Preparation and identification method of rice resistant to rice blast

Abstract

The application provides a preparation method of rice with resistance to rice blast. By inhibiting the expression of a DHD6 gene in rice or constructing a DHD6 gene-deficient plant, a rice plant with the property of resistance to rice blast can be obtained. The CDS sequence of the DHD6 gene is shown as SEQ ID NO:1, or the sequence of the protein encoded by the DHD6 gene is shown as SEQ ID NO:2. The rice plant with improved resistance to rice blast can be identified by detecting the loss of function of the DHD6 gene. The application also provides a mutated DHD6 gene, the CDS sequence of the mutated DHD6 gene is shown as SEQ ID NO:3, or the sequence of the protein encoded by the mutated DHD6 gene is shown as SEQ ID NO:4. By replacing the wild-type DHD6 gene with the mutated gene through genetic engineering, a rice plant with resistance to rice blast can be constructed.

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering technology, and in particular relates to a method for preparing and identifying rice resistant to rice blast. Background Technology

[0002] Rice (Oryza sativa) is one of the world's major food crops, with over 50% of the global population relying on it as their staple food. Rice blast can severely reduce rice yields, affect grain quality, and cause significant economic losses. The rice blast fungus can infect rice at all growth stages and can be classified into seedling blast, leaf blast, node blast, neck blast, and grain blast based on the time and location of infection. Rice blast occurring on the neck, rachis, branches, and grains after the rice plant has headed is collectively called neck blast. Leaf blast reduces the plant's photosynthetic capacity, reducing yield by 10-30%, while neck blast can lead to total crop failure. Furthermore, the rice blast fungus mutates rapidly, constantly producing new variant races that quickly render existing resistant varieties ineffective. Therefore, continuously identifying resistance genes and cultivating new resistant varieties is of paramount importance. Summary of the Invention

[0003] This invention provides a method for preparing rice resistant to rice blast, wherein the expression of the DHD6 gene in rice is inhibited by genetic engineering or mutagenesis, thereby obtaining rice with resistance to rice blast; the CDS sequence of the DHD6 gene is shown in SEQ ID NO: 1, or the sequence of the protein encoded by the DHD6 gene is shown in SEQ ID NO: 2.

[0004] In one optional preparation method, the inhibition of DHD6 gene expression in rice includes constructing a DHD6 gene mutant rice, which cannot normally express the DHD6 gene.

[0005] A method for identifying rice blast-resistant rice involves determining whether rice possesses blast resistance by detecting the copy number, transcription level, translation level, or DHD6 genotype of the DHD6 gene in the rice.

[0006] A mutated DHD6 gene, the CDS sequence of which is shown in SEQ ID NO: 3, or the sequence of the protein encoded by the mutated DHD6 gene as shown in SEQ ID NO: 4.

[0007] A transformation vector containing the aforementioned mutated DHD6 gene.

[0008] Application of the above-mentioned mutated DHD6 gene or the above-mentioned transformation vector in rice breeding for resistance to rice blast.

[0009] A method for preparing rice resistant to rice blast involves replacing the DHD6 gene in wild-type rice with a mutated DHD6 gene using genetic engineering techniques.

[0010] A method for identifying rice blast-resistant rice prepared by the above method involves detecting the genotype of the DHD6 gene in rice using a combination of PCR, enzyme digestion, and agarose gel electrophoresis.

[0011] Preferably, the upstream primer sequence for PCR is shown in SEQ ID NO: 5, the downstream primer sequence for PCR is shown in SEQ ID NO: 6, and the enzyme digestion is performed using the EcoRI restriction site.

[0012] The beneficial effects of this invention are:

[0013] This invention utilizes deep sequencing analysis on a large number of mutated rice plants to discover that one mutant rice plant exhibits a 2bp mutation compared to the wild-type plant, leading to premature termination of DHD6 gene expression and thus acquiring resistance to rice blast. Furthermore, phenotypic identification in greenhouses and disease nurseries demonstrates that the mutant DHD6 genotype rice plants exhibit significant resistance to rice blast compared to wild-type rice plants. This invention reveals for the first time the relationship between the DHD6 gene and rice blast resistance, providing new insights for the breeding and identification of blast-resistant rice.

[0014] The present invention also provides a mutated DHD6 gene. By replacing the wild-type DHD6 gene with the mutated gene through genetic engineering, a disease-resistant rice plant can be constructed. Attached Figure Description

[0015] Figure 1 Phenotypic growth of wild-type Kitaake and FN75 mutant in a greenhouse. Wild-type is on the left and FN75 mutant is on the right.

