A method for promoting the synthesis of 7-dehydrocholesterol by Saccharomyces cerevisiae

By heterologously expressing and integrating mutant ERG8* and ERG9* in Saccharomyces cerevisiae, the carbon flux of the synthesis pathway of 7-DHC was improved, and the problem of low 7-DHC yield in Saccharomyces cerevisiae was solved, and a significant yield increase was achieved.

CN118703345BActive Publication Date: 2025-07-18JIANGNAN UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202410846650.1
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-06-27
Publication Date
2025-07-18
Estimated Expiration
2044-06-27

AI Technical Summary

Technical Problem

In the prior art, Saccharomyces cerevisiae has insufficient enzyme activity in the 7-dehydrocholesterol (7-DHC) synthesis pathway, resulting in a small carbon flux and low yield, making it difficult to meet industrial needs.

Method used

Recombinant Saccharomyces cerevisiae are constructed by heterologously expressing the mutant mevalonate kinase ERG8* and squalene synthase ERG9* in Saccharomyces cerevisiae, thereby improving the carbon flux of the sterol metabolic pathway and promoting 7-DHC synthesis.

Benefits of technology

The yield of 7-DHC was significantly improved, and 19.86%, 24.04% and 42.47% compared with wild-type, laying the foundation for metabolic engineering to promote 7-DHC synthesis by Saccharomyces cerevisiae.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN118703345B_ABST
    Figure CN118703345B_ABST
Patent Text Reader

Abstract

The present invention discloses a method for promoting the synthesis of 7-dehydrocholesterol by Saccharomyces cerevisiae. By mutating phosphomevalonate kinase ERG8 and squalene synthase ERG9 and integrating them into the Saccharomyces cerevisiae genome separately or simultaneously, several mutant strains with significantly increased 7-dehydrocholesterol production are obtained. Among them, phosphomevalonate kinase ERG8 involves mutations at one or more sites such as 75, 187, 192, 205, 206, 314, 322, 349, etc., and squalene synthase ERG9 involves mutations at one or more sites such as 96, 108, 146, 208, 209, 251, 252, 258, 286, 345, 355, 388, 389, 404, 426, 434, etc. The Saccharomyces cerevisiae mutants provided by the present invention can achieve the production of 7-DHC, laying a foundation for metabolic engineering transformation of Saccharomyces cerevisiae to promote 7-DHC synthesis.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to a method for promoting the synthesis of 7-dehydrocholesterol by Saccharomyces cerevisiae, belonging to the technical field of synthetic biology. Background Art

[0002] 7-dehydrocholesterol (7-DHC) is converted into vitamin D3 through ultraviolet light irradiation (hv) and thermal isomerization.

[0003] (VD3), and VD3 is a steroid hormone required for maintaining human growth and life health. It can promote the absorption of calcium in the intestine to maintain bone calcium balance, relieve immune system diseases, cardiovascular diseases, and various cancers. It is widely used in the fields of medicine and functional foods, etc., and has broad market application prospects. Vitamin D3 and its derivatives such as 25-OH-VD3 and 1,25-(OH)2-VD3 can also be used as drugs to treat many diseases. Nowadays, vitamin D deficiency is a global public health problem, and 7-DHC, as a key precursor of VD3, is a high-value sterol, and its production method has received extensive attention in the industry.

[0004] Currently, the industrial production of 7-DHC mainly includes chemical synthesis method and biosynthesis method. The chemical synthesis of 7-DHC uses lanolin as a raw material and obtains it through steps such as esterification, allylic oxidation, reduction, hydrolysis, and elimination. The chemical synthesis method requires the addition of a large amount of organic reagents, which is easy to cause environmental pollution, and various by-products will be generated due to the changes in temperature and pressure during the reaction process. In contrast, using a microbial cell factory to produce 7-DHC can solve the problems related to the chemical synthesis method. The microbial fermentation method for producing 7-DHC with glucose as a substrate has many advantages such as low cost, unrestricted raw materials, good sustainability, and little environmental pollution, and can solve the problems related to the chemical synthesis method, and is favored by many scholars. Saccharomyces cerevisiae has the advantages of clear genetic background, convenient genetic manipulation, and low cultivation cost. It is a GRAS strain and shows excellent performance and great potential in the microbial fermentation production of products such as alkaloids, artemisinin acid, and terpenoids. The de novo synthesis of 7-DHC can be achieved in Saccharomyces cerevisiae by introducing heterologous 24-dehydrocholesterol reductase (DHCR24), but the yield is low. The reason is that in the relatively long metabolic pathway, due to insufficient activity of pathway enzymes, the carbon flux of the sterol metabolic pathway is small. Therefore, constructing mutants of the key enzymes in the 7-DHC synthesis pathway can increase the carbon flux of the sterol metabolic pathway and promote the production of 7-DHC. Summary of the Invention

