Taro CePDS gene and its VIGS virus vector and silencing method

Abstract

The present invention relates to the field of genetic engineering technology, in particular to taro CePDS Gene and VIGS virus vector and silencing method thereof. The present invention provides a taro phytoene dehydrogenase, the amino acid sequence of which is shown in SEQ ID NO.1. The present invention discovered the amino acid sequence of taro phytoene dehydrogenase and its encoding gene CePDS sequence, on this basis, provides a kind of silencing CePDS The target sequence of the gene, the VIGS silencing system and the silencing method can effectively reduce the CePDS The expression level of the gene can enable the VIGS silencing system to spread systemically in taro plants, thereby effectively interfering with the CePDS The VIGS silencing system and method provided by the present invention will greatly improve the progress of taro gene function research and significantly save time and cost.

Description

Technical Field

[0001] The present invention relates to the field of genetic engineering technology, in particular to taro PDS Genes and their VIGS viral vectors and silencing methods. Background Art

[0002] taro[ Colocasiae sculenta (L). Schott] is a perennial herbaceous plant of the genus Taro in the family Araceae, often cultivated as an annual crop. The underground corms of taro are rich in nutrients, have a soft and sticky taste, can be used as both grain and vegetable, and are also a high-efficiency crop widely used as a raw material for food processing, with broad market prospects and industrial development potential. However, the basic biological research of taro is relatively weak, especially the mining and verification of functional genes is very backward, which seriously hinders the research on the regulatory mechanism of important agronomic traits of taro and the breeding of new varieties. Therefore, the development of an efficient, convenient and rapid technical solution for the verification of taro gene function plays an important role in the genetic improvement of taro.

[0003] Virus-induced gene silencing (VIGS) assay refers to a technical means that can induce silencing of target genes and cause corresponding phenotypic changes when plants are infected with virus vectors carrying target gene fragments. It has the characteristics of simple operation, rapid phenotypic acquisition, no reliance on plant genetic transformation, avoidance of lethal mutations, complex redundant gene function research and rapid comparison of gene functions between different species. Therefore, it has been widely used in some species with complex genetic backgrounds and difficult genetic transformation.

[0004] Phytoene desaturase (PDS) is a key gene in the carotenoid biosynthesis pathway of plants. Silencing the expression of this gene can cause albino phenotype in plants. The phenotype is obvious and easy to observe. It is a very important gene for the development of VIGS silencing technology. However, the current research on the gene function of taro is still relatively backward, its genome ploidy is complex, and the phytoene desaturase and coding sequence of taro are not clear. Summary of the invention

[0005] In order to solve the above problems, the present invention provides taro PDS Gene and VIGS virus vector and silencing method thereof. The present invention discovered the amino acid sequence of taro phytoene dehydrogenase and its coding gene PDS sequence, on this basis, provides a kind of silencing PDS The target sequence of the gene, the VIGS silencing system and the silencing method can effectively reduce the PDS The expression level of the gene can be controlled and enabled to spread systemically within the taro plant, providing important technical support for the functional verification of taro genes.

[0006] In order to achieve the above object, the present invention provides the following technical solutions:

[0007] The invention provides a taro phytoene dehydrogenase, the amino acid sequence of which is shown as SEQ ID NO.1.

[0008] The present invention provides a gene encoding the phytoene dehydrogenase described in the above technical solution. PDS Gene, the PDS The nucleotide sequence of the gene is shown in SEQ ID NO.2.

[0009] The present invention provides the method of silencing the above technical solution PDS Application of genes in reducing chlorophyll content in taro leaves.

[0010] The present invention provides a method for silencing the above technical solution. PDS The target sequence of the gene, the nucleotide sequence of the target sequence is shown as SEQ ID NO.3.

[0011] The present invention provides a method for silencing the above technical solution. PDS A VIGS viral vector of a gene, wherein the VIGS viral vector comprises the target sequence described in the above technical solution.