[0016] Figure 2 Greenhouse rice blast resistance identification experiment: A shows the lesion phenotype of FN75 mutant 14 days after inoculation with rice blast fungus strain ZB25, and B shows the rice blast fungus content in leaves 14 days after inoculation of FN75 mutant with rice blast fungus strain ZB25.

[0017] Figure 3 : Design drawing of the disease nursery.

[0018] Figure 4 Field rice blast resistance identification experiment. In A, the left side is the wild type and the right side is the FN75 mutant. B is the statistical identification result of the number of leaves infected with rice blast on a single plant. **P<0.01, ****P<0.0001.

[0019] Figure 5: FN75 mutant detection results. Detailed Implementation

[0020] Based on previous research, a rice mutant population was created using fast neutron mutagenesis. Deep sequencing was performed on 1504 mutant lines, resulting in a gene database of the rice mutant population. This invention further analyzes this gene database against rice phenotypic controls, discovering that mutations in the CDS region of the DHD6 gene lead to the loss of gene function, thereby enhancing the resistance of the mutant strains to rice blast.

[0021] Based on this research, the present invention provides the following technical solution:

[0022] A method for preparing rice resistant to rice blast involves inhibiting the expression of the DHD6 gene in rice through genetic engineering or mutagenesis, thereby obtaining rice with resistance to rice blast; the CDS sequence of the DHD6 gene is shown in SEQ ID NO: 1, or the sequence of the protein encoded by the DHD6 gene is shown in SEQ ID NO: 2.

[0023] Optionally, the genetic engineering methods include homologous recombination technology, CRISPR / Cas gene editing technology, and RNA interference technology.

[0024] Optionally, the mutagenesis method includes physical mutagenesis and chemical mutagenesis. Preferably, the physical mutagenesis is fast neutron mutagenesis.

[0025] In one optional preparation method, the inhibition of DHD6 gene expression in rice includes constructing a DHD6 gene mutant rice variety, which cannot normally express the DHD6 gene. Further, the inability of the DHD6 gene mutant rice to normally express the DHD6 gene is achieved through genetic engineering or mutagenesis to induce gene mutation, resulting in incomplete or complete non-expression of the DHD6 gene; or resulting in the expression of a protein with no biological activity or only low biological activity.

[0026] In one optional preparation method, the inhibition of DHD6 gene expression in rice includes using RNA interference technology to inhibit the expression of DHD6 gene in rice.

[0027] A method for identifying rice blast-resistant rice involves determining whether rice possesses blast resistance by detecting the copy number, transcription level, translation level, or DHD6 genotype of the DHD6 gene in the rice.

[0028] Optionally, in the above identification methods, the detection means include gene sequencing, PCR, protein electrophoresis, Western blotting, and ELISA.

[0029] A mutated DHD6 gene, the CDS sequence of which is shown in SEQ ID NO: 3, or the sequence of the protein encoded by the mutated DHD6 gene as shown in SEQ ID NO: 4.

[0030] A transformation vector containing the aforementioned mutated DHD6 gene.

[0031] Application of the above-mentioned mutated DHD6 gene or the above-mentioned transformation vector in rice breeding for resistance to rice blast.

[0032] A rice variety resistant to rice blast, wherein the DHD6 genotype in the rice resistant to rice blast is the aforementioned mutated DHD6 gene.

[0033] A method for preparing the above-mentioned rice resistant to rice blast involves replacing the DHD6 gene in wild-type rice with a mutated DHD6 gene using genetic engineering techniques. Preferably, the genetic engineering technique involves using homologous recombination technology to replace the DHD6 gene in wild-type rice with the mutated DHD6 gene.

[0034] A method for identifying blast-resistant rice prepared by the above method involves detecting the genotype of the DHD6 gene in rice using a combination of PCR, enzyme digestion, and agarose gel electrophoresis. Preferably, the upstream primer sequence for PCR is shown in SEQ ID NO: 5, the downstream primer sequence for PCR is shown in SEQ ID NO: 6, and the enzyme digestion site is the EcoRI restriction site.

[0035] In this invention, unless otherwise specified, all raw material components are commercially available products well known to those skilled in the art.

[0036] The technical solutions of this invention will be clearly and completely described below with reference to the embodiments thereof. Obviously, the described embodiments are only a part of the embodiments of this invention, and not all of them. All other embodiments obtained by those skilled in the art based on the embodiments of this invention without creative effort are within the scope of protection of this invention.

[0037] Example 1

[0038] Obtaining DHD6 gene mutant rice:

[0039] Experimental materials: wild-type Kitaake

[0040] Experimental methods: A rice mutant population was created using fast neutron mutagenesis. Deep sequencing was performed on 1504 mutant lines, and plants with the DHD6 gene defect were screened and named FN75 mutant.