[0005] To solve the above problems, the present invention provides a method for promoting the synthesis of 7-DHC by Saccharomyces cerevisiae. In Saccharomyces cerevisiae strains capable of synthesizing 7-DHC, the mutant phosphomevalonate kinase ERG8* and squalene synthase ERG9* are respectively expressed to construct two Saccharomyces cerevisiae mutants, improve the carbon flux of the sterol metabolic pathway, and promote the synthesis of 7-DHC. And ERG8* and ERG9* are co-expressed to construct a combined mutant to further promote the synthesis of 7-DHC.

[0006] The first object of the present invention is to provide a recombinant Saccharomyces cerevisiae, which includes the following modifications: heterologous expression of 24-dehydrocholesterol reductase, overexpression of a phosphomevalonate kinase mutant and / or a squalene synthase mutant;

[0007] The phosphomevalonate kinase mutant has at least one of the following mutations compared with the amino acid sequence shown in SEQ ID NO.2:

[0008] Mutating serine at position 75 to threonine,

[0009] Mutating valine at position 187 to aspartic acid,

[0010] Mutating alanine at position 192 to serine,

[0011] Mutating serine at position 205 to threonine,

[0012] Mutating glycine at position 206 to arginine,

[0013] Mutating serine at position 314 to threonine,

[0014] Mutating threonine at position 322 to histidine,

[0015] Mutating glutamate at position 349 to alanine;

[0016] The squalene synthase mutant has at least one of the following mutations compared with the amino acid sequence shown in SEQ ID NO.8:

[0017] Mutating leucine at position 96 to lysine,

[0018] Mutating tryptophan at position 108 to serine,

[0019] Mutating glutamate at position 146 to alanine,

[0020] Mutating glutamate at position 208 to aspartic acid,

[0021] Mutating glutamine at position 209 to glutamate,

[0022] Mutating lysine at position 251 to asparagine,

[0023] Mutate the 252nd aspartic acid to histidine,

[0024] mutate the 258th asparagine to phenylalanine,

[0025] mutate the 286th glycine to serine,

[0026] mutate the 345th phenylalanine to asparagine,

[0027] delete the 355th lysine,

[0028] mutate the 388th asparagine to isoleucine,

[0029] mutate the 389th valine to glutamic acid,

[0030] mutate the 404th serine to tryptophan,

[0031] delete the 426th serine,

[0032] mutate the 434th glycine to proline.

[0033] Furthermore, the heterologous expression and / or overexpression is genome integration expression.

[0034] Furthermore, the heterologous expression is to integrate and express the 24-dehydrocholesterol reductase coding gene at the 416d locus on the genome of the Saccharomyces cerevisiae host, and the overexpression is to integrate and express the phosphomevalonate kinase mutant coding gene at the 208a locus on the genome of the Saccharomyces cerevisiae host and / or to integrate and express the squalene synthase mutant coding gene at the 308a locus on the genome of the Saccharomyces cerevisiae host.

[0035] Furthermore, the coding gene sequence of the 24-dehydrocholesterol reductase is as shown in SEQ ID NO.11; the amino acid sequence of the phosphomevalonate kinase mutant is as shown in SEQ ID NO.4, and the amino acid sequence of the squalene synthase mutant is as shown in SEQ ID NO.10.

