, and PVDF membranes are pre-equilibrated in the transfer buffer for 10 min. Transfer the fixed gel-membrane "sandwich" to the electrotransfer apparatus, with the gel side facing the negative electrode and the PVDF membrane side facing the positive electrode, and connect the cooling device. Transfer at a constant current of 200 mA for 1 h. After the transfer is completed, remove the PVDF membrane and perform the following operations:

[0183] (1) Membrane washing I: After the transfer is completed, remove the PVDF membrane and place it in a glass petri dish of appropriate size. Slowly shake and wash the membrane 3 times with TBST (Solarbio), 5 min each time;

[0184] (2) Blocking: Place the PVDF membrane in a glass petri dish of appropriate size and block it with 5% skim milk powder at 37 °C for 1 h;

[0185] (3) Membrane washing II: Discard the blocking solution and slowly shake and wash the membrane 3 times with TBST, 5 min each time;

[0186] (4) Adding primary antibody: Add the anti-His tag monoclonal antibody diluted with the blocking solution (mouse source: working concentration 1:2000), and slowly shake at room temperature for 1 h;

[0187] (5) Membrane washing III: Discard the primary antibody and slowly shake and wash the membrane 3 times with TBST, 5 min each time;

[0188] (6) Adding secondary antibody: Add the horseradish peroxidase-labeled goat anti-mouse IgG diluted with the blocking solution (working concentration 1:10000 dilution), and slowly shake at room temperature for 1 h;

[0189] (7) Membrane washing IV: Discard the secondary antibody and slowly shake and wash the membrane 3 times with TBST, 5 min each time;

[0190] (8) Color development: Place the PVDF membrane in the chemiluminescent substrate solution, develop the color in the dark, and image and photograph it on the gel imager.

[0191] Use the anti-His tag monoclonal antibody to perform Western Blot identification on the purified recombinant tandem protein. A target band appears around 40-55 KD. The results are shown in Figure 3 .

[0192] 3.3 Specific identification of recombinant tandem protein

[0193] The specificity of the LSDV recombinant tandem protein was identified by Western Blot. The primary antibodies were inactivated LSDV positive serum, GTPV positive serum, SPPV positive serum, PPRV vaccine virus positive serum, Akabane disease (AKAV) positive serum, and bovine negative serum respectively. The secondary antibodies were HRP-labeled rabbit anti-bovine IgG and rabbit anti-sheep IgG respectively. The specific operation steps refer to 3.1 and 3.2.

[0194] The specificity of the purified LSDV recombinant tandem protein was identified by Western Blot. The results are shown in Figure 4 . It can be seen from the figure that the LSDV recombinant tandem protein showed obvious positive reactions only with inactivated LSDV positive serum, GTPV positive serum, and SPPV positive serum, and did not cross-react with PPRV vaccine virus positive serum, Akabane disease (AKAV) positive serum, and bovine negative serum, proving that the recombinant tandem protein has good specificity and can detect LSDV and capripoxvirus simultaneously.

[0195] 3.4 Immunogenicity of LSDV Recombinant Tandem Protein

[0196] After mixing 100 μg of LSDV recombinant tandem protein with an equal volume of Freund's complete adjuvant, 2 8-week-old BALB / c mice were immunized by intraperitoneal injection. At the same time, 2 negative mice were immunized with Freund's complete adjuvant emulsified with PBS; the second immunization was carried out 14 days later. The positive group mice were immunized with Freund's incomplete adjuvant emulsified with an equal volume of 100 μg of LSDV recombinant tandem protein, and the negative group mice were treated in the same way; 28 days later, the third immunization was carried out. 100 μg of LSDV recombinant tandem protein was taken to immunize the positive group mice, and the negative group mice were immunized with PBS. Mouse sera were collected after the first and second immunizations respectively, and mouse blood was collected 14 days after the third immunization, and the sera were collected.

