Application of OsGAT3 gene in regulating Cd, Cu or Mn content and plant height of rice

Abstract

The application belongs to the field of crop breeding, and relates to cultivation of low-cadmium rice, in particular to OsGAT3 Application of genes in regulating Cd, Cu or Mn content and plant height of rice. Through overexpression of OsGAT3, it is found that overexpression significantly increases Cd content in the aboveground part and root of rice, which is contrary to the Cd content phenotype of the mutant, OsGAT3 It is possible to positively regulate the Cd content of the plant. After knocking out the function of OsGAT3 , compared with the control, gat3 The Cd content of the aboveground part of the mutant is reduced by 4.3% and 15.9% respectively under 0.5 μM Cd and 5 μM Cd treatment, gat3 The Cd content of the root of the mutant is reduced by 12.1% and 14.4% respectively. Compared with the wild type, the Cd content in the grains of the mutant is significantly reduced, and the Cu and Mn contents in the grains are also significantly reduced.

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of crop breeding, and relates to the cultivation of low-cadmium rice, in particular to OsGAT3 the application of a gene in regulating the Cd, Cu or Mn content and plant height of rice. BACKGROUND

[0002] Heavy metal generally refers to a metal with a density greater than 4.5 g / cm 3 , and common examples include gold (Au), silver (Ar), copper (Cu), iron (Fe), mercury (Hg), lead (Pb), and cadmium (Cd). In the biological environment, heavy metals generally refer more specifically to toxic metal elements such as mercury (Hg) and cadmium (Cd), and metal elements with general toxicity such as copper (Cu) and zinc (Zn). Global heavy metal pollution is becoming increasingly serious, and has a more obvious impact on arable land related to food security. Heavy metal pollution has caused harm to the yield and growth and development of rice, and after these metal elements are enriched into the human body, they accumulate and are blocked in metabolism for a long time, thereby producing toxic effects and endangering human health.

[0003] There are many methods for reducing the accumulation of heavy metals in rice, which can be roughly summarized into three categories: field management methods, biological remediation methods, and genetic methods. Field management methods are based on artificial regulation of the production environment in the field, and improve the physical and chemical properties of the soil to fix heavy metals in the contaminated soil and reduce the absorption of heavy metals by rice. Studies have shown that flooding management before and after the heading of rice can reduce the accumulation of cadmium; increasing the levels of certain essential nutrients (such as Ca, Mg, Zn, Fe, Mn, P, S, etc.) can also reduce the absorption of Cd by rice; soil amendments can effectively reduce the absorption and accumulation of Cd by rice by increasing the soil pH or increasing the cation binding sites to reduce the solubility of Cd. Biological remediation is a method that uses biological adsorption, biological extraction, or root filtration to transfer soil heavy metals to introduced organisms or reduce the bioavailability of heavy metals, thereby achieving the purpose of soil remediation and improvement. Compared with the above two methods, genetic methods are one of the effective ways to reduce the accumulation of heavy metals in rice, and the expression of genes and various metal transporters that affect the distribution and migration of heavy metals in rice plants plays an important role in the absorption of heavy metals by rice. It is generally believed that there is no specific Cd transport protein in plants, and Cd is mainly transported in plants through the transport system of Zn 2+ , Cd 2+ , Fe 2+ , Cu 2+ , and Mn 2+, OsZIP2 can transport Cd in the root to the aboveground part and is involved in the transfer of Cd in the stem node (LI M Z, HU D W, LIU X Q, et al. The OsZIP2 transporter is involved in root-to-shoot translocation and intervascular transfer of cadmium in rice [J]. Plant Cell Environ, 2024, doi: 10.1111 / pce.14993). OsNRAMP5 is the main gene for rice to absorb Cd, Mn, and is involved in the transport of Mn from the root to the aboveground part, OsNRAMP5 The loss of function leads to a substantial decrease in the absorption of Cd by rice, and the Cd content in rice is reduced by more than 90% (TANG L, DONG J, QU M, et al. Knockout of OsNRAMP5In response to varying external cadmium concentrations, OsHMA3 enhances rice tolerance to cadmium toxicity via distinct mechanisms [J]. Sci Total Environ, 2022, 832: 155006). Heavy metal-related proteins are a class of metalloproteins or metallochaperone-like proteins containing heavy metal ATPase (HMA) domains, which play a key role in heavy metal transport and detoxification in plant cells, and can bind and transfer Cd, Cu, Zn and other heavy metal ions (SHARMA P, NGO H H, KHANAL S, et al. Efficiency of transporter genes and proteins in hyperaccumulator plants for metal tolerance in wastewater treatment: Sustainable technique for metal detoxification [J]. Environmental Technology, 2021, 23: 101725). Yellow stripe-like transporters play an important role in the long-distance transport of Cu ion chelates. OsYSL16 is a phloem-localized Cu-NA complex transporter that participates in the distribution and redistribution of copper ions in rice, and is mainly responsible for transporting Cu-NA complexes to newly developing tissues and seeds (KAKEI Y, ISHIMARU Y, KOBAYASHI T, et al. OsYSL16 plays a role in the allocation of iron [J]. Plant molecular biology 2012, 79(6): 583-94).