[0036] The second object of the present invention is to provide a method for constructing the recombinant Saccharomyces cerevisiae, comprising the following steps:

[0037] S1. Integrate the 24-dehydrocholesterol reductase coding gene into the genome of the Saccharomyces cerevisiae host by using the CRISPR technology;

[0038] S2. Integrate the coding gene of the phosphomevalonate kinase mutant into the genome of the Saccharomyces cerevisiae obtained in step S1 by using the CRISPR technology, and / or integrate the coding gene of the squalene synthase mutant into the genome of the Saccharomyces cerevisiae obtained in step S1 by using the CRISPR technology to obtain the recombinant Saccharomyces cerevisiae.

[0039] Further, the above key genes are integrated and expressed by the CRISPR Cas9 editing technology, with promoter P tef1 and terminator T cyc1 to control the expression of the key genes.

[0040] The third object of the present invention is to provide a method for producing 7-dehydrocholesterol, comprising the following steps: performing fermentation production by using the recombinant Saccharomyces cerevisiae.

[0041] Further, production is carried out using glucose as a substrate.

[0042] Further, the fermentation includes: preparing a seed solution, inoculating the seed solution into a fermentation medium containing glucose, and culturing at 28-32 °C and 220-280 rpm.

[0043] Further, the fermentation medium contains: 30-60 g / L of soy peptone, 15-35 g / L of sucrose, 15-35 g / L of glucose, and 20-30 g / L of glycerol.

[0044] The fourth object of the present invention is to provide a method for promoting the synthesis of 7-dehydrocholesterol by Saccharomyces cerevisiae, the method comprising the step of introducing the phosphomevalonate kinase mutant and / or the squalene synthase mutant (coding gene) into a Saccharomyces cerevisiae host (heterologously expressing 24-dehydrocholesterol reductase), the sequence of the phosphomevalonate kinase mutant being as shown in SEQ ID NO.4, and the sequence of the squalene synthase mutant being as shown in SEQ ID NO.10.

[0045] The fifth object of the present invention is to provide a phosphomevalonate kinase mutant, the phosphomevalonate kinase mutant having at least one of the following mutations compared to the amino acid sequence shown in SEQ ID NO.2:

[0046] mutating serine at position 75 to threonine,

[0047] mutating valine at position 187 to aspartic acid,

[0048] mutating alanine at position 192 to serine,

[0049] mutating serine at position 205 to threonine,

[0050] The glycine at position 206 is mutated to arginine,

[0051] The serine at position 314 is mutated to threonine,

[0052] The threonine at position 322 is mutated to histidine,

[0053] The glutamate at position 349 is mutated to alanine.

[0054] The sixth object of the present invention is to provide a squalene synthase mutant, which squalene synthase mutant has at least one of the following mutations compared to the amino acid sequence shown in SEQ ID NO. 8:

[0055] The leucine at position 96 is mutated to lysine,

[0056] The tryptophan at position 108 is mutated to serine,

[0057] The glutamate at position 146 is mutated to alanine,

[0058] The glutamate at position 208 is mutated to aspartic acid,

[0059] The glutamine at position 209 is mutated to glutamate,

[0060] The lysine at position 251 is mutated to asparagine,

[0061] The aspartic acid at position 252 is mutated to histidine,

[0062] The asparagine at position 258 is mutated to phenylalanine,

[0063] The glycine at position 286 is mutated to serine,

[0064] The phenylalanine at position 345 is mutated to asparagine,

[0065] The lysine at position 355 is subjected to a deletion mutation,

[0066] The asparagine at position 388 is mutated to isoleucine,

[0067] The valine at position 389 is mutated to glutamate,

[0068] The serine at position 404 is mutated to tryptophan,

[0069] The serine at position 426 is subjected to a deletion mutation,

[0070] The glycine at position 434 is mutated to proline.

[0071] The seventh object of the present invention is to provide a polynucleotide encoding the phosphomevalonate kinase mutant or the squalene synthase mutant.

[0072] Furthermore, the polynucleotide sequence encoding the mevalonate kinase mutant is as shown in SEQ ID NO.3; the polynucleotide sequence encoding the squalene synthase mutant is as shown in SEQ ID NO.9.

[0073] The eighth object of the present invention is to provide a recombinant expression vector containing the polynucleotide.

[0074] Furthermore, the expression vector can be DNA, RNA, plasmid, etc.

[0075] The ninth object of the present invention is to provide a recombinant cell containing the recombinant expression vector. Among them, the host cell is preferably a microbial cell, and most preferably Saccharomyces cerevisiae.