[0041] Whole-genome sequencing revealed that, compared with wild-type plants, mutant FN75 had a 2bp deletion in the SD region of the DHD6 gene (CDS sequence as shown in SEQ ID NO: 1), which caused the original encoded protein (sequence as shown in SEQ ID NO: 2) to terminate prematurely.

[0042] In the FN75 mutant, the CDS sequence of the mutated DHD6 gene is shown in SEQ ID NO: 3, and the encoded protein sequence is shown in SEQ ID NO: 4.

[0043] The growth phenotypes of wild-type Kitaake and FN75 mutants under room temperature conditions are as follows: Figure 1 As shown, compared with the wild-type Kitaake, the FN75 mutant exhibits an early flowering and leaf tip necrosis growth phenotype.

[0044] Example 2

[0045] The homozygous FN75 mutant constructed in Example 1 was selected for disease resistance identification:

[0046] Under greenhouse conditions, rice plants 25 days after germination were inoculated with Magna blast fungus race ZB25 to observe their disease resistance.

[0047] The method for identifying resistance to rice blast leaf blast is as follows: The tested strain was cultured on oat medium under light for 7 days, and then inoculated into 25-day-old rice seedlings. A potential circular wound was artificially created on the second-to-last leaf using a mouse-ear punch, and a 2mm × 2mm mycelial block was placed at the wound and sealed with transparent tape. After 14 days of growth under high temperature and humidity at 28℃, the disease incidence was investigated. Eight plants were inoculated per line, with three independent replicates. Diseased leaves were photographed, and leaves of the same length containing the lesions were taken. DNA was extracted using the CTAB method, and the relative fungal content of *Strombus oryzae* was determined using quantitative real-time analysis. The ratio of the *Strombus oryzae* MoPOT2 gene to the *Ubiquitin* gene in rice represents the relative fungal biomass.

[0048] Fluorescent quantitative primers

[0049] MoPot2-RT-F SEQ ID NO: 7 ACGACCCGTCTTTACTTATTTGG MoPot2-RT-R SEQ ID NO: 8 AAGTAGCGTTGGTTTTGTTGGAT Osubiqutin-RT-F SEQ ID NO: 9 TGAAGACCCTGACTGGGAAG Osubiqutin-RT-R SEQ ID NO: 10 CACGGTTCAACAACATCCAG

[0050] like Figure 2 As shown in Figure A, the mutant FN75 exhibits some resistance to rice blast fungus ZB25 compared to the wild-type Kitaake. The results of quantitative real-time PCR are shown below. Figure 2 As shown in Figure B, the relative fungal biomass of wild-type Kitaake after inoculation with rice blast fungus ZB25 was approximately 44.21, while the average relative fungal biomass of mutant FN75 was approximately 18.64.

[0051] The above-mentioned rice blast fungus race ZB25 was obtained from Professor Chen Xuewei of Sichuan Agricultural University. Reference (Zhou et al., Loss of function of arice TPR-domain RNA-binding protein confers broad-spectrum disease resistance. Proc Natl Acad Sci USA 2018.115(12):3174-3179).

[0052] Example 3

[0053] Field trials for disease resistance testing:

[0054] Experimental materials: wild-type Kitaake; homozygous FN75 mutant constructed in Example 1.

[0055] The study used a naturally induced disease nursery to assess rice blast resistance at a test site in Xianfeng County, Enshi, Hubei Province. The assessment was conducted over two years. Transplanting was generally done around May, depending on the local climate. The nursery design was as follows: Figure 3 As shown. Susceptible rice blast fungus LTH (obtained from Professor Chen Xuewei of Sichuan Agricultural University, same reference as the above-mentioned rice blast fungus race) was planted around the control and test groups to induce inoculation. A total of 60m² of both materials were planted. 2 500 seedlings of each material were planted, with a spacing of 18cm x 18cm. The cultivation conditions and management measures met the requirements for field management, and protective rows were planted around the perimeter of the experimental area.

[0056] Methods for identifying resistance to leaf blast: The investigation was conducted at the end of the tillering stage of rice, when the leaf blast disease is most severe. 65 wild-type Kitaake plants and 44 FN75 plants were investigated. Each plant was investigated individually, and the number of leaves with obvious lesions and the total number of leaves were counted for each plant. The percentage of diseased leaves per plant was calculated.

[0057] The results are as follows Figure 4 As shown: all wild-type Kitaake materials were severely affected by leaf blast, with an average disease rate of 0.8%, while the mutant material FN75 had an average disease rate of 0.6%, indicating that the mutant FN75 has a certain degree of resistance to rice blast in the field.