[0012] Preferably, the backbone vector of the VIGS viral vector includes a pTRV2 vector.

[0013] The present invention provides a method for silencing the above technical solution. PDS Genetically engineered bacteria, the engineered bacteria comprising the VIGS virus vector described in the above technical solution.

[0014] The present invention provides a method for silencing the above technical solution. PDS The gene infection solution comprises the engineered bacteria described in the above technical solution.

[0015] Preferably, the OD of the engineered bacteria in the infection solution is 600 The value is 0.6~1.0.

[0016] The present invention provides a method for silencing the above technical solution. PDS The genetic method comprises the following steps:

[0017] Spraying water on the back of the flattened core leaves of three-leaf taro plants to obtain water-sprayed leaves;

[0018] The infection liquid described in the above technical solution is injected into the water-sprayed leaves on the back side of the water-sprayed leaves.

[0019] Beneficial effects:

[0020] The present invention provides a taro phytoene dehydrogenase, the amino acid sequence of which is shown in SEQ ID NO.1. The present invention discovered the amino acid sequence of the taro phytoene dehydrogenase and its encoding gene PDS The present invention provides a silencing PDS The target sequence of the gene, the VIGS silencing system and the silencing method. The target sequence provided by the present invention can effectively reduce the PDS The gene expression level, compared with the empty vector control, PDS The relative expression of the gene was reduced by 21.83% to 31.46%. The silencing method provided by the present invention sprays water on the back of the taro leaves before injecting the infection solution, which solves the problem that the taro leaves have a thick cuticle and wax on the surface, the leaves are brittle and hard, and the bacterial solution is difficult to inject into the leaves through a syringe. The VIGS silencing system can be systematically spread in the taro plant, thereby effectively interfering with the infection of the taro. PDS The VIGS silencing system and method provided by the present invention will greatly improve the progress of taro gene function research and significantly save time and cost. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required to be used in the embodiments are briefly introduced below.

[0022] Figure 1 For the taro in Example 1 PDS Figure 1. Cloning results of gene-specific fragments.

[0023] Figure 2 For the taro in Example 1 PDS Schematic diagram of some elements of the gene plant expression vector pTRV2;

[0024] Figure 3 This is the phenotypic diagram of the taro leaves of the VIGS silenced strain in Example 3;

[0025] Figure 4 This is a graph showing the results of semi-quantitative PCR amplification of taro leaves of the VIGS silenced strain in Example 3;

[0026] Figure 5 The taro leaf of the VIGS silenced strain in Example 3 PDS The relative expression of genes is verified by the results diagram;

[0027] Figure 6 This is the result graph of the total chlorophyll content in the taro leaves of the VIGS silenced strain in Example 3. DETAILED DESCRIPTION

[0028] The present invention provides a taro phytoene dehydrogenase, the amino acid sequence of which is shown in SEQ ID NO.1, and is specifically as follows:

[0029] .

[0030] The present invention provides a gene encoding the phytoene dehydrogenase described in the above technical solution. PDS Gene, the PDS The nucleotide sequence of the gene is shown in SEQ ID NO.2, and is as follows:

[0031]

[0032] The present invention discovered the amino acid sequence and coding gene of taro phytoene dehydrogenase PDS The sequence, through the silent taro PDS gene, reducing the expression of taro phytoene dehydrogenase and PDS The expression level of the gene can reduce the chlorophyll content in taro leaves, causing obvious whitening of the leaves, providing technical support for the functional genomics research of taro.

[0033] Based on the above advantages, the present invention provides a method for silencing the above technical solution. PDS Application of genes in reducing chlorophyll content in taro leaves.