[0076] The tenth object of the present invention is to provide the application of the recombinant Saccharomyces cerevisiae, mevalonate kinase mutant, squalene synthase mutant, polynucleotide, recombinant expression vector or recombinant cell in the preparation of 7-dehydrocholesterol.

[0077] Advantages of the present invention:

[0078] Through a large number of screening and verification experiments, the present invention obtained a mevalonate kinase mutant and a squalene synthase mutant that can promote the increase of 7-DHC production in Saccharomyces cerevisiae. After integrating these two mutants into the host bacterium separately or simultaneously, the yield of de novo synthesis of 7-DHC can be increased: when the mevalonate kinase mutant is introduced, the yield is increased by 19.86% compared with the introduction of the wild type; when the squalene synthase mutant is introduced, the yield is increased by 24.04% compared with the introduction of the wild type; when the mevalonate kinase mutant and the squalene synthase mutant are introduced simultaneously, the yield is increased by 42.47% compared with the simultaneous introduction of the wild type. The transformation method provided by the present invention can achieve the promotion of the fermentation production of 7-DHC, laying a foundation for the metabolic engineering transformation of Saccharomyces cerevisiae to promote 7-DHC synthesis. The method for constructing the Saccharomyces cerevisiae mutant provided by the present invention is simple, easy to use, and has good application prospects. Description of the drawings

[0079] Figure 1 It is a graph of the 7-DHC production of strains Qe1-Qe3 and Ze1-Ze3. Detailed implementation manners

[0080] The following combines the drawings and specific examples to further illustrate the present invention, so that those skilled in the art can better understand the present invention and be able to implement it, but the examples given are not intended to limit the present invention.

[0081] The present invention provides a method for constructing the above-mentioned Saccharomyces cerevisiae mutant, and the specific method is as follows:

[0082] Using the Saccharomyces cerevisiae BYA1 capable of synthesizing 7-DHC as the starting strain, the erg8* gene expression cassette was inserted into the 208a locus of the Saccharomyces cerevisiae genome to obtain the mutant Qe1; using the Saccharomyces cerevisiae BYA1 capable of synthesizing 7-DHC as the starting strain, the erg8 gene expression cassette was inserted into the 208a locus of the Saccharomyces cerevisiae genome to obtain the control strain Ze1. Using the Saccharomyces cerevisiae BYA1 capable of synthesizing 7-DHC as the starting strain, the erg9* gene expression cassette was inserted into the 308a locus of the Saccharomyces cerevisiae genome to obtain the mutant Qe2; using the Saccharomyces cerevisiae BYA1 capable of synthesizing 7-DHC as the starting strain, the erg9 gene expression cassette was inserted into the 308a locus of the Saccharomyces cerevisiae genome to obtain the control strain Ze2. Using the Saccharomyces cerevisiae Qe1 as the starting strain, the erg9* gene integration cassette was inserted into the 308a locus to obtain the combined mutant Qe3; using the Saccharomyces cerevisiae Ze1 as the starting strain, the erg9 gene integration cassette was inserted into the 308a locus to obtain the control strain Ze3.

[0083] Methods for fermenting and producing 7-DHC by mutants Qe1-Qe3 and Ze1-Ze3: The seed liquid cultured at 28-32 °C and 220-280 rpm for 18 h was inoculated into the fermentation medium at an inoculum size of 5-10% (v / v), and fermented at 28-32 °C and 220-280 rpm for 96 h.

[0084] Example 1 Construction of the phosphomevalonate kinase ERG8* mutant Qe1 and its control strain Ze1

[0085] (a) Artificially synthesize gene fragments: The mutated phosphomevalonate kinase gene erg8* (nucleotide sequence shown in SEQ ID NO.3, amino acid sequence shown in SEQ ID NO.4) was amplified using primers ERG8*-F and ERG8*-R.

[0086] (b) Using the Saccharomyces cerevisiae S228C genome as a template, the wild-type phosphomevalonate kinase gene erg8 (NCBI ID: 855260, nucleotide sequence shown in SEQ ID NO.1, amino acid sequence shown in SEQ ID NO.2) was amplified using primers ERG8-F and ERG8-R.