[0197] The purified LSDV recombinant tandem protein was diluted to 1 mg / mL and diluted 1:1000 with coating buffer (0.05 M carbonate buffer, pH 9.6), and 100 μL per well was used to coat the enzyme-linked immunosorbent assay (ELISA) plate and incubated overnight at 4°C; washed 3 times with PBS, 2 - 3 min each time, blocked with 5% BSA at 37°C for 2 h; washed 3 times with PBS, 2 - 3 min each time; the antisera obtained after the first, second, and third immunizations of LSDV recombinant tandem protein were diluted 1:100 with 5% BSA and added to the corresponding protein wells respectively, incubated at 37°C for 1 h, and the negative serum was treated in the same way; washed 5 times with PBST, 2 - 3 min each time; added HRP-labeled goat anti-mouse secondary antibody (dilution ratio 1:5000) diluted with 5% BSA, incubated at 37°C for 1 h; washed 5 times with PBST, 2 - 3 min each time, added 100 μL of TMB chromogenic solution to each well, developed color in the dark for 15 min, added 2 mol / L H2 SO 4 Terminate the reaction and detect the OD 450nm value.

[0198] The specific antibody titer in the sera of immunized mice after the first, second, and third immunizations was determined by indirect ELISA. As Figure 5 shown, compared with the control group, specific antibodies were induced in the mice immunized with the LSDV recombinant tandem protein, and the titer of the sera of the immunized group of mice increased with the extension of time. The OD 450nm value of the sera could reach above 2.0 after the third immunization, while the OD450 nm of the control group was below 0.1.

[0199] 3.4.2 Immunogenicity of the P32N recombinant single protein

[0200] After mixing 100 μg of the LSDV-P32N recombinant protein with an equal volume of Freund's complete adjuvant, 2 8-week-old BALB / c mice were immunized by intraperitoneal injection. At the same time, 2 negative mice were immunized with Freund's complete adjuvant emulsified with PBS; the second immunization was carried out after 14 days. The positive group of mice was immunized with Freund's incomplete adjuvant emulsified with an equal volume of 100 μg of the LSDV-P32N recombinant protein, and the negative group of mice was treated in the same way; the third immunization was carried out after another 28 days. 100 μg of the LSDV-P32N recombinant protein was taken to immunize the positive group of mice, and the negative group of mice was immunized with PBS. The sera of the mice were collected respectively after the first and second immunizations, and the blood of the mice was collected 14 days after the third immunization, and the sera were collected.

[0201] The purified LSDV-P32N recombinant protein was diluted to 1 mg / mL, and after dilution at a ratio of 1:1000 with the coating solution (0.05 M carbonate buffer, pH 9.6), 100 μL per well was used to coat the ELISA plate and incubated overnight at 4°C; washed 3 times with PBS, 2 - 3 min each time, and blocked with 5% BSA at 37°C for 2 h; washed 3 times with PBS, 2 - 3 min each time; the antisera obtained after the first, second, and third immunizations with the LSDV-P32N protein were diluted at a ratio of 1:100 with 5% BSA and added to the corresponding protein wells respectively, incubated at 37°C for 1 h, and the negative sera were treated in the same way; washed 5 times with PBST, 2 - 3 min each time; added the HRP-labeled goat anti-mouse secondary antibody diluted with 5% BSA (dilution ratio 1:5000), incubated at 37°C for 1 h; washed 5 times with PBST, 2 - 3 min each time, and 100 μL of TMB chromogenic solution was added to each well, developed color in the dark for 15 min, and 2 mol / L H 2 SO 4 Terminate the reaction and detect the OD 450nm value.

[0202] The specific antibody titers in the sera of immunized mice after the first, second, and third immunizations were determined by indirect ELISA. As Figure 5 shown, compared with the control group, specific antibodies were induced in the mice immunized with the LSDV recombinant P32N protein, and the titer of the sera of the immunized mice increased with the extension of time. The OD 450nm value of the sera could reach about 1.5 after the third immunization, while the OD 450nm of the control group was below 0.1. However, the OD 450nm values of the anti-sera from the first, second, and third immunizations with the P32N protein were all lower than those of the anti-sera from the first, second, and third immunizations with the recombinant tandem protein 450nm values.