[0034] Based on the above advantages, the present invention provides a method for silencing the above technical solution. PDS The target sequence of the gene, the nucleotide sequence of the target sequence is shown in SEQ ID NO.3, and is specifically as follows:

[0035] 5'-atgggctttaccagttctctttcggctgtcaatccgggtgatgtaatccagaaaagctgccttctggatgcccacgcctccaggagacccctgtccggcgt agaccctggttgcaactgtgtgctggctttcaggggcagtgatgctttgggccggcggctgaggcttagaagctcttggtcgttggggaggaagcactcaggcc ctttgcaggttgtttgcgcggattacccgaggccagagctagagaatacggccaacttcctagaagctgctgctttgtctgcatcttttcgcacttcaccacgc ccgactagaccactggaggttgttattgctggcgcaggtctcgctggactgtctacggcaaaatatcttgcagatgcaggtcataagcctatattgctgga-3'.

[0036] Based on the above advantages, the target sequence provided by the present invention can effectively reduce taro PDS The gene expression level, compared with the empty vector control, PDS The relative expression of genes decreased by 21.83%~31.46%.

[0037] Based on the above advantages, the present invention provides a method for silencing the above technical solution. PDSThe VIGS viral vector of the gene comprises the target sequence described in the above technical solution. In the present invention, the backbone vector of the VIGS viral vector preferably comprises a pTRV2 vector; the target sequence is preferably located in the pTRV2 vector EcoR Ⅰ and Bm Between the restriction sites of Ⅰ.

[0038] Based on the above advantages, the present invention provides a method for silencing the above technical solution. PDS The genetically engineered bacteria include the VIGS virus vector described in the above technical solution. In the present invention, the initial bacteria of the engineered bacteria preferably include Agrobacterium, further preferably include Agrobacterium tumefaciens, and more preferably Agrobacterium tumefaciens GV3101.

[0039] Based on the above advantages, the present invention provides a method for silencing the above technical solution. PDS The infection solution of the gene comprises the engineered bacteria described in the above technical solution. In the present invention, the OD of the engineered bacteria in the infection solution is 600 The value is preferably 0.6 to 1.0, and more preferably 0.8; the infection solution preferably also includes an engineering bacterium containing an auxiliary vector and an infection medium; the initial bacteria of the engineering bacterium containing an auxiliary vector preferably include Agrobacterium, and more preferably include Agrobacterium tumefaciens, and more preferably Agrobacterium tumefaciens GV3101; the auxiliary vector preferably includes a pTRV1 vector and a P19 vector; the infection medium preferably uses MS liquid medium as a basic medium, and preferably also includes 10 mM magnesium chloride, 10 mM 2-morpholineethanesulfonic acid and 200 µM acetosyringone. The P19 vector of the present invention can enhance the infection effect of Agrobacterium.

[0040] Based on the above advantages, the present invention provides a method for silencing the above technical solution. PDS The genetic method comprises the following steps:

[0041] Spraying water on the back of the flattened core leaves of three-leaf taro plants to obtain water-sprayed leaves;

[0042] The infection liquid described in the above technical solution is injected into the water-sprayed leaves on the back side of the water-sprayed leaves.

[0043] Compared with the VIGS technology of model plants such as tobacco, the surface texture of the leaves of plants such as tobacco is thin and soft, and the infection solution can be injected very smoothly and can spread over a large area, so that the infection efficiency is significantly improved; while the surface of taro leaves has a thicker cuticle and wax, the leaves are brittle and hard, and the bacterial solution is difficult to be injected through a syringe. The present invention sprays water on the back of the taro leaves before injecting the Agrobacterium infection solution, which can facilitate the penetration of the infection solution; a small hole needs to be gently poked out at the injection site with a needle, but poking the front of the leaf should also be avoided; the injected leaf is a flattened core leaf of a three-leaf-age taro plant, so that the problems of bacterial solution injection and diffusion can be better achieved.

[0044] In order to further illustrate the present invention, the taro provided by the present invention is described below in conjunction with the accompanying drawings and embodiments. PDS The gene and its VIGS viral vector and silencing method are described in detail, but they should not be understood as limiting the scope of protection of the present invention.

