Application of a rice grain shape gene

By knocking out the rice grain type gene OsGSEG1, and using the CRISPR/Cas9 system to improve the grain type of rice grains, the problem of difficulty in digging out the slender or large-grain regulatory genes in the prior art is solved, and significant improvement of the grain type of rice grains and improvement of yield and quality has been achieved.

CN118703555BActive Publication Date: 2025-06-13INST OF FOOD CROPS HUBEI ACAD OF AGRI SCI +1
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202411005341.8
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-07-25
Publication Date
2025-06-13
Estimated Expiration
2044-07-25

AI Technical Summary

Technical Problem

The prior art is difficult to effectively dig the regulatory genes of rice slender or large grains, which limits the process of rice grain breeding.

Method used

By knocking out the rice grain type gene OsGSEG1, the CRISPR/Cas9 system was used to improve the grain type of rice grains, increasing the grain length and enlarging the outer epidermal cells of the shell and their length and width.

Benefits of technology

The grain shape of rice grains has been significantly improved, the grain length and size of the epidermal cells of the husk are increased, and the rice yield and rice appearance quality are improved.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN118703555B_ABST
    Figure CN118703555B_ABST
Patent Text Reader

Abstract

The present disclosure provides an application of a rice grain shape gene, belonging to the field of biotechnology. The application includes: knocking out the rice grain shape gene for improving the grain shape of rice grains, the rice grain shape gene being gene OsGSEG1, and the sequence of the gene OsGSEG1 being as shown in SEQ ID NO: 1 in the sequence listing. The present disclosure provides an application of a rice grain shape gene, which includes that knocking out the rice grain shape gene can improve the grain shape of rice grains. The rice grain shape gene is gene OsGSEG1, and the improvement effect is significant, which can significantly increase the grain length of rice grains, increase the epidermal cells on the outer surface of the glume of rice grains, and increase the length and width of the epidermal cells on the outer surface of the glume of rice grains.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present disclosure relates to the field of biotechnology, and particularly to the application of a rice grain shape gene. Background Art

[0002] Rice (Oryza sativa L.) is one of the most important food crops in the world and is the basic food for nearly half of the global population. However, along with a series of problems such as global warming, rapid population growth, and declining arable land quality, the food security problem has become increasingly severe. Therefore, improving rice yield has always been a research hotspot for breeders. The rice grain yield traits are relatively complex and mainly depend on the number of panicles per plant, the number of grains per panicle, and the 1000-grain weight. The grain shape mainly consists of grain length, grain width, and grain thickness, and is an important agronomic trait affecting the 1000-grain weight of rice. Therefore, exploring new rice grain shape regulatory genes is of great significance for improving rice yield and improving the appearance quality of rice.

[0003] With the rapid development of modern biotechnology, multiple genes and gene loci (Quantitative Trait Locus, QTL) related to rice grain shape traits have been successively discovered and isolated. For example, grain length regulatory genes GS3, GLW7, GL6, and GL10, grain width regulatory genes GW2, GW5, qSW5, and GS5, etc.; grain thickness regulatory genes TGW3, OsBZR1, and OsMADS56, etc. However, there are few genes that can produce slender or large-grain types through gene editing means, which greatly limits the process of rice grain shape breeding. Therefore, it is necessary to explore more rice grain shape genes to provide more gene resources and technical ideas for rice breeding.

[0004] Disclosure Content

[0005] To solve the problems of the prior art, the embodiments of the present disclosure provide an application of a rice grain shape gene. The technical solution is as follows:

[0006] The present disclosure provides an application of a rice grain shape gene, and the application includes: knocking out the rice grain shape gene for improving the grain shape of rice grains, where the rice grain shape gene is gene OsGSEG1, and the sequence of the gene OsGSEG1 is shown as SEQ ID NO: 1 in the sequence listing.

[0007] Specifically, the improvement of the grain shape of rice grains includes: increasing the grain length of rice grains, increasing the epidermal cells on the outer surface of the glume of rice grains, and increasing the length and width of the epidermal cells on the outer surface of the glume of rice grains.

[0008] Specifically, the application includes: knocking out the coding region of the rice grain shape gene using the CRISPR / Cas9 system for improving the grain shape of the rice grains.