[0203] 3.4.3 Immunogenicity of the L1R recombinant single protein

[0204] After mixing 100 μg of the LSDV-L1R recombinant protein with an equal volume of Freund's complete adjuvant, 2 8-week-old BALB / c mice were immunized by intraperitoneal injection. At the same time, 2 negative mice were immunized with Freund's complete adjuvant emulsified with PBS; the second immunization was carried out after 14 days. The positive group mice were immunized with Freund's incomplete adjuvant emulsified with an equal volume of 100 μg of the LSDV-L1R recombinant protein, and the negative group mice were treated in the same way; the third immunization was carried out after another 28 days. 100 μg of the LSDV-L1R recombinant protein was used to immunize the positive group mice, and the negative group mice were immunized with PBS. The sera of the mice were collected respectively after the first and second immunizations, and the blood of the mice was collected 14 days after the third immunization, and the sera were collected.

[0205] The purified LSDV-L1R recombinant protein was diluted to 1 mg / mL and diluted 1:1000 with the coating solution (0.05 M carbonate buffer, pH 9.6). 100 μL was added to each well to coat the enzyme-linked immunosorbent assay (ELISA) plate and incubated overnight at 4 °C; washed 3 times with PBS, 2 - 3 min each time, blocked with 5% bovine serum albumin (BSA) at 37 °C for 2 h; washed 3 times with PBS, 2 - 3 min each time; the anti-sera obtained after the first, second, and third immunizations with the LSDV-L1R protein were diluted 1:100 with 5% BSA and added to the corresponding protein wells respectively, incubated at 37 °C for 1 h, and the negative sera were treated in the same way; washed 5 times with PBST, 2 - 3 min each time; added the HRP-labeled goat anti-mouse secondary antibody diluted with 5% BSA (dilution ratio 1:5000), incubated at 37 °C for 1 h; washed 5 times with PBST, 2 - 3 min each time, 100 μL of TMB chromogenic solution was added to each well, developed color in the dark for 15 min, and 2 mol / L H 2 SO 4 was added to terminate the reaction and the OD 450nm value was detected.

[0206] The specific antibody titers in the sera of immunized mice after the first, second, and third immunizations were determined by indirect ELISA. AsFigure 5 As shown, compared with the control group, specific antibodies were induced in mice immunized with the LSDV recombinant L1R protein, and the titer of the serum of the immunized mice increased with the extension of time. The OD value of the serum after the third immunization could reach about 1.5, while the OD value of the control group was below 0.1. However, the OD values of the antiserum of the L1R protein after the first, second, and third immunizations were all lower than those of the antiserum of the recombinant tandem protein after the first, second, and third immunizations. The OD values were basically equivalent to those of the antiserum of the P32N protein after the first, second, and third immunizations. Thus, it can be seen that the growth amplitude of the serum titer of the mice immunized with the tandem recombinant protein of the P32N protein and the L1R protein and the serum titer of the mice co-immunized with the P32N and L1R proteins were basically the same, and both were higher than the serum titer of the mice immunized with a single protein. 450nm value 450nm values of the first, second, and third immunizations of the L1R protein antiserum 450nm were all lower than those of the first, second, and third immunizations of the recombinant tandem protein antiserum 450nm values. The OD 450nm values of the first, second, and third immunizations of the P32N protein antiserum

[0207] In summary, whether the P32N protein and the L1R protein are physically mixed or the fusion protein expressed in tandem can greatly improve the immunogenicity.

[0208] Example 4. Application of establishing an indirect ELISA for detecting LSDV antibodies using the LSDV recombinant antigen

[0209] 1. Materials

[0210] 1.1 Serum: The LSDV positive serum inactivated with 0.3% TNBP and 1% triton X-100 was kindly provided by the China Animal Husbandry Research Institute. The GPTV positive serum, SPPV positive serum, PPRV vaccine virus positive serum, Akabane disease (AKAV) positive serum, and 88 bovine serum sample plates inactivated with 0.3% TNBP and 1% triton X-100 were stored by the China Animal Disease Control and Prevention Center. The bovine negative control serum was purchased from Gibco.