[0004] Exploring the way to reduce the accumulation of heavy metals in rice has great significance for screening and breeding of heavy metal low-accumulation rice varieties. However, the use of field management and biological remediation methods to reduce the accumulation of heavy metals in rice usually requires a large amount of human and time resources, increasing the cost of agricultural production. The existing methods for reducing the accumulation of heavy metals in rice mainly use cultivation management and breeding improvement methods, which usually require a large amount of human and time resources, increasing the cost of agricultural production. Through precise knockout or modification of related genes by molecular means, high-efficiency development of rice varieties with reduced heavy metal accumulation has become an important way to reduce the content of heavy metals in rice. At present, there are more and more basic researches on reducing the absorption and accumulation of heavy metals in rice, but most of them focus on transport proteins that directly mediate the transport of heavy metals across the membrane or on chelating proteins that bind to heavy metals, and there are limited genes that can simultaneously regulate the content of multiple heavy metal elements, and the function is also limited. Through precise knockout or modification of related genes by molecular means, high-efficiency development of rice varieties with reduced heavy metal accumulation has become an important way to reduce the content of heavy metals in rice. At present, there are more and more basic researches on reducing the absorption and accumulation of heavy metals in rice, but most of them focus on transport proteins that directly mediate the transport of heavy metals across the membrane, and there are limited genes that can simultaneously regulate the content of multiple heavy metal elements. SUMMARY

[0005] To solve the above technical problems, the present application provides a kind of OsGAT3 gene in the application of regulating OsGAT3 gene in the application of regulating the content of Cd, Cu or Mn in rice and plant height. OsGAT3 The gene reduces the content of Cd, Cu and Mn in rice by effectively changing the absorption and transport of heavy metals in plants, providing new gene resources for breeding low-Cd and stress-tolerant rice varieties.

[0006] The technical scheme of the present application is as follows:

[0007] The present application requests protection in one aspect OsGAT3 gene in the application of regulating the content of Cd, Cu or Mn in rice plants and grains.

[0008] The above application is realized by overexpressing OsGAT3 the function of the gene to increase the content of Cd, Cu or Mn in rice; by silencing OsGAT3 the function of the gene to reduce the content of Cd, Cu or Mn in rice.

[0009] On the other hand, the application requests protection OsGAT3 gene in the application of regulating the plant height of rice.

[0010] The application reduces the plant height of rice by overexpressing OsGAT3 the function of the gene; and increases the plant height of rice by interfering OsGAT3 the function of the gene.

[0011] Furthermore, the above OsGAT3 The nucleotide sequence of the gene is shown in SEQ ID No. 1.

[0012] The third aspect of this application provides a method for reducing the content of Cd, Cu, or Mn in rice plants or grains, the steps of which are: constructing... OsGAT3 CRISPR- of genes OsGAT3 The vector was knocked out and transferred into rice using Agrobacterium-mediated transformation for cultivation.

[0013] The fourth aspect of this application provides a method for cultivating tall rice, the steps of which are: constructing... Ca9 The gene overexpression vector was transferred into rice using Agrobacterium-mediated transformation and then cultivated.

[0014] The fifth aspect of this application provides a method for cultivating dwarf rice, the steps of which are: constructing... OsGAT3 CRISPR- of genes OsGAT3 The vector was knocked out and transferred into rice using Agrobacterium-mediated transformation for cultivation.