[0087] (c) Using the pY26-TEF1-CYC1 plasmid as a template, primers TEF1-F1 and TEF1-R1 were used to amplify the promoter P tef1 (SEQ ID NO.5) to obtain the gene fragment te f1-erg8* with an overlapping region with the fragment erg8* and the gene fragment tef1-erg8 with an overlapping region with the fragment erg8. Primers CYC1-F1 and CYC1-R1 were used to amplify the terminator T cyc1(SEQ ID NO.6), gene fragments cyc1-erg8* with an overlapping region with fragment erg8* and gene fragment cyc1-erg8 with an overlapping region with fragment erg8 were obtained.

[0088] (d) Using the genome of Saccharomyces cerevisiae S228C as a template, a 20bp PAM sequence of CRISP R Cas9 was selected at the 208a integration site. Upstream and downstream homologous arm amplification primers 208a-UP-F, 208a-UP-R and 208a-DOWN-F, 208a-DOWN-R of the gene integration cassette were designed on both sides of the PAM sequence, and the left and right arm gene fragments 208a-up and 208a-down at the 208a site were amplified.

[0089] (e) The fragments erg8*, tef1-erg8*, cyc1-erg8*, 208a-up, 208a-down and erg8, tef1-erg8, cyc1-erg8, 208a-up, 208a-down obtained in steps (a), (b), (c) and (d) were respectively subjected to overlap extension PCR. After verifying correctness by 1% agarose gel electrophoresis, the gel was cut and the fragments were recovered to obtain the fusion gene fragments 208a-tef1-erg8*-cyc1 and 208a-tef1-erg8-cyc1.

[0090] (f) Construct an sgRNA plasmid of CRISPR Cas9. Using plasmid pML104 as a template, circular PCR was performed with primers added with a 20bp PAM sequence, and plasmid Cas9-208a with the corresponding PAM sequence was amplified using primers Cas9-208a-F and Cas9-208a-R.

[0091] (g) The gene fragments 208a-tef1-erg8*-cyc1 and plasmid Cas9-208a obtained in steps (e) and (f) were transformed into the competent cells of Saccharomyces cerevisiae BYA1 strain (i.e., CEN.PK2-1C△416d::P GAL1,10 -DHCR24, described in DOI: 10.1002 / bit.28055), and the gene fragments 208a-tef1-erg8-cyc1 and plasmid Cas9-208a were transformed into the competent cells of another Saccharomyces cerevisiae BYA1 strain. Colony PCR verification was performed using primers YZ-ERG8*-F, YZ-ERG8*-R and YZ-ERG8-F, YZ-ERG8-R, and transformants with correct colony PCR were selected for sequencing verification. Finally, the recombinant Saccharomyces cerevisiae strain Qe1 and its control strain Ze1 were obtained.

[0092] Table 1 Primer sequences

[0093] ERG8*-F actagcgcggccatgtcgccctctgccgta ERG8*-R gttaactgatcatcattacaacttgaccgaatcaattagatgtctaaca ERG8-F actagcgcggccatgtcgccctctgccgta ERG8-R gttaactgatcatcattacaacttgaccgaatcaattagatgtctaaca TEF1-F1 tacggcagagggcgacatggccgcgctagttctagaaaac TEF1-R1 aacggcagacattccgtcgaaactaagttctggtgtt CYC1-F1 tacggcagagggcgacatggccgcgctagttctagaaaac CYC1-R1 aacggcagacattccgtcgaaactaagttctggtgtt 208a-UP-F gatgtaatagagaattatctgcgctatatagctagc 208a-UP-R caattcagctggcgtaatagcgacacagcctatatctgttggtttgtcaa 208a-DOWN-F ttgggacgctcgaaggctttaatttgccataaacatggcatggcgatcagc 208a-DOWN-F cacccgatcctctttttatgcacag Cas9-208a-F gctctaaaacttccccttccgcttatagtagatcatttatctttcactgcggagaagt Cas9-208a-R ctactataagcggaaggggaagttttagagctagaaatagcaagttaaaataaggctag YZ-ERG8*-F aagaatcccgtatcatggacgatttc YZ-ERG8*-R caaagctgcatggccatcatttg YZ-ERG8-F tgagaagagtatccagaccttccacg YZ-ERG8-R gcggacattaaggacgaacagaaaag

[0094] Construction of squalene synthase ERG9* mutant Qe2 and its control strain Ze2 in Example 2

[0095] (h) Artificially synthesized gene fragment: The mutated squalene synthase gene erg9* (nucleotide sequence is shown in SEQ ID NO.9, amino acid sequence is shown in SEQ ID NO.10) was amplified using primers ERG9*-F and ERG9*-R.