[0045] Example 1 Taro VIGS silencing expression vector pTRV2- PDS Construction

[0046] 1. RNA was extracted from the leaves of 'Gan Yu No. 2' according to the instructions of the polysaccharide and polyphenol plant RNA extraction kit of Nanjing Novizan Company.

[0047] 2. Then, the RNA obtained in step 1 was used as a template according to the reverse transcription kit HifairⅢ 1 from Shanghai Yisheng Biological Company. st Strand cDNA Synthesis Kit (Genomic DNA Digestion Enhanced Edition) Instructions Reverse transcription to synthesize first-strand cDNA.

[0048] 3. Design PDS The amplification primers for the gene specific sequence fragment (shown in SEQ ID NO.3) are pTRV2- PDS _F (shown in SEQ ID NO.4) and pTRV2- PDS _R (shown in SEQ ID NO.5), the specific sequence is as follows:

[0049] SEQ ID NO.4: 5'-gtgagtaaggttaccgaattcatgggctttaccagttctct-3';

[0050] SEQ ID NO.5: 5'-cgtgagctcggtaccggatcctccagcaatataggcttatg-3';

[0051] Among them, 5'-gtgagtaaggttaccgaattc-3' (SEQ ID NO.6) is EcoRⅠ enzyme-cut linker and TRV2 vector homology arm; 5'-cgtgagctcggtaccggatcc-3' (SEQ ID NO.7) is Bm Ⅰ Restriction cut linker and TRV2 vector homology arms.

[0052] 4. Using the first-strand cDNA obtained in step 2 as a template, use the high-fidelity enzyme 2×Hieff canace Plus PCR Master Mix (containing electrophoresis indicator dye) from Shanghai Yisheng Biotechnology Co., Ltd. PDS Specific fragments were amplified by PCR. The PCR amplification system was: 19 µL of ultrapure water without RNAse, 2 µL of forward primer (10 µM), 2 µL of reverse primer (10 µM), 25 µL of 2×Hieff canace Plus PCR Master Mix (containing electrophoresis indicator dye), and 2 µL of template (100 ng / µL). The reaction conditions for PCR amplification were: 98°C pre-denaturation for 3 min; 98°C denaturation for 10 s, 59°C annealing for 20 s, 72°C extension for 1 min15 s, for a total of 34 cycles; and finally 72°C final extension for 5 min.

[0053] 5. After testing the PCR amplification product by agarose gel electrophoresis, the results were as follows: Figure 1 As shown, the band size of the PCR amplification product is 452 bp, which is consistent with the size of the target fragment and can be used for subsequent vector connection.

[0054] 6. Use restriction enzymes from NEB (New England Biolabs) EcoR Ⅰ and Bm ⅠDigest the pTRV2 vector to obtain the linearized pTRV2 vector. The double digestion reaction system is: 5 µL rCutSmart buffer, EcoR Ⅰ1 µL, Bm Ⅰ1 μL, pTRV2 vector plasmid 3 μL and RNase-free ultrapure water 40 μL. Double enzyme digestion reaction conditions are: 37℃ enzyme digestion for 6h, 65℃ enzyme inactivation for 20 min.

[0055] 7. Use Tiangen Biotechnology's agarose gel DNA recovery kit (enhanced) to recover the 452 bp PCR amplification product in step 5 and the 9639 bp linearized vector in step 6.

[0056] 8. Connect the PCR amplification product recovered in step 7 to the linearized vector using the Shanghai Yisheng Biotechnology Company's homologous recombination cloning kit Hieff Clone ® Plus Multi One Step Cloning Kit. The connection reaction system is: 200 ng of pTRV2 linearized vector, 30 ng of target fragment, 5 µL of 2×Hieff Clone Enzyme Premix, and 10 µL of RNase-free ultrapure water. The connection reaction conditions are: incubate at 50°C for 20 min.