[0015] Furthermore, the above Ca9 The nucleotide sequence of the gene is shown in SEQ ID No. 1.

[0016] Preferably, the rice mentioned above is a japonica rice variety, and the terms "tall rice" and "short rice" refer to the height of the rice plants during the seedling stage.

[0017] The present invention has the following beneficial effects:

[0018] 1. This application found that overexpression of OsGAT3 significantly increased the Cd content in the aboveground parts and roots of rice, which is opposite to the Cd content phenotype of the mutant. OsGAT3 It may be regulating the Cd content in plants. Knockout... OsGAT3 After the function was completed, under treatment with 0.5 μM Cd and 5 μM Cd, compared with the control, OsGAT3 The Cd content in the aboveground parts of the mutant was reduced by 4.3% and 15.9%, respectively. gat3 The Cd content in the roots of the mutants decreased by 12.1% and 14.4%, respectively.

[0019] 2. This invention constructs gat3 Knockout mutants and overexpression materials confirmed that OsGAT3 The encoded transporter protein can regulate the content of Cd, Cu, or Mn in rice. Knocking out the transporter protein in rice... OsGAT3 The gene significantly reduced Cd content in the aboveground parts and roots of rice seedlings, and also significantly reduced the content of Cd, Cu, and Mn in grains; while overexpression in rice... OsGAT3The gene can increase the Cd content of the above-ground part and root of rice seedlings.

[0020] 3. In the late-season rice planted in 2022, OsGAT3 The Cd content in the mutant grains decreased by 33.8% compared with the wild type; in the early-season rice planted in 2023, the Cd content in the wild type grains was 0.14 ug / g, gat3 The Cd content in the mutant grains was 0.02 ug / g, decreased by 85.7%; it can be seen that gat3 The gene has a significant effect on reducing the heavy metal Cd content of rice. OsGAT3 The gene can effectively change the content of heavy metals in rice, reduce the Cd, Cu and Mn content of rice grains, and provide a new gene resource for breeding low-Cd and stress-tolerant rice varieties. BRIEF DESCRIPTION OF DRAWINGS

[0021] In order to more clearly illustrate the technical solutions in the embodiments of the present application or the prior art, the drawings needed in the following embodiment or prior art description will be briefly introduced. Obviously, the drawings in the following description are only some embodiments of the present application, and other drawings can be obtained by those skilled in the art without creative labor.

[0022] OsGAT3 To construct a knockout genetic material using CRISPR technology Figure 1 Knockout genetic material.

[0023] OsGAT3 Under Cd treatment Figure 2 The height and root length of the mutant plants; the left graph is a statistical graph of the height of the Cd-treated mutant plants; the middle graph is a statistical graph of the root length of the Cd-treated mutant plants; the right graph is a statistical graph of the OsGAT3 The phenotype of the mutant plants. n=10, the values in the graph represent mean ± SD.

[0024] gat3 Under Cd treatment Figure 3 The Cd content in the mutant plants; note: n=3, the values in the graph represent mean ± SD.

[0025] OsGAT3 Overexpression of the gene Figure 4 The phenotype of the overexpression strain; the left graph is the expression amount of the above-ground part; the right graph is the expression amount of the root; the expression amount of the gene is expressed as OsGAT3 As an internal reference, n=3 in the graph, and the values in the graph represent mean ± SD.

[0026] OsActin1 Overexpression of the gene Figure 5 The column chart of the height and root length of the overexpression plants and wild type plants under different cadmium treatments.

[0027] OsGAT3 To determine the Cd content in the aboveground parts and roots of the overexpression strain. Detailed Implementation

[0028] The technical solution of the present invention will be clearly and completely described below with reference to the embodiments of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative effort are within the scope of protection of the present invention.

[0029] Unless otherwise specified, the experimental methods used in the following experimental examples are conventional methods; the materials and reagents used are commercially available unless otherwise specified. Example

[0030] I. Test Materials

[0031] Using CRISPR-Cas9 technology, design Figure 6 The knockout target site (GCTCTGTGCGAGAACCGGTG) was identified, a gene knockout vector was constructed, and the Japonica rice variety ZH11 was transformed using Agrobacterium-mediated rice transformation. The obtained transgenic lines were sequenced and identified, and effective knockout mutant materials were screened and obtained.