[0096] (i) Using the Saccharomyces cerevisiae S228C genome as a template, the mutated squalene synthase gene erg9 (NCBI ID: 856597, nucleotide sequence is shown in SEQ ID NO.7, amino acid sequence is shown in SEQ ID NO.8) was amplified using primers ERG9-F and ERG9-R.

[0097] (j) Using the pY26-TEF1-CYC1 plasmid as a template, primers TEF1-F2 and TEF1-R2 were used to amplify promoter P tef1 (SEQ ID NO.5), obtaining gene fragments tef1-erg9* with an overlapping region with fragment erg9* and gene fragment tef1-erg9 with an overlapping region with fragment erg9. Primers CYC1-F2 and CYC1-R2 were used to amplify terminator T cyc1 (SEQ ID NO.6), obtaining gene fragments cyc1-erg9* with an overlapping region with fragment erg9* and gene fragment cyc1-erg9 with an overlapping region with fragment erg9.

[0098] (k) Using the Saccharomyces cerevisiae S228C genome as a template, a 20bp PAM sequence of CRISPR Cas9 was selected at the 308a integration site, and upstream and downstream homologous arm amplification primers 308a-UP-F, 308a-UP-R and 308a-DOWN-F, 308a-DOWN-R of the gene integration cassette were designed on both sides of the PAM sequence, and the left and right arm gene fragments 308a-up and 308a-down of the 308a site were amplified.

[0099] (l) Overlap extension PCR was performed on the fragments erg9*, tef1-erg9*, cyc1-erg9*, 308a-up, 308a-down, erg9, tef1-erg9, cyc1-erg9, 308a-up, and 308a-down obtained in steps (h), (i), (j), and (k) respectively. After verifying the correctness by 1% agarose gel electrophoresis, the gel was cut to recover the fragments, and the fusion gene fragments 308a-tef1-erg9*-cyc1 and 308a-tef1-erg9-cyc1 were obtained.

[0100] (m) The sgRNA plasmid of CRISPR Cas9 was constructed. Using plasmid pML104 as a template, circular PCR was performed with primers added with a 20bp PAM sequence, and plasmid Cas9-308a with the corresponding PAM sequence was amplified using primers Cas9-308a-F and Cas9-308a-R.

[0101] (n) The gene fragments 308a-tef1-erg9*-cyc1 and plasmid Cas9-308a obtained in steps (l) and (m) were transformed into the competent cells of Saccharomyces cerevisiae strain BYA1, and the gene fragments 308a-tef1-erg9-cyc1 and plasmid Cas9-308a were transformed into the competent cells of another Saccharomyces cerevisiae strain BYA1. Colony PCR verification was performed using primers YZ-ERG9*-F, YZ-ERG9*-R, YZ-ERG9-F, and YZ-ERG9-R. The transformants with correct colony PCR were selected for sequencing verification, and finally the recombinant Saccharomyces cerevisiae strain Qe2 and its control strain Ze2 were obtained.