[0058] Example 4

[0059] Detection of FN75 mutant in Example 1 (detection of rice plants resistant to rice blast):

[0060] The steps for extracting DNA using the CTAB method are as follows:

[0061] (1) Open the 65℃ water bath in advance and place the prepared CTAB on it;

[0062] (2) Grind the 2-3cm leaves with a mortar and pestle, adding liquid nitrogen as needed during the grinding process until the leaves are ground into powder. Put an appropriate amount of powder into a 1.5mL centrifuge tube and add 600μL CTAB. Mix by inverting the tube and incubate in a 65℃ water bath for 30min (invert gently 3-5 times every 10min).

[0063] (3) Add 400 μL of chloroform:isoamyl alcohol (24:1) and slowly rotate on a shaker for 15 min;

[0064] (4) Centrifuge at 4℃, 10000r / min, for 10min. Use a pipette to gently aspirate 400μL of supernatant into a new 1.5mL centrifuge tube, add an equal volume of isopropanol and mix gently. Let stand for 20min.

[0065] (5) Centrifuge at 4℃, 10000r / min, for 10min, and discard the supernatant;

[0066] (6) Add 1 mL of 75% ethanol to the centrifuge tube, gently wash the precipitate, and remove the 75% ethanol.

[0067] (7) Dry the centrifuge tubes in a clean bench to remove anhydrous ethanol.

[0068] (8) Add 50 μL of preheated sterile water to the centrifuge tube and gently aspirate to mix and dissolve the precipitate;

[0069] (9) Measure the DNA concentration and store it at -20℃ for later use.

[0070] The extracted DNA was amplified by PCR using FN75 Seq / FR primers, and the amplification products were used... Enzyme digestion was performed using EcoRI (TransGenBiotech#JE201-01).

[0071] The specific steps are as follows:

[0072] PCR reaction system

[0073]

[0074]

[0075] Primer sequence

[0076] FN75Seq / F SEQ ID NO: 5 GTCAGGTTCGGACACCATTC FN75Seq / R SEQ ID NO: 6 GGCCATCTGGAGTAAAAGCA

[0077] Amplification program: Pre-denaturation, 95℃, 3 min; Denaturation, second step, 95℃, 30 sec; Annealing, third step, 55℃, 30 sec; Extension temperature, fourth step, 72℃, determined according to the size of the amplified fragment, generally calculated as 60 sec / kb; The process from extension to denaturation is carried out in the fourth step, 35 cycles; then the fifth step, 72℃, 5 min; finally, the sixth step, 16℃, 10 min.

[0078] Product digestion system

[0079] PCR products 5μL 10×CutSmartBuffer 2μL EcoRⅠ 0.5μL <![CDATA[ddH2O]]> 12.5μL

[0080] Enzyme digestion conditions: 37℃, 4 hours.

[0081] The results of agarose gel electrophoresis are as follows: Figure 5 As shown, lane 1 is the wild type with one band, lane 2 is the heterozygous mutant with three bands, and lane 3 is the homozygous mutant with a 2bp deletion, which will be cut into two bands (i.e., the rice plant resistant to rice blast).

[0082] In summary, this invention reveals the effect of the DHD6 gene on the resistance of rice plants to rice blast. When the DHD6 gene is mutated, resulting in its inability to be expressed normally, the rice plant acquires resistance to rice blast.

[0083] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. A method of preparing a blast disease resistant rice plant, characterized by, Rice with resistance to rice blast can be obtained by inhibiting the expression of the DHD6 gene in rice through genetic engineering. The CDS sequence of the DHD6 gene is shown in SEQ ID NO:

1.

2. The method as described in claim 1, characterized in that, The sequence of the protein encoded by the DHD6 gene is shown in SEQ ID NO:

2.

3. The method as described in claim 1, characterized in that, The method of inhibiting the expression of the DHD6 gene in rice includes constructing a DHD6 gene mutant rice, which cannot express the DHD6 gene normally.

4. A method for preparing blast-resistant rice containing the mutated DHD6 gene, characterized in that, The DHD6 gene in wild-type rice was replaced with a mutated DHD6 gene using genetic engineering. The CDS sequence of the DHD6 gene in wild-type rice is shown in SEQ ID NO: 1, and the CDS sequence of the mutated DHD6 gene is shown in SEQ ID NO:

3.

5. A method for identifying rice resistant to rice blast prepared according to the method described in claim 4, characterized in that, The genotype of the DHD6 gene in rice was detected by combining PCR, enzyme digestion, and agarose gel electrophoresis techniques.

6. The method as described in claim 5, characterized in that, The upstream primer sequence for PCR is shown in SEQ ID NO: 5, and the downstream primer sequence for PCR is shown in SEQ ID NO:

6. The enzyme digestion selected is the EcoRI restriction site.

Images