[0032] Filtering obtained OsGAT3 Mutant plants with deletions or additions of gene target site sequences that are not multiples of 3 are named... OsGATs (1bp missing) e.g. gat3 As shown.

[0033] II. Identification of Mutant Materials

[0034] DNA extraction: Take fresh rice leaves into a 2 mL centrifuge tube, freeze and grind them into powder using liquid nitrogen, add 600 μL of 2% CTAB extraction buffer, stir gently, place in a 65 °C water bath for 60 min, inverting and mixing once every 15 min during this period, cool for 2 min, add an equal volume of chloroform, invert and mix, centrifuge at 12000 rpm for 10 min, take 400 μL of supernatant into a new centrifuge tube, take an equal volume of isopropanol, invert and mix, centrifuge at 1200 rpm for 10 min and discard the supernatant, add 1 mL of 75% ethanol, gently rotate or flick the tube tip to make the DNA precipitate at the bottom of the tube float in the liquid, place for 2 min, centrifuge at 1200 rpm for 3 min and discard the supernatant, centrifuge at 7000 rpm for 15 s, aspirate the residual liquid with the pipette tip, dry the DNA (air dry or blow dry with an air blower), add 30 μL of sterile ultrapure water to dissolve the obtained DNA.

[0035] Mutant genotype identification: a pair of specific primers was designed for the target site of CRISPR material:

[0036] Cr980-F02-F: ATTTCCTAATGCAGGGCATCGG;

[0037] Cr980-F02-R: GCGAATGTCGGCCTGCAGTATA;

[0038] Mutant genotype detection was performed. 2 μL of total DNA was used as a template for PCR identification. The PCR reaction system is shown in Table 1, and the amplification program is shown in Table 2. After amplification, the gel image was imaged according to gel electrophoresis (155 v, 20 min), and the correct position of the fragment was judged. After sequencing by Zhikeye Biological Company, the amplified fragment sequence was compared using SnapGene software, and the mutation type was judged.

[0039] Table 1 PCR reaction system

[0040]

[0041] Table 2 PCR amplification program

[0042]

[0043] III. Construction of overexpression material

[0044] 3.1 Construction of overexpression vector

[0045] The CDS sequence of the rice gene was obtained through the official website of Rice Genome Annotation Project (RGAP), and specific primers for PCR amplification were designed. The cDNA of ZH11 genome was selected as a template, and the designed primers were used: Figure 1 Primer-F: TCTGATCAAGAGACAGGATCCATGTCGCCGGCGAGAGGTG;

[0046] Primer-R: CGATCGGGGAAATTCGAGCTCACATGTCATGGAAGAAT.

[0047] The target DNA fragment was amplified by PCR technology. The pcambia1300-35s vector BamH1 and Sac1 double enzyme digestion system (Table 3) was configured, and the reaction was carried out at 37℃ for 1h.

[0048] Table 3 Enzyme digestion system

[0049]

[0050] ​

[0051] The desired fragment and linearized vector after the reaction is completed immediately subjected to gel electrophoresis (155 v, 20 min), and then the gel is placed in a chemiluminescence imaging system, the band position is observed, and the agarose gel block containing the desired DNA fragment is cut under the ultraviolet lamp. AxyPrep DNA gel recovery kit is used for recovery. The specific steps are as follows:

[0052] a. Use a paper towel to absorb the liquid on the surface of the agarose gel containing the desired DNA, and cut into pieces.

[0053] b. Add about 600 μL Buffer DE-A, mix well, and heat at 75 ℃, mix every 2-3 min, until the gel block is completely melted (about 6-8 min).

[0054] c. Add Buffer DE-B of 0.5 times the volume of Buffer DE-A, that is, 300 μL DE-B, mix well. (When the isolated DNA fragment is less than 400 bp, 1 volume of isopropanol needs to be added.)

[0055] d. Take the mixed solution in step c, transfer it to a DNA preparation tube, place it in a 2 mL Ep tube, centrifuge at 12,000 ×g for 1 min, and discard the filtrate.