[0102] Table 2 Primer Sequences

[0103] ERG9*-F cgcggccatgacaatcaaggaacataaagtagttcatgaagc ERG9*-R gatcatcattatttctttttttgagagaaaaattggttctctacagc ERG9-F cgcggccatgacaatcaaggaacataaagtagtttatgaagct ERG9-R gatcaTCAttatttctttttttgagagaaaaattggttctctacagc TEF2-F ctttatgttccttgattgtcatggccgcgctagttctagaaaac TEF2-R aacggcagacattccgtcgaaactaagttctggtgtt CYC1-F ctttatgttccttgattgtcatggccgcgctagttctagaaaac CYC1-R aacggcagacattccgtcgaaactaagttctggtgtt 308a-UP-F taatgtcctctgccgccgaaaag 308a-UP-R ctccaattcagctggcgtaatagcttggcgaaatccatgaatacggtcat 308a-DOWN-F ttgggacgctcgaaggctttaatttgcttgacgatgtcagtgaatcccgg 308a-DOWN-R gtcaattctcggtgaacaattttttgcaaga Cas9-308a-F gctctaaaacactctgctagtatttctgatgatcatttatctttcactgcggagaagt Cas9-308a-R catcagaaatactagcagagtgttttagagctagaaatagcaagttaaaataaggctag YZ-ERG9*-F cagcctccgaagggagttgtataa YZ-ERG9*-R ccacatcagaaattgaagcatccatctc YZ-ERG9-F tgagaagagtatccagaccttccacg YZ-ERG9-R tgccaacctgttggtaaagcacta

[0104] Example 3 Construction of the combined mutant Qe3 of ERG8* and ERG9* and its control strain Ze3

[0105] (o) The gene fragments 308a-tef1-erg9*-cyc1 and plasmid Cas9-308a obtained in steps (l) and (m) were transformed into the competent cells of Saccharomyces cerevisiae strain Qe1, and the gene fragments 308a-tef1-erg9-cyc1 and plasmid Cas9-308a were transformed into the competent cells of Saccharomyces cerevisiae strain Ze1. Colony PCR verification was performed using primers YZ-ERG9*-F, YZ-ERG9*-R, YZ-ERG9-F, and YZ-ERG9-R. The transformants with correct colony PCR were selected for sequencing verification, and finally the recombinant Saccharomyces cerevisiae strain Qe3 and its control strain Ze3 were obtained.

[0106] Example 4 Preparation of 7-DHC by Recombinant Saccharomyces cerevisiae Fermentation

[0107] The specific steps are as follows:

[0108] (1) Preparation of seed liquid

[0109] Pick the recombinant Saccharomyces cerevisiae strains Qe1-Qe3 and Ze1-Ze3 and inoculate them into 3 mL of YPD medium, and culture them at 28-32 °C and 220-280 rpm for 18 h.

[0110] (2) Fermentation culture

[0111] Transfer them to a 250 mL Erlenmeyer flask containing 20-40 mL of soybean peptone medium at an inoculation amount of 5%-10% (v / v), and culture them at 28-32 °C and 220-280 rpm for 96 h.

[0112] Soybean peptone medium: 30-60 g / L soybean peptone, 15-35 g / L sucrose, 15-35 g / L glucose, 20-30 g / L glycerol.

[0113] (3) Product extraction

[0114] 7-DHC: Take 1 mL of the fermentation broth, wash away the medium, add 1 mL of saponification solution (potassium hydroxide-methanol), grind and break it with glass beads, take 500 μL of the cell lysate and carry out saponification reaction at 80-90 °C for 2 h. After the reaction, perform rotary evaporation for 3 h, add 500 μL of ethyl acetate for extraction, and absorb the supernatant and use high performance liquid chromatography to detect 7-DHC. The yield results are shown in Table 3 and Figure 1 as follows. The 7-DHC yields of the mutants Qe1-Qe3 are 50.1 mg / L, 48.5 mg / L and 63.4 mg / L respectively; the yields of the control strains Ze1-Ze3 are 41.8 mg / L, 39.1 mg / L and 44.5 mg / L respectively.

[0115] The experimental results are shown in Table 3 and Figure 1 as follows.

[0116] Table 3 Strains Yields of Qe1-Qe3 and Ze1-Ze3

[0117] Strain Qe1 Ze1 Qe2 Ze2 Qe3 Ze3 7-DHC production (mg / L) 50.1 41.8 48.5 39.1 63.4 44.5

[0118] Obviously, the above embodiments are merely examples given for clear illustration and are not limitations on the implementation manners. For those of ordinary skill in the art, other different forms of changes or modifications can be made based on the above description. It is not necessary and impossible to list all the implementation manners here. And the obvious changes or modifications derived therefrom still fall within the protection scope of the present invention.