[0057] 9. The ligated product was transformed into E. coli DH5α, and positive single clones were screened and sequenced to obtain the recombinant expression vector pTRV2- PDS (Some components such as Figure 2 as shown).

[0058] Example 2 Preparation of Agrobacterium infection solution

[0059] 1. The pTRV2- PDS Transform the recombinant plasmid into Agrobacterium tumefaciens GV3101. Mix 50 µL of Agrobacterium GV3101 thawed on ice with pTRV2- PDS The plasmid (about 1 µg) was gently mixed in a 1.5 mL centrifuge tube, and then placed on ice for 5 min, frozen in liquid nitrogen for 5 min, in a 37°C water bath for 5 min, and in an ice bath for 5 min. Then 700 µL of antibiotic-free LB liquid medium was added to the centrifuge tube, mixed and revived at 28°C, 200 rpm for 2-3 h, and then plated on LB solid medium containing 50 mg / L kanamycin and 25 mg / L rifampicin for positive single clone screening. The pTRV2 vector identification primers pTRV2_F and pTRV2_R were used to perform bacterial liquid PCR for positive clone identification, and the plant expression vector pTRV2- PDS Agrobacterium GV3101; the primer sequences are as follows:

[0060] pTRV2_F: 5'-tgtcaacaaagatggacattgttac-3', SEQ ID NO.8;

[0061] pTRV2_R: 5'-acacggatctacttaaagaa-3', SEQ ID NO. 9.

[0062] 2. The pTRV1, pTRV2 and P19 plasmids were transformed into Agrobacterium tumefaciens GV3101 respectively by freeze-thaw method. The specific steps were the same as step 1 to obtain Agrobacterium tumefaciens GV3101 containing plant expression vectors pTRV1, pTRV2 and P19 respectively.

[0063] 3. The plant expression vector pTRV2- PDS tumefaciens GV3101 obtained in step 2 and the Agrobacterium GV3101 containing the plant expression vectors pTRV1, pTRV2 and P19, respectively, were inoculated into LB liquid medium containing 50 mg / L kanamycin and 25 mg / L rifampicin, and cultured overnight at 28°C and 200 rpm until the OD of the four Agrobacterium was 600 The values ​​are all 0.8.

[0064] 4. Collect the four Agrobacterium bacterial cultures from step 3 into 50 mL centrifuge tubes, centrifuge at 6000 rpm for 8 min, discard the supernatant, resuspend the bacteria in the infection solution, adjust the concentration of each bacterial culture, and obtain the pTRV1 infection solution (OD 600 0.4, 0.8 and 1.2), pTRV2 infection solution (OD 600 0.4, 0.8 and 1.2), pTRV2- PDS (OD 600 0.4, 0.8 and 1.2) primary infection solution and P19 infection solution (OD 600 The infection solution was MS liquid culture medium (4.74 g MS powder and 30 g sucrose dissolved in 1 L distilled water) and contained only 10 mM magnesium chloride, 10 mM 2-morpholineethanesulfonic acid and 200 µM acetosyringone.

[0065] 5. The pTRV1 infection solution (OD 600 0.8), pTRV2 infection solution (OD 600 0.8) and P19 infection solution (OD 600 0.8) in a volume ratio of 1:1:1 and allowed to stand in the dark for 3-5 h to obtain the pTRV infection solution; the pTRV1 infection solution (OD 600 0.4, 0.8 and 1.2), pTRV2- PDS Primary infection fluid (OD 600 0.4, 0.8 and 1.2) and P19 infection solution (OD 600 0.4, 0.8 and 1.2) were mixed at a volume ratio of 1:1:1 and allowed to stand in the dark for 3-5 h to obtain pTRV- PDS Infection fluid (OD 6000.4, 0.8 and 1.2) for spare use.