[0056] e. Put the preparation tube back into a 2 mL centrifuge tube, add 500 μL Buffer W1, centrifuge at 12,000 ×g for 30 s, and discard the filtrate.

[0057] f. Put the preparation tube back into a 2 mL centrifuge tube, add 700 μL Buffer W2, centrifuge at 12,000 ×g for 30 s, and discard the filtrate.

[0058] g. Wash with 700 μL Buffer W2 again in the same way, centrifuge at 12,000 ×g for 1 min, and discard the filtrate.

[0059] h. Put the preparation tube back into a 2 mL centrifuge tube, centrifuge at 12,000 ×g for 1 min.

[0060] i. Put the preparation tube into a clean 1.5 mL Ep tube, add 25-30 μL Eluent or ddH2O in the center of the preparation membrane (heating the Eluent or ddH2O to 65 ℃ will improve the elution efficiency), stand at room temperature for 1 min, and centrifuge at 12,000 ×g for 1 min to elute the DNA.

[0061] After the PCR product is purified and recovered, the product concentration is measured by a microplate reader, and recombination connection is performed using the ClonExpress II One Step Cloning Kit enzyme of Vazyme. According to the fragment concentration, the reaction solution is prepared according to the system shown in Table 4, and the reaction is performed at 37°C for 30 min. After the reaction is completed, it is placed on ice.

[0062] Table 4 Recombination reaction system

[0063]

[0064] Take 10 μl of the recombination product and add it to 100 μl of the pre-frozen competent cells on ice, gently shake the tube wall to mix evenly, and place it on ice for 30 min. Place the mixed solution in a 42 ℃ water bath for 50 s, and immediately place it on ice for cooling for 2 min 30 s. Add liquid LB medium without antibiotics to the mixed solution, and place it in a 37 ℃ shaking bed at a speed of 220 rpm for 40 min. After incubation, centrifuge at 5000 rpm for 5 min, discard 800 μl of supernatant, resuspend the bacterial cells in the remaining LB medium in the tube with a pipette, and evenly smear them on LB plates with Kan ＋ antibiotic, and place it in a 37 ℃ biochemical incubator for 16 to 18 hours. In the clean bench, pick single colonies from the LB plate, punch them into liquid LB containing Kan ＋ antibiotic, and incubate in a 37 ℃ shaking bed at a speed of 220 rpm for about 8 hours. Take a certain amount of bacterial solution to configure the reaction system (Table 5) for PCR bacterial liquid identification, and preliminarily judge whether the bacterial solution is correct by gel electrophoresis.

[0065] Table 5 Bacterial liquid PCR reaction system

[0066]

[0067] If the gel electrophoresis band is correct, the bacterial solution is entrusted to the Genesee Biotechnology Company for sequencing. After the sequencing result is correct, the SanPrep column plasmid DNA small amount extraction kit is used to extract the plasmid, and the genetic transformation is performed in ZH11 by Wuhan Boyuan Company. The plasmid extraction steps are as follows:

[0068] a. Use a pipette to transfer 2 ml of cultured bacterial solution to a 2 ml centrifuge tube, centrifuge at 8000 x g for 2 min to collect the bacterial cells, and discard the supernatant.

[0069] b. Add 250 μl of Buffer P1 to the 2 ml centrifuge tube, and thoroughly suspend the bacterial cells.

[0070] c. Add 250 μl Buffer P2, mix immediately by inverting gently (5-10 times), and let stand at room temperature for 2 min.

[0071] d. Add 350 μl Buffer P3, mix immediately by inverting gently (5-10 times).

[0072] e. Then centrifuge at 12,000 x g for 10 min, pipette the supernatant into the adsorption column, centrifuge at 8,000 x g for 30 s, and discard the filtrate.

[0073] f. Add 500 μl Buffer DW1, centrifuge at 9,000 x g for 30 s, and discard the filtrate.

[0074] g. Add 500 μl Wash Solution, centrifuge at 9,000 x g for 30 s, and discard the filtrate.

[0075] h. Repeat step 7 once

[0076] i. Place the adsorption column in a centrifuge tube, centrifuge at 9,000 x g for 1 min.

[0077] j. Place the adsorption column in a new 1.5 ml centrifuge tube, add 50-100 μl Elution Buffer to the center of the filter membrane, let stand at room temperature for 1 min, centrifuge at 9,000 x g for 1 min, and store the obtained plasmid at -20 °C.