[0009] The beneficial effects brought by the technical solutions provided in the embodiments of the present disclosure are as follows: The embodiments of the present invention provide an application of a rice grain shape gene. This application includes that knocking out the rice grain shape gene can improve the grain shape of rice grains. The rice grain shape gene is the gene OsGSEG1, and the improvement effect is remarkable, which can significantly increase the grain length of rice grains, increase the outer epidermal cells of the glume of rice grains, and increase the length and width of the outer epidermal cells of the glume of rice grains. Description of the Drawings

[0010] In order to more clearly illustrate the technical solutions in the embodiments of the present disclosure, the following will briefly introduce the drawings required for the description of the embodiments. Obviously, the following drawings are only some embodiments of the present disclosure. For those of ordinary skill in the art, without creative efforts, other drawings can also be obtained based on these drawings.

[0011] Figure 1 It is a comparison diagram of the grains of the control group N with glumes, the experimental group OsGSEG1-KO-1 with glumes, and the experimental group OsGSEG1-KO-2 with glumes provided in Embodiment 1 of the present disclosure. In the figure, N represents the control group N, OsGSEG1-KO-1 represents the experimental group OsGSEG1-KO-1, and OsGSEG1-KO-2 represents the experimental group OsGSEG1-KO-2;

[0012] Figure 2 It is a comparison diagram of the grains of the control group without glumes, the experimental group OsGSEG1-KO-1 without glumes, and the experimental group OsGSEG1-KO-2 without glumes provided in Embodiment 1 of the present disclosure. In the figure, N represents the control group N, OsGSEG1-KO-1 represents the experimental group OsGSEG1-KO-1, and OsGSEG1-KO-2 represents the experimental group OsGSEG1-KO-2;

[0013] Figure 3 It is a statistical chart of the grain lengths of the grains of the control group N with glumes, the experimental group material OsGSEG1-KO-1 with glumes, and the experimental group OsGSEG1-KO-2 with glumes provided in Embodiment 1 of the present disclosure. The data in the figure represents the mean ± standard error, and the asterisks on the error bars indicate significant differences compared with the control group (the p-value is calculated by one-way analysis of variance, *p < 0.05; **p < 0.01);

[0014] Figure 4It is a statistical chart of the grain length of the grains of the control group N with glumes removed, the experimental group material OsGSEG1-KO-1 with glumes removed, and the experimental group OsGSEG1-KO-2 with glumes removed provided in Example 1 of the present disclosure. The data in the figure represent the mean ± standard error, and the asterisks on the error bars indicate significant differences compared with the control group (p-value calculated by one-way ANOVA, **p < 0.01);

[0015] Figure 5 It is a scanning electron microscope image of the outer epidermal surface of the glumes of the grains of the control group N provided in Example 1 of the present disclosure;

[0016] Figure 6 It is a scanning electron microscope image of the outer epidermal surface of the glumes of the grains of the experimental group OsGSEG1-KO-1 provided in Example 1 of the present disclosure;

[0017] Figure 7 It is a scanning electron microscope image of the outer epidermal surface of the glumes of the grains of the experimental group OsGSEG1-KO-2 provided in Example 1 of the present disclosure;

[0018] Figure 8 It is a statistical chart of the lengths of the outer epidermal cells of the glumes of the grains of the control group N, the experimental group OsGSEG1-KO-1, and the experimental group OsGSEG1-KO-2 provided in Example 1 of the present disclosure. The data in the figure represent the mean ± standard error, and the asterisks on the error bars indicate significant differences compared with the control group (p-value calculated by one-way ANOVA, **p < 0.01). Detailed implementation manners

[0019] To make the objectives, technical solutions, and advantages of the present disclosure clearer, the following will further describe the implementation manners of the present disclosure in detail with reference to the accompanying drawings.

[0020] Example 1

[0021] The present disclosure provides an application of a rice grain shape gene, and the application includes: knocking out the rice grain shape gene for improving the grain shape of rice grains, where the rice grain shape gene is gene OsGSEG1, and the sequence of gene OsGSEG1 is as shown in SEQ ID NO: 1 in the sequence listing.

[0022] Specifically, the application includes: knocking out the coding region of the rice grain shape gene using the CRISPR / Cas9 system for improving the grain shape of rice grains.

[0023] Specifically, improving the grain shape of rice grains includes: increasing the grain length of rice grains, increasing the outer epidermal cells of the glumes of rice grains, and increasing the length and width of the outer epidermal cells of the glumes of rice grains.

[0024] Furthermore, the rice material used in this example is Nipponbare.

[0025] In this example, the target site sequence of the knocked-out gene OsGSEG1 was selected, and the target site (OsGSEG1-T) was designed using the Huazhong Agricultural University CRISPR-P website (http: / / crispr.hzau.edu.cn / CRISPR2 / ). The sequence of the target site OsGSEG1-T is shown as SEQ ID NO: 2 in the sequence listing, specifically: TCGTCCTTGTTGGCTGTCAGGGG.