[0211] 1.2 Cells: SF9 cells, 293F cells, Hi5 cells, and SP2 / 0 cells were all identified, stored, and supplied by the Institute of Animal Inspection and Quarantine, Chinese Academy of Inspection and Quarantine.

[0212] 1.3 Proteins: The purified LSDV recombinant tandem protein P32N+L1R, L1R recombinant protein, and P32N recombinant protein were all identified, stored, and supplied by the Institute of Animal Inspection and Quarantine, Chinese Academy of Inspection and Quarantine; the commercial His-tagged protein was purchased from Shanghai Bio-Pack Biotechnology Co., Ltd.

[0213] 1.4 Experimental animals: Female BALB / c mice aged 6 - 8 weeks were provided by Beijing Vital River Laboratory Animal Technology Co., Ltd.

[0214] 1.5 Related reagents: HRP-labeled goat anti-mouse IgG antibody was purchased from Zhongshan Jinqiao, and FITC-labeled goat anti-mouse IgG antibody was purchased from Abcam; QuickAntibody-Mouse 5W adjuvant was purchased from Beijing Bioclone Immunotech Co., Ltd.

[0215] 2. Establishment of indirect ELISA method

[0216] 2.1 Establishment of indirect ELISA for LSDV P32N+L1R recombinant tandem protein and P32N and L1R single recombinant proteins

[0217] For indirect ELISA, the optimal coating concentration of the antigen and the optimal dilution of the enzyme-labeled secondary antibody were determined by checkerboard titration. The operation steps are as follows:

[0218] (1) Coating: Dilute the purified LSDV recombinant tandem protein to 1 mg / mL and then dilute it with coating buffer to 1:500, 1:1000, 1:2000, 1:4000, 1:8000, 1:16000, 1:20000 for coating, 100 μL / well, incubate overnight at 2 - 8 °C;

[0219] (2) Washing: Take out the enzyme-linked immunosorbent assay (ELISA) plate, discard the coating buffer, wash it 3 times with PBST, and pat dry;

[0220] (3) Blocking: Add 200 μL / well of 5% BSA (prepared with PBST) to each well, incubate at 37 °C for 1 h, repeat step (2) to wash 3 times, and pat dry;

[0221] (4) Primary antibody: Add 1:100 - diluted negative serum and positive serum at 100 μL / well, and set a blank control at the same time. Incubate at 37 °C for 1 h, repeat step (2) to wash 3 times, and pat dry;

[0222] (5) Secondary antibody: Dilute the enzyme-labeled secondary antibody with diluent (i.e., blocking solution) at 1:5000, 1:10000, 1:20000, 1:40000, add 100 μL / well, react at 37 °C for 1 h, repeat step (2) to wash 3 times, and pat dry;

[0223] (6) Color development: Add 100 μL / well of TMB color development solution to each well, develop color in the dark at room temperature for 15 min;

[0224] (7) Termination and reading: Add sulfuric acid (2 moL / L) at 50 μL / well to terminate the reaction, and detect the OD450nm value with an enzyme-linked immunosorbent assay (ELISA) reader.

[0225] (8) Judgment: If P / N ≥ 2.1, it is judged as positive; if P / N < 2.1, it is judged as negative.

[0226] The optimal coating concentration of the recombinant tandem protein indirect ELISA was determined to be 0.1 mg / mL by the above-mentioned checkerboard titration method, and the optimal dilution of the enzyme-labeled secondary antibody was 1:10,000.

[0227] The indirect ELISA detection methods for P32N and L1R were established by optimization in the same way.

[0228] 2.2 Establishment of indirect ELISA with mixed coating of LSDV P32N recombinant protein and L1R recombinant protein

[0229] (1) Coating: After diluting the purified LSDV P32N recombinant protein and L1R recombinant protein to 1 mg / mL, they were mixed at volume ratios of 1:1, 2:1, 3:1, 1:2, and 1:3 respectively, and then diluted with the coating buffer to 1:500, 1:1000, 1:2000, 1:4000, 1:8000, 1:16000, and 1:20000 for coating, 100 μL / well, and incubated overnight at 2 - 8 °C;

[0230] (2) The subsequent operations were carried out according to the operations in 2.1.