Claims

1. A recombinant Saccharomyces cerevisiae, characterized in that, The recombinant Saccharomyces cerevisiae includes the following modifications: heterologous expression of 24-dehydrocholesterol reductase; and overexpression of phosphomevalonate kinase mutant and / or squalene synthase mutant; The amino acid sequence of the phosphomevalonate kinase mutant is as shown in SEQ ID NO.4, and the amino acid sequence of the squalene synthase mutant is as shown in SEQ ID NO.

10.

2. The recombinant Saccharomyces cerevisiae according to claim 1, wherein The heterologous expression and / or overexpression is genomic integration expression.

3. The recombinant Saccharomyces cerevisiae according to claim 2, wherein The heterologous expression is integration and expression of the 24-dehydrocholesterol reductase-encoding gene described in claim 1 at the 416d locus on the Saccharomyces cerevisiae host genome; the overexpression is integration and expression of the phosphomevalonate kinase mutant-encoding gene described in claim 1 at the 208a locus on the Saccharomyces cerevisiae host genome and / or integration and expression of the squalene synthase mutant-encoding gene described in claim 1 at the 308a locus on the Saccharomyces cerevisiae host genome.

4. The method for constructing the recombinant Saccharomyces cerevisiae according to any one of claims 1 to 3, characterized in that, It includes the following steps: S1. Using the CRISPR technique to integrate the 24-dehydrocholesterol reductase-encoding gene described in claim 1 into the genome of the Saccharomyces cerevisiae host; S2. Using the CRISPR technique to integrate the phosphomevalonate kinase mutant-encoding gene described in claim 1 into the genome of the Saccharomyces cerevisiae obtained in step S1, and / or using the CRISPR technique to integrate the squalene synthase mutant-encoding gene described in claim 1 into the genome of the Saccharomyces cerevisiae obtained in step S1 to obtain the recombinant Saccharomyces cerevisiae.

5. A method for producing 7-dehydrocholesterol, characterized in that, It includes the following steps: Fermentation production is carried out using the recombinant Saccharomyces cerevisiae described in any one of claims 1-3.

6. The method according to claim 5, characterized in that, Production is carried out using glucose as a substrate.

7. The method according to claim 6, wherein The fermentation includes: inoculating the seed liquid of the recombinant Saccharomyces cerevisiae into a fermentation medium containing glucose, and culturing at 28-32 °C and 220-280 rpm.

8. The method according to claim 7, wherein The fermentation medium contains: 30-60 g / L soy peptone, 15-35 g / L sucrose, 15-35 g / L glucose, and 20-30 g / L glycerol.

9. A method for promoting the synthesis of 7-dehydrocholesterol by Saccharomyces cerevisiae, characterized in that, The method includes the steps of heterologously expressing 24-dehydrocholesterol reductase in a Saccharomyces cerevisiae host and introducing a phosphomevalonate kinase mutant and / or a squalene synthase mutant into the Saccharomyces cerevisiae host. The amino acid sequence of the phosphomevalonate kinase mutant is as shown in SEQ ID NO.4, and the amino acid sequence of the squalene synthase mutant is as shown in SEQ ID NO.

10.

10. A mevalonate kinase mutant, characterized in that, The amino acid sequence of the phosphomevalonate kinase mutant is as shown in SEQ ID NO.

4.

11. A squalene synthase mutant, characterized in that, The amino acid sequence of the squalene synthase mutant is as shown in SEQ ID NO.

10.

12. A polynucleotide encoding the phosphomevalonate kinase mutant described in claim 10 or the squalene synthase mutant described in claim 11.

13. The polynucleotide according to claim 12, wherein The polynucleotide sequence encoding the phosphomevalonate kinase mutant is as shown in SEQ ID NO.3; the polynucleotide sequence encoding the squalene synthase mutant is as shown in SEQ ID NO.

9.

14. A recombinant expression vector containing the polynucleotide described in claim 12 or 13.

15. A recombinant cell containing the recombinant expression vector described in claim 14.

16. Use of the recombinant Saccharomyces cerevisiae described in any one of claims 1-3, the phosphomevalonate kinase mutant described in claim 10, the squalene synthase mutant described in claim 11, the polynucleotide described in claim 12 or 13, the recombinant expression vector described in claim 14, or the recombinant cell described in claim 15 in the preparation of 7-dehydrocholesterol.