[0026] The U6b promoter and the sgRNA fragment were amplified from the pYLsgRNA-OsU6b plasmid by PCR (Polymerase Chain Reaction) using KOD-plus high-fidelity enzyme.

[0027] The first forward amplification primer (U-F) is shown as SEQ ID NO: 3 in the sequence listing, specifically: CTCCGTTTTACCTGTGGAATCG; the first reverse amplification primer (OsGSEG1-U6bT) is shown as SEQ ID NO: 4 in the sequence listing, specifically: TCGTCCTTGTTGGCTGTCAGGTTTTAG AGCTAGAAAT.

[0028] The second forward amplification primer (OsGSEG1-gT) is shown as SEQ ID NO: 5 in the sequence listing, specifically: CTGACAGCCAACAAGGACGACAACACAAGCGGCAGC; the second reverse amplification primer (gR-R) is shown as SEQ ID NO: 6 in the sequence listing, specifically: CGGAGGAAAATTCC ATCCAC.

[0029] Each 50 μL PCR amplification system includes: 5 μL of 10× buffer; 5 μL of 2 mM dNTP; 1.5 μL of the first forward primer with a concentration of 10 μM; 1.5 μL of the first reverse primer with a concentration of 10 μM; 1.5 μL of the second forward primer with a concentration of 10 μM; 1.5 μL of the second reverse primer with a concentration of 10 μM; 1 μL of pYLsgRNA-OsU6b plasmid; 1 μL of KOD-Plus-Neopolymerase with a concentration of 1 U / μL; ddH 2 O 35 μL.

[0030] The PCR amplification program is: pre-denaturation at 98°C for 2 min; then 30 cycles, each cycle including: denaturation at 98°C for 10 s, annealing at 55°C for 15 s, and extension at 68°C for 40 s.

[0031] The amplification products were recovered and purified to obtain the purified U6b promoter and the purified sgRNA fragment.

[0032] The U6b promoter, sgRNA fragment, and target OsGSEG1-T were linked together by overlap extension PCR technology to construct an sgRNA expression cassette controlled by the U6b promoter.

[0033] The amplification system for overlap extension PCR includes: the first-round reaction amplification and the second-round reaction amplification.

[0034] The amplification system for the first-round reaction amplification includes: 5 μL of 10× buffer; 3 μL of 25 mM MgSO 4 3 μL; 5 μL of 2 mM dNTPs; 50 ng of the U6b promoter; 50 ng of the sgRNA fragment; supplemented with ddH 2 O to a total volume of 50 μL.

[0035] The amplification program for the first-round reaction amplification is: pre-denaturation at 94 °C for 2 min; 98 °C for 10 s, 50 °C for 60 s, 68 °C for 45 s, for a total of 10 cycles to obtain the first amplification product.

[0036] The amplification system for the second-round reaction amplification includes: 50 μL of the first amplification product; 5 μL of 10× buffer; 3 μL of 25 mM MgSO 4 3 μL; 5 μL of 2 mM dNTPs; 3 μL of the first forward primer; 3 μL of the second reverse primer; 2 μL of KOD Plus Neo, ddH 2 O 27 μL.

[0037] The amplification program for the second-round reaction amplification is: pre-denaturation at 94 °C for 2 min; 98 °C for 10 s, 55 °C for 30 s, 68 °C for 1 min, for a total of 18 cycles.

[0038] After the overlap extension PCR reaction was completed, the amplification product was obtained. 2 μL of the amplification product was taken for agarose gel electrophoresis detection. The target product (sgRNA expression cassette) was recovered by gel cutting. The target product was approximately 700 bp. The sgRNA expression cassette was ligated into the pYLCRISPR / Cas9Pubi-H vector by the method of Golden Gate ligation. The pYLCRISPR / Cas9Pubi-H vector was produced and donated by the team of Academician Liu Yaoguang using existing technologies.

[0039] The reaction system for the sgRNA expression cassette ligation reaction includes: 1.5 μL of 10× CutSmart Buffer; 1.5 μL of 10 mM ATP; 60 - 80 ng of the pYLCRISPR / Cas9Pubi-H vector; 10 - 15 ng of the target product (sgRNA expression cassette); 10 U of Bsa I-HF; 35 U of T4 DNA ligase; supplemented with ddH 20 to 15 μL.