[0078] 3.2 Identification of overexpression materials

[0079] After obtaining the T0 generation of transgenic plants, transplant and breed, harvest the T1 generation seeds, germinate the seeds in a water culture box for 6 d, use a solution of hygromycin B with a concentration of 50 mg / L for culture, use wild type ZH11 (without hygromycin resistance) as a negative control, observe the survival of the overexpression materials and the negative control, transplant and harvest the resistant plants, use the above method to screen the hygromycin resistance again, and all hygromycin-resistant strains are the homozygous strains. Germinate the homozygous strains again, water culture to two leaves and one heart, take the roots and aboveground parts to extract RNA, reverse transcribe cDNA, use OsGAT3 as an internal reference gene, design primers to identify OsActin1 the expression amount of the gene, and screen the strain with a higher expression amount.

[0080] The primers used are:

[0081] qRT-F: CTACCTGCACTGGCATTTCT;

[0082] qRT-R: GCTCCGACAATGGAGAACAA.

[0083] Application Example: Rice culture

[0084] I. Seedling stage water culture

[0085] Seed germination: rice seeds were soaked in tap water for 2-3 d to fully absorb water until they were white, then evenly spread in a germination dish, cultured in a 30 °C incubator under dark conditions for 1-2 d, until the seeds grew tender embryos and radicles.

[0086] Seedling culture: seeds with uniform germination were selected and planted on 96-well plant water culture boxes, 48 seedlings per water culture box, cultured normally in a simulated natural light condition (14 h of daylight, 30 °C, 10 h of night, 26 °C, light intensity of 30,000 Lx) artificial climate chamber for 3 d, and the treatment solution (normal nutrient solution plus different concentrations of CdCl2) was replaced.

[0087] Table 6 Composition of normal nutrient solution for rice

[0088]

[0089] II. Determination of seedling growth indicators

[0090] Plant height determination: the distance from the base of the plant to the tip of the highest leaf was measured with a ruler, which was the plant height.

[0091] Root length determination: the distance from the base of the plant to the tip of the root was measured with a ruler, which was the root length.

[0092] Cd ion content determination

[0093] The seedlings at the 2-leaf 1-heart stage after Cd treatment were removed from the water culture box, soaked in ultrapure water for about 30 s, repeated 3 times, washed off impurities, then soaked in 5 mM EDTA-2Na solution for 15 min to completely remove the ions on the surface of the plants, and washed with new ultrapure water for 3 times to remove the EDTA-2Na solution on the surface of the plants. The plants were dried with a paper towel, and the aboveground part (2 cm of the entire plant part above the root base) and the root of the seedlings were taken into a 10 mL centrifuge tube. After killing green in a 105 °C oven for 30 min and drying in a 85 °C oven for 3 d, a steel ball was placed in the centrifuge tube containing the dried sample, and a high-throughput grinder was used at 40 HZ for 12 min. 0.05 g of the powder sample was weighed and placed in a cell flow tube resistant to high temperature and acid and alkali. 1 mL of nitric acid was added to each sample tube, shaken and mixed, then placed in a fume hood for overnight standing digestion. The digested sample was placed in a 100 °C water bath and cooked until the sample was clear and transparent. The cooked sample was diluted with ultrapure water to 10 times for measurement, and the Cd ion content was determined using an inductively coupled plasma mass spectrometer (PerkinElmer NexION300).

[0094] To investigate the function of OsGATs transporters in Cd stress, OsGAT3 After normal hydroponics for 3 days, mutant seedlings were treated with 0.5 μM and 5 μM Cd until they reached the stage of two leaves and one bud. Plant phenotypes were observed and statistically analyzed. OsGATs As shown, we found that, compared with the control, the mutant Figure 2 Plant height and root length were significantly higher under different concentrations of Cd treatment than the control.