[0066] Example 3 Agrobacterium injection infection of taro leaves and phenotypic identification

[0067] 1. Use the harvested 'Gan Yu No. 2' corms as seed taro, select corms with healthy epidermis and no obvious diseases and insect pests, and the size is 2-4 cm, bury them in mixed matrix soil for rooting and germination, and select a culture pot with a diameter of about 10 cm. The mixed matrix is ​​composed of seaweed mud, vermiculite and perlite, and the volume ratio of seaweed mud, vermiculite and perlite is 5:1:1; culture at 26-28℃, 16 h light / 8 h dark conditions for 20-30 days, and when the taro plant has three leaves, the leaves can be infected by Agrobacterium injection;

[0068] 2. Randomly select taro seedlings with good growth status, relatively uniform development, and no obvious diseases and insect pests, and divide them into a control group (pTRV) and a test group (pTRV- PDS ), and then use a 1 mL disposable syringe to absorb the infection solution in step 5 of Example 2. The control group was injected with pTRV infection solution on the back of the taro leaves, and the experimental group was injected with three concentrations of pTRV- PDS (OD 600 0.4, 0.8 and 1.2) infection solution, each concentration of pTRV- PDS The infection solution was used to conduct experiments on three strains. After the injection, the plants were cultured in the dark for 12-14 h, and then continued to be cultured at 26-28℃, 16 h light / 8 h dark. Before injecting the Agrobacterium infection solution, the back of the taro leaves were sprayed with water to facilitate the penetration of the infection solution. A small hole needed to be gently poked at the injection site with a needle, but the front of the leaf should be avoided. The injected leaves were the flattened core leaves of three-leaf-age taro plants.

[0069] 3. After 7-10 days of cultivation, the phenotypic identification of the taro leaves in the experimental group and the control group was carried out. Figure 3 As shown in the figure, leaves with different numbers are the experimental results of different strains under different concentrations. The results show that compared with the control group, at OD 600 = 0.4, the taro leaves remained green and did not reach silence. PDS The effect of OD 600 = 0.8 VIGS silence PDS The leaves of taro with the OD gene showed obvious whitening. 600 =1.2, the taro leaves were yellow and shrunken. This is a phenomenon that the high concentration of bacterial solution causes the leaves to wither and die. The above results show that when the bacterial solution OD 600 = 0.8 can achieve better silencing in taro leaves PDS The effect of genes.

[0070] For pTRV and pTRV- PDS (OD 600 =0.8) were sampled from taro leaves, and RNA was extracted and reverse transcribed into cDNA. Semi-quantitative PCR was used to detect PDS The gene silencing effect was detected in the control group and the experimental group (OD 600 =0.8, three strains, respectively denoted as pTRV-CePDS-1, pTRV-CePDS-4 and pTRV-CePDS-7) were used to transcribe the TRV1 and TRV2 viruses in taro leaves. The primers used are as follows:

[0071] pTRV2_F: 5'-tgtcaacaaagatggacattgttac-3', SEQ ID NO.8;

[0072] pTRV2_R: 5'-acacggatctacttaaagaa-3', SEQ ID NO.9;

[0073] pTRV1_F: 5'-cgtgttgcatttcgatgaa-3', SEQ ID NO.10;

[0074] pTRV1_R: 5'-gacaacgccacgattaagt-3', SEQ ID NO. 11;

[0075] Semi-quantitative results such as Figure 4 As shown, pTRV-CePDS-1, pTRV-CePDS-4 and pTRV-CePDS-7 are PDS Three gene-silenced strains.

[0076] Depend on Figure 4 It can be seen that compared with the untreated taro leaves, the PCR products of the leaves of the VIGS-silenced taro leaves were 198 bp and 590 bp respectively, because the silencing fragment was inserted into the pTRV2 vector, indicating that the pTRV2 plant expression vector played a role in the taro leaves, thus achieving PDS Gene silencing effect.