[0231] The optimal coating concentration of the mixed antigen was determined to be 0.1 mg / mL by the checkerboard titration method, and the optimal dilution of the enzyme-labeled secondary antibody was 1:10,000.

[0232] 3. Detection of clinical bovine serum samples

[0233] 98 bovine serum sample plates with known infection status were detected simultaneously by P32N + L1R tandem protein indirect ELISA, indirect ELISA with mixed coating of P32N and L1R, and indirect ELISA with single recombinant proteins of P32N and L1R, and the detection results of the four indirect ELISA detection methods were compared.

[0234] Table 9. Detection results of 98 bovine serum samples

[0235]

[0236]

[0237]

[0238] As can be seen from Table 9, the indirect ELISA method using the P32N+L1R recombinant tandem protein and the indirect ELISA method with co - coating of P32N and L1R both had a sensitivity and specificity of 100% for the detection of 98 samples with known infection status. Moreover, the difference between positive and negative sera was more obvious than that of the indirect ELISA methods using single recombinant proteins. Especially for the weak positive samples at the critical value, they had a greater advantage in detection. In contrast, the indirect ELISA method using single recombinant proteins was very likely to miss the detection of positive and negative samples at the critical value, resulting in poor sensitivity and specificity of the single recombinant protein indirect ELISA method.

[0239] Example 3 Application of the polyclonal antibody prepared from the LSDV recombinant tandem protein in neutralization test

[0240] 1. Materials

[0241] 1.1 Virus: The live goatpox vaccine virus was purchased from Harbin Pharmaceutical Group Biological Vaccine Co., Ltd.

[0242] 1.2 Cells: Sheep testicular cells (LT cells) were identified, stored and supplied by the Institute of Animal Inspection and Quarantine, Chinese Academy of Inspection and Quarantine.

[0243] 1.3 Serum: The LSDV positive serum was kindly provided by China Animal Husbandry Research Institute; the mouse polyclonal sera against the LSDV recombinant tandem protein P32N+L1R, the P32N recombinant protein, and the L1R recombinant protein were all prepared, identified, stored and supplied by the Institute of Animal Inspection and Quarantine, Chinese Academy of Inspection and Quarantine. The P32N+L1R (without P2) recombinant fusion protein without the P2 gene sequence was expressed according to Example 2, and the mouse polyclonal serum was obtained by immunizing mice in the same way.

[0244] 1.4 Reagents: PBS and cell fixative were purchased from Beijing Solarbio Science & Technology Co., Ltd.; DMEM medium was purchased from Gibco; goat serum for blocking was purchased from Beijing Zhongshan Golden Bridge Biotechnology Co., Ltd.; goat anti - mouse FITC - labeled antibody was purchased from Abcam.

[0245] 2. Determination of virus - serum neutralizing antibody

[0246] Cultivate LT cells normally and seed the LT cells into a 96-well cell culture plate. Before the neutralization test, all sera were placed in a water bath at 56 °C for 30 min to eliminate the influence of serum complement. Dilute the polyclonal antiserum to be tested, mouse negative serum, and LSDV positive serum by two-fold serial dilution, and make 4 parallel wells for each dilution. Dilute the sheeppox vaccine virus to a dose of 200×TCID50 / 50 μL, add an equal volume of serum and mix, and incubate at 37 °C in an incubator for 1 h. After washing the LT cells cultured in the 96-well plate with a density of 90% 3 times with PBS solution, take 100 μL of the neutralized mixture and inoculate it into the corresponding wells of the 96-well cell culture plate, and incubate at 37 °C in an incubator for 2 h. At the same time, set up a normal virus-infected cell control and a blank control. After 2 h, aspirate the mixture, wash 3 times with PBS, add 200 μL of DMEM maintenance medium, and continue to culture in a 37 °C incubator for 3 - 5 days, and observe the cytopathic effect. After 5 days, use IFA to measure the serum neutralization titer.