[0095] The Cd content in the aboveground parts and roots of the mutant was determined, such as... gat3 The results showed that under both concentrations of Cd stress... Figure 3 The Cd content in both the aboveground parts and roots of the mutant was reduced. Specifically, under 0.5 μM Cd and 5 μM Cd treatments, compared to the control, the Cd content was significantly lower. gat3 The Cd accumulation in the aboveground parts of the mutant was reduced by 4.3% and 15.9%, respectively. gat3 The Cd accumulation in the roots of the mutant was reduced by 12.1% and 14.4%, respectively. Further measurements... gat3 In field conditions, the ion content of grains at maturity was found to be significantly lower in mutant grains compared to wild type, and the contents of Cu and Mn in the grains were also significantly lower (Table 7).

[0096] Table 7. Ion content in grains

[0097]

[0098] Note: Different lowercase letters after the data in the same column indicate significant differences between treatments. P <0.05).

[0099] Table 5 shows that in the late-season rice planted in 2022, the Cd content in wild-type grains was 0.65 μg / g. gat3 The Cd content in the mutant grains was 0.43 μg / g, a decrease of 33.8%; the Cu content in the wild-type grains was 14.24 μg / g. gat3 The Cu content in the mutant grains was 11.19 μg / g, a decrease of 21.4%; the Mn content in the wild-type grains was 74.08 μg / g. gat3 The Mn content in the mutant grains was 59.61 μg / g, a decrease of 19.5%. In early-season rice planted in 2023, the Cd content in the wild-type grains was 0.14 μg / g. gat3 The Cd content in the mutant grains was 0.02 μg / g, a decrease of 85.7%; the Cu content in the wild-type grains was 10.87 μg / g. gat3The Cu content in the mutant grain was 2.67 μg / g, decreased by 75.4%; the Mn content in the wild-type grain was 43.02 μg / g, gat3 The Mn content in the mutant grain was 35.63 μg / g, decreased by 17.2%. Compared with the wild type, gat3 The contents of Cd, Cu and Mn in the mutant were significantly reduced.

[0100] In order to further clarify gat3 the function, we constructed OsGAT3 overexpression materials with ZH11 as the background, and obtained overexpression lines: GAT3-6, GAT3-16 (overexpression lines) through gene expression analysis. OsGAT3 Cd treatment was carried out in the seedling stage, and the results showed that compared with the wild type, Figure 4 the plant height of overexpression plants was significantly reduced (P<0.05) OsGAT3 , which was contrary to the plant height phenotype of the mutant material, indicating that Figure 5 may negatively regulate the growth of the aboveground part of rice in the seedling stage. The Cd content in the aboveground part and the root of the overexpression lines was determined (P<0.05) OsGAT3 , and it was found that: Figure 6 overexpression significantly increased the Cd content in the aboveground part and the root of rice, which was contrary to the Cd content phenotype of the mutant, OsGAT3 OsGAT3 OsGAT3 may positively regulate the Cd content of the plant.

[0101] The above only describes the preferred embodiments of the present application and is not intended to limit the present application. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present application shall be included in the protection scope of the present application.

Claims

1. OsGAT3 The application of genes in regulating the plant height of rice is characterized in that: By overexpressing OsGAT3 genes reduce the height of rice plants; knockout OsGAT3 genes increase the plant height of rice; The OsGAT3 The nucleotide sequence of the gene is shown in SEQ ID No.

1.

2. A method of reducing the content of Cd, Cu or Mn in a rice plant or grain, characterized in that, The steps are: constructing OsGAT3 CRISPR- Cas9 knockout vectors, transformed into rice by Agrobacterium transformation method, and cultivated; The OsGAT3 The nucleotide sequence of the gene is shown in SEQ ID No.

1.

3. A method for breeding high culm rice, characterized by, The steps are: constructing OsGAT3 The overexpression vector of the gene is transformed into rice by Agrobacterium transformation method, and cultivation is carried out. The OsGAT3 The nucleotide sequence of the gene is shown in SEQ ID No.

1.

4. The method of claim 3, wherein: The high-stalk rice refers to the rice plant height at the seedling stage.

5. A method for breeding a short-stalked rice plant, characterized by, The steps are: constructing OsGAT3 CRISPR- Cas9 knockout vectors, transformed into rice by Agrobacterium transformation method, and cultivated; The OsGAT3 The nucleotide sequence of the gene is shown in SEQ ID No.

1.

6. The method of claim 5, wherein: The rice is a japonica variety, and the short-stalk rice refers to the rice plant height at the seedling stage.

Images