[0077] 4. Then, real-time fluorescence quantitative PCR was used to detect the control group and OD 600 =0.8 in the leaves of the experimental group PDS The relative expression of genes was expressed as Actin is the internal reference gene, and the results are shown in Table 1 and Figure 5 As shown, where ** indicates P <0.01, *** indicatesP <0.001; the primers used are as follows:

[0078] Actin _F: 5'-ctagtggtcgcacaacaggt-3', SEQ ID NO.12;

[0079] Actin _R: 5'-ttcacgctcagcagtggtag-3', SEQ ID NO.13;

[0080] qP_ PDS _F: 5'-ttacccgaggccagagct-3', SEQ ID NO.14;

[0081] qP_ PDS _R: 5'-tctagtcgggcgtggtga-3', SEQ ID NO.15;

[0082] Table 1 After VIGS silencing PDS Relative expression of genes

[0083]

[0084] Note: Different letters represent significant differences. P <0.01.

[0085] From Table 1 and Figure 5 It can be seen that after VIGS silencing, PDS The gene expression level was significantly reduced. Compared with the control group, the experimental groups of three different strains (OD 600 = 0.8, pTRV-CePDS-1, pTRV-CePDS-4, and pTRV-CePDS-7) PDS The gene expression levels decreased by 29.25%, 21.83% and 31.46%, respectively.

[0086] 5. The total chlorophyll content of taro leaves in the experimental group and the control group was determined using the acetone-ethanol (80% acetone and 95% ethanol mixed in a volume ratio of 1:1) extraction method. The results are shown in Figure 6 , where *** represents P <0.001. The results showed that the total chlorophyll content in taro leaves was significantly reduced after VIGS silencing. Compared with the control group, the 3 experimental groups pTRV-CePDS-1 (OD 600 =0.8), pTRV-CePDS-4 (OD 600 =0.8) and pTRV-CePDS-7 (OD 600=0.8) decreased by 0.78 mg / g·FW, 0.67 mg / g·FW and 0.74 mg / g·FW, respectively.

[0087] In summary, the present invention can achieve PDS The gene silencing effect, the taro leaves after injection and infection can be directly identified in a short period of time, the test cycle is short, the gene silencing effect is good, the gene conversion rate is high, and there is no need for plant genetic transformation, which overcomes the difficulties of long cycle and difficulty of taro genetic transformation.

[0088] Although the above embodiment describes the present invention in detail, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A phytoene dehydrogenase from taro, characterized in that: The amino acid sequence is shown in SEQ ID NO.

1.

2. A gene encoding the phytoene dehydrogenase according to claim 1 PDS A gene characterized by Said PDS The nucleotide sequence of the gene is shown in SEQ ID NO.

2.

3. Silence of claim 2 PDS Application of genes in reducing chlorophyll content in taro leaves.

4. A silent claim 2 PDS A target nucleic acid molecule of a gene, characterized in that The nucleotide sequence of the target nucleic acid molecule is shown in SEQ ID NO.

3.

5. A silent claim as described in claim 2 PDS A VIGS viral vector containing a gene, characterized in that The VIGS viral vector comprises the target nucleic acid molecule of claim 4.

6. The VIGS viral vector according to claim 5, characterized in that The backbone vector of the VIGS viral vector includes a pTRV2 vector.

7. A silent claim as described in claim 2 PDS A genetically engineered bacterium, characterized in that The engineered bacteria include the VIGS viral vector described in claim 5 or 6.

8. A silent claim as described in claim 2 PDS The gene infection solution is characterized in that The infection solution includes the engineered bacteria described in claim 7.

9. The infection solution according to claim 8, characterized in that The OD of the engineered bacteria in the infection solution 600 The value is 0.6~1.

0.

10. A silent claim 2 PDS A genetic method, characterized in that The following steps are involved: Spraying water on the back of the flattened core leaves of three-leaf taro plants to obtain water-sprayed leaves; The infection solution of claim 8 is injected into the water-sprayed leaves at the back of the water-sprayed leaves.

Images