[0040] Specifically, the amplification program of the sgRNA expression cassette ligation reaction includes: 5 min at 37°C; 5 min at 10°C, 5 min at 20°C; and finally 5 min at 37°C, for a total of 10 to 15 cycles. The vector for knocking out the gene OsGSEG1 is obtained.

[0041] The vector for knocking out the gene OsGSEG1 is transformed into the competent Agrobacterium tumefaciens cells EH105 (purchased from Shanghai Weidi Biotechnology Co., Ltd.) by electroporation. Then, the RNA editing vector of the gene OsGSEG1 is transformed into the receptor material Nipponbare rice by the Agrobacterium-mediated method, thereby obtaining rice plants with the gene OsGSEG1 knocked out. The specific method is as follows:

[0042] 1. Induction of callus:

[0043] Remove the seed coat of Nipponbare rice seeds with a seed beater, and operate carefully to ensure the integrity of the seeds. Select mature and plump seeds, weigh 15 g, and put them into a 50 mL centrifuge tube.

[0044] The seeds are first rinsed 4 times with distilled water and then treated with 75% ethanol for 2 to 5 min. Finally, they are rinsed 4 times with distilled water, and 0.15% mercuric chloride is added. They are treated on a shaker at 130 rpm for 12 min. When adding mercuric chloride, open the filter paper on the ultra-clean bench and place it in reserve. Light the alcohol lamp and burn the spoon and forceps for later use. Transfer the seeds treated with mercuric chloride to the ultra-clean bench and continuously wash them with sterilized distilled water (to remove the residual mercuric chloride on the seeds). Use the spoon and forceps to transfer the treated seeds to the filter paper and dry them on the clean bench for two hours.

[0045] Transfer the dried seeds one by one with forceps to the N6 induction medium, mark them, seal them with a sealing film, and culture them in a 28°C dark incubator for about 4 weeks to obtain induced callus.

[0046] 2. Subculture:

[0047] There will be some small detached callus around the callus in good condition. Pick these detached, light yellow, and relatively dense callus and transfer them to a new N6 induction medium. Culture them in a 28°C dark incubator for about 10 days to obtain subcultured callus.

[0048] 3. Infection:

[0049] Add 30 mL of 1 / 2 N6 liquid medium (with 1 / 1000 AS added) to a 50 mL centrifuge tube. Use a sterilized spoon to scrape the Agrobacterium cells containing the target vector after electroporation, and gently tap the Agrobacterium cells on the wall with the back of the spoon to disperse them and make them suspended, with OD600 = 0.8 - 1.0.

[0050] Collect all the subcultured calli in a sterilized Petri dish containing filter paper. Carefully transfer the calli to the bacterial solution with a spoon, and mix the bacterial solution and calli evenly. After 15 minutes, first pour out the bacterial solution, and then carefully transfer the calli to a new sterilized filter paper. After drying for two hours on the laminar flow bench, transfer them to 1 / 2 N6 solid medium (with 1 / 1000 AS added). Incubate in a dark incubator at 20 °C for two days to obtain infected calli.

[0051] 4. Bacteria elimination

[0052] Take out the Petri dish from the dark incubator, carefully scrape the calli on the filter paper with a spoon, and dry them on the laminar flow bench for 15 minutes.

[0053] Transfer the calli on the filter paper to 250 mL of sterilized water, gently shake the sterilized water bottle, and carefully pour out the sterilized water, taking care not to pour out the calli. Repeat this step four times.

[0054] Add 250 mL of sterilized water containing 1 / 1000 cefotaxime to the bottle, shake at 100 rpm for 10 minutes, pour out the sterilized water, and repeat this operation once more.

[0055] Add 250 mL of sterilized water containing 1 / 500 cefotaxime to the bottle, shake at 100 rpm for 10 minutes, pour out the sterilized water, and repeat this operation once more.

[0056] Carefully transfer the calli to a new sterilized filter paper with a spoon, and dry them on the laminar flow bench for three hours, changing the filter paper once in the middle.

[0057] 5. Screening

[0058] Transfer the dried calli to N6 solid medium (screening medium) containing 250 mg / L cefotaxime and 50 mg / L hygromycin, and incubate in the dark at 28 °C for 30 days.

[0059] 6. Differentiation

[0060] Select the calli with better growth and denseness on the screening medium and transfer them to MS medium (differentiation medium) with forceps, and incubate in a light incubator at 28 °C for 40 days.