[0247] 3. Cellular immunofluorescence (IFA) assay

[0248] The specific operation steps are as follows:

[0249] (1) When obvious cytopathic effect appears, aspirate the cell culture medium, add PBS and rinse once, then aspirate the PBS;

[0250] (2) Add 100 μL of cell fixative to each well and fix at room temperature for 30 min;

[0251] (3) Discard the fixative, add PBS and rinse once, and air dry at room temperature;

[0252] (4) Blocking: Add an appropriate amount of blocking goat serum (covering the bottom surface only) to each well and block at 37 °C for 60 min;

[0253] (5) Add 100 μL of polyclonal antiserum diluted 1:1000 to each well and incubate at 37 °C for 1 h;

[0254] (6) Aspirate the primary antibody incubation solution, add PBS and rinse 3 times, 5 min each time, and air dry;

[0255] (7) Add 100 μL of secondary antibody (goat anti-mouse IgG-FITC) diluted 1:1000 to each well and incubate at 37 °C for 1 h in the dark;

[0256] (8) Aspirate the secondary antibody incubation solution, add PBS and rinse 3 times, 5 min each time, and air dry;

[0257] (9) Observe, photograph, and record under a fluorescence microscope.

[0258] IFA result determination: When the serum sample does not contain LSDV or capripoxvirus neutralizing antibodies, the vaccine virus co-incubated with the serum sample to be tested at any dilution will not be neutralized. As a result, the vaccine virus can infect the nucleus or cytoplasm of LT cells, and specific fluorescence (green) will appear under a fluorescence inverted microscope. Then the serum sample to be tested is negative. Usually (neutralization titer is 200 TCID50), when specific fluorescence appears below the 1:2 dilution line of the serum sample, it is considered a negative serum sample. When the serum sample contains LSDV or capripoxvirus neutralizing antibodies, the vaccine virus co-incubated with the serum sample to be tested will be neutralized by the neutralizing antibodies therein. Moreover, as the dilution factor decreases, more vaccine virus will be neutralized, and less vaccine virus can infect LT cells, and the number of specific fluorescence appearing under the fluorescence inverted microscope will also be less. When only 1 - 2 cells show specific fluorescence or exactly no specific fluorescence appears, it is considered that the amount of virus neutralizing antibodies contained in the serum sample at this dilution can exactly neutralize the virus in the vaccine virus. Through this method, the titer level of virus neutralizing antibodies in the serum sample can be detected. And when the titer in the vaccine virus is 200 TCID50, it can be considered that the dilution value of the serum sample to be tested corresponding to the well where only 1 - 2 cells show specific fluorescence or exactly no specific fluorescence appears observed under the fluorescence inverted microscope is the neutralizing antibody titer value of this serum sample. When the content of neutralizing antibodies in the serum sample to be tested is high enough, all the viruses in the vaccine virus will be neutralized, and thus the virus cannot infect LT cells. Therefore, no specific fluorescence will appear under the fluorescence inverted microscope.

[0259] According to the above result determination criteria, after experimental verification (see Figure 6 ), the neutralization titer of the polyclonal antiserum against the recombinant tandem protein P32N + L1R ≥ 1:64 ( Figure 6 C), the neutralization titer of the polyclonal antiserum against the recombinant tandem protein P32N + L1R (without P2) ≥ 1:32 ( Figure 6 D), while the neutralization titers of the polyclonal antisera against the single recombinant proteins P32N and L1R are both 1:16 ( Figure 6 A and Figure 6 B). It can be seen that the polyclonal antiserum prepared from the recombinant tandem protein P32N + L1R with P2 added has a better neutralization effect, and the titer is much higher than that of the polyclonal antiserum after immunization with the tandem protein without P2 and the single protein. Therefore, adding the common CD4+ helper T cell epitope P2 has no impact on the antigenicity of the recombinant tandem protein and its application in detection, and also increases the titer of neutralizing antibodies, thereby increasing the probability of obtaining neutralizing antibodies and having a higher success rate in the application of screening neutralizing antibodies.

[0260] Finally, it should be noted that the above are only the preferred embodiments of the present disclosure and are not used to limit the present disclosure. Although the present disclosure has been described in detail with reference to the foregoing embodiments, those skilled in the art can still modify the technical solutions described in the foregoing embodiments or perform equivalent replacements on some of the technical features. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present disclosure shall be included within the protection scope of the present disclosure.

Claims

1. An antigen combination, comprising: fragments of the P32 protein; and, L1R protein; the amino acid sequence of the fragment of the P32 protein is positions 26 to 195 of SEQ ID NO: 1 or SEQ ID NO: 4; the amino acid sequence of the L1R protein is SEQ ID NO:

2.

2. The antigen combination according to claim 1, characterized in that: The antigen combination also includes foreign proteins that enhance immunogenicity.

3. The antigen combination according to claim 2, characterized in that: The exogenous proteins that enhance immunogenicity include tetanus toxin T cell epitope P2, cholera toxin B subunit, Escherichia coli heat-labile toxin B subunit, Brucella dioxotetrahydropterin synthase, granular protein mouse polyomavirus VP1, Norovirus capsid protein or fragments thereof.

4. The antigen combination according to claim 2, characterized in that: The foreign protein that enhances immunogenicity is the tetanus toxin T cell epitope P2.

5. The antigen combination according to claim 2, characterized in that: The amino acid sequence of the exogenous protein that enhances immunogenicity is SEQ ID NO:

8.

6. The antigen combination according to any one of claims 1 to 5, characterized in that: The antigen combination includes a mixture of the fragment of the P32 protein and the L1R protein.

7. The antigen combination according to any one of claims 2 to 5, characterized in that: The antigen combination includes a mixture of the foreign protein that enhances immunogenicity, the fragment of the P32 protein and the L1R protein.

8. The antigen combination according to claim 6, characterized in that: The weight ratio of the P32 protein fragment to the L1R protein in the mixture is (1-10): (1-10).

9. The antigen combination according to claim 7, characterized in that: The weight ratio of the foreign protein that enhances immunogenicity, the fragment of the P32 protein and the L1R protein in the mixture is (1-10): (1-10): (1-10).

10. A fusion protein, the amino acid sequence of which is SEQ ID NO: 9 or SEQ ID NO:

10.

11. A nucleic acid molecule encoding the antigen combination according to any one of claims 1 to 9 or the fusion protein according to claim 10.

12. An expression vector comprising the nucleic acid molecule of claim 11.

13. A host cell comprising the nucleic acid molecule of claim 11.

14. The host cell according to claim 13, characterized in that The host cell is selected from prokaryotic cells and / or eukaryotic cells.

15. A pharmaceutical composition, comprising the antigen combination according to any one of claims 1 to 9 or the fusion protein according to claim 10.

16. The pharmaceutical composition according to claim 15, characterized in that The pharmaceutical composition includes pharmaceutically acceptable excipients.

17. The pharmaceutical composition according to claim 15, characterized in that: The pharmaceutical compositions include vaccine compositions.

18. A detection kit comprising the antigen combination according to any one of claims 1 to 9 or the fusion protein according to claim 10.

19. Use of the antigen combination according to any one of claims 1 to 9, the fusion protein according to claim 10, the nucleic acid molecule according to claim 11, the expression vector according to claim 12 or the host cell according to claim 13 or 14 in the preparation of an agent for diagnosing, preventing or treating infection with capripox virus or bovine lumpish dermatitis virus.

20. The use according to claim 19, characterized in that: The capripox virus is goatpox virus and / or sheeppox virus.

21. Use of the antigen combination according to any one of claims 1 to 9, the fusion protein according to claim 10, the nucleic acid molecule according to claim 11, the expression vector according to claim 12 or the host cell according to claim 13 or 14 in the preparation of polyclonal antibodies.

22. The use according to claim 21, characterized in that: The polyclonal antibody is a polyclonal antibody against capripox virus or bovine nodular skin disease virus.

23. The use according to claim 22, characterized in that: The capripox virus is goatpox virus and / or sheeppox virus.

Images