[0061] 7. Rooting and acclimatization

[0062] Transfer the green seedlings grown on the differentiation medium to the 1 / 2MS medium (rooting medium), place them in an incubator at 28 °C for light culture for about 15 days, then carefully take out the seedlings from the 1 / 2MS medium, remove the 1 / 2MS medium carried on the roots, and put them into a centrifuge tube filled with sterilized water. During this period, change the sterilized water continuously. After 1 week, plant the seedlings in the field. When the seedlings mature, T2-generation seeds can be obtained.

[0063] In this example, two homozygous knockout lines, namely the T2-generation lines of OsGSEG1-KO-1 and OsGSEG1-KO-2, were selected as the experimental groups. In this example, Nipponbare rice was used as the control group N.

[0064] After soaking and germinating the T2-generation seeds of the control group N and the two experimental groups (OsGSEG1-KO-1 and OsGSEG1-KO-2), 50 seeds with normal germination and similar germination rates were selected and sown in the seedling trays. When the seedling age reached 25 days, they were transplanted into the field at a plant spacing of 16.7 cm and a row spacing of 26.7 cm, and planted according to the rule of 10 plants × 5 rows as a plot, and normal field water and fertilizer management was carried out. After the seeds matured, the grain shapes of the control group N, the experimental group OsGSEG1-KO-1, and the experimental group OsGSEG1-KO-2 were examined and photographed. The photographing results are as Figure 1 shown. As Figure 1 can be seen, compared with the control group N, the grain lengths of the grains in the experimental group OsGSEG1-KO-1 and the experimental group OsGSEG1-KO-2 are both longer. After removing the glumes of the control group N, the experimental group OsGSEG1-KO-1, and the experimental group OsGSEG1-KO-2 and then making a comparison, the results are as Figure 2 shown. As Figure 2 can be seen, compared with the control group N, the grain lengths of the grains in the experimental group OsGSEG1-KO-1 and the experimental group OsGSEG1-KO-2 after removing the glumes are both longer.

[0065] At the same time, measure the grain lengths of the grains in the control group N, the experimental group OsGSEG1-KO-1, and the experimental group OsGSEG1-KO-2, with 50 replicates in each group. Statistically analyze the measurement results with glumes, as specifically shown in Figure 3 shown. At the same time, statistically analyze the measurement results after removing the glumes, as specifically shown in Figure 4 shown. Combining Figure 3 and Figure 4 it can be seen that compared with the control group N, the grain lengths of the experimental group OsGSEG1-KO-1 and the experimental group OsGSEG1-KO-2 are both longer.

[0066] Ten plump seeds of the control group N, the experimental group OsGSEG1-KO-1, and the experimental group OsGSEG1-KO-2 were taken separately and adhered to the sample stage, and then sputter-coated with gold using an ion sputtering coater (Eiko, Hitachi IB-5 sputter coater). The outer epidermis of the rice seed hulls was observed using a Hitachi S-450 scanning electron microscope, and the results are as Figures 5 to 7 shown. Combining Figures 5 to 7 it can be seen that, compared with the control group N, the outer epidermal cells of the seed hulls of the experimental group OsGSEG1-KO-1 and the experimental group OsGSEG1-KO-2 were significantly enlarged. The lengths and widths of the outer epidermal cells of the seed hulls of the control group N and the experimental groups were statistically analyzed, as specifically shown in Figure 8 shown. From Figure 8 it can be seen that, compared with the control group N, the lengths and widths of the outer epidermal cells of the seed hulls of the experimental group OsGSEG1-KO-1 and the experimental group OsGSEG1-KO-2 were significantly increased.

[0067] The above are only optional embodiments of the present disclosure and are not intended to limit the present disclosure. Any modifications, equivalent replacements, improvements, etc. made within the spirit and principle of the present disclosure shall be included within the protection scope of the present disclosure.

Claims

1. An application of a rice grain type gene, characterized in that: The application is to knock out the rice grain shape gene to improve the grain shape of rice grains, the improved rice grain shape is to increase the grain length of rice grains, the rice grain shape gene is gene OsGSEG1, and the sequence of the gene OsGSEG1 is shown in SEQ ID NO: 1 in the sequence list.

2. The use according to claim 1, characterized in that: The improved rice grain shape is achieved by increasing the length of the outer epidermal cells of the glume of the rice grain.

3. The use according to claim 1, characterized in that: The application is to use the CRISPR / Cas9 system to knock out the coding region of the rice grain type gene and then use it to increase the grain length of rice grains.

Citation Information

Patent Citations

  • Application of gene miR408 and UCL in cultivating high-yielding rice

    CN105112422A

  • Application of rice gene OsBRR1 in regulation and control of plant type and grain type of rice

    CN115724931A