SNP 6-117625901 marker related to content of ginsenoside Rg1 in panax notoginseng and application thereof
By developing the SNP molecular marker SNP6-117625901, which is related to the content of ginsenoside Rg1 in Panax notoginseng, and using KASP primers for PCR amplification and genotyping, the problems of long breeding cycle and low efficiency of Panax notoginseng were solved, and early selection and efficient breeding were achieved.
Patent Information
- Application Number
- CN202410750716.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-06-12
- Publication Date
- 2026-02-06
- Estimated Expiration
- 2044-06-12
AI Technical Summary
Existing technologies for breeding Panax notoginseng varieties have long breeding cycles and low efficiency. They lack early selection and identification methods, and the hybridization breeding methods are limited, making it difficult to increase the content and types of ginsenosides, resulting in breeding cycles of up to 15-20 years.
We developed the SNP molecular marker SNP6-117625901, which is associated with the content of ginsenoside Rg1 in Panax notoginseng. We used KASP primers for PCR amplification and genotyping, and then used a high-throughput genotyping system to detect the genotype, thus achieving early molecular-assisted selection of ginsenoside Rg1 content.
By using molecular marker-assisted selection, the efficiency of Panax notoginseng breeding has been improved, enabling early identification and pre-selection of ginsenoside Rg1 content, shortening the breeding cycle, and improving breeding selection efficiency.
Smart Images

Figure CN118703667B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The application belongs to the technical field of molecular genetic breeding, and particularly relates to a SNP molecular marker related to the content of ginsenoside Rg1 in Panax notoginseng and application thereof. BACKGROUND
[0002] Panax notoginseng is a perennial herb of the genus Panax in the family Araliaceae, and its roots and rhizomes are used as medicines. Panax notoginseng has the effects of removing blood stasis, stopping bleeding, and relieving swelling and pain. Panax notoginseng is one of the most valuable traditional Chinese medicinal materials in China. Panax notoginseng is widely used in clinical practice, and is one of the main raw materials of Xuesaitong soft capsules, Yunnan white medicine, compound salvia miltiorrhiza tablets, compound salvia miltiorrhiza dripping pills, and Zhangzhou Banling Decoction. Ginsenosides are the main active ingredients in Panax notoginseng, and the content and types of ginsenosides are important indicators for evaluating the quality of Panax notoginseng.
[0003] Quality breeding is the core measure of good seed selection. Studies have shown that the excellent allelic variation of key genes controlling important agronomic traits can be effectively utilized in molecular marker-assisted selection breeding through the development of allelic specific molecular markers. Panax notoginseng variety selection mainly adopts group mixed selection method, mainly relies on phenotypic selection, and obtains population varieties, which is the main breeding method for Panax notoginseng variety selection at present. However, Panax notoginseng requires at least 3 years per generation, and the speed of phenotypic separation and population construction is extremely slow, and there is also a lack of early selection and identification means, resulting in a long breeding cycle, low efficiency, and the need for 15-20 years to cultivate a new variety. At the same time, Panax notoginseng is a common cross-pollinated plant, and there is no pure line breeding material so far, which seriously limits the application of hybrid breeding method in Panax notoginseng variety selection. Distant hybridization is also difficult to be used for Panax notoginseng quality improvement.
[0004] With the development of omics technology, molecular genetic breeding of medicinal plants based on molecular markers can greatly improve the breeding efficiency, and make it possible to carry out molecular design breeding for targeted improvement of effective components of medicinal plants. SNP marker (single nucleotide polymorphism) mainly refers to DNA sequence polymorphism caused by single nucleotide variation at the genome level, which is the highest in polymorphism coverage and density among current molecular markers. Compared with traditional molecular marker-assisted selection, high-throughput resequencing technology can generate large-scale SNP markers, promote accurate association analysis of markers and traits, and improve the efficiency of molecular-assisted selection breeding. The content and types of ginsenosides in Panax notoginseng should be the core target of Panax notoginseng variety selection. Therefore, it is particularly important to use known ginsenoside biosynthetic genes and rich Panax notoginseng germplasm resources to excavate SNPs significantly associated with the content of ginsenoside Rg1 in Panax notoginseng, develop KASP molecular markers for assisting breeding, and realize early molecular-assisted selection of target traits to improve breeding efficiency. SUMMARY
[0005] In view of the above problems, the present application aims to provide a SNP molecular marker related to the content of ginsenoside Rg1 in Panax notoginseng and application thereof.
[0006] To achieve the above object, the present application adopts the following technical solution:
[0007] The present application provides application of a kit for detecting a SNP molecular marker related to the content of ginsenoside Rg1 in Panax notoginseng in breeding of the content of ginsenoside Rg1 in Panax notoginseng, wherein the SNP molecular marker is SNP6-117625901, located at base position 117625901 of Chr11 chromosome, and the mutation type thereof is C / T.
[0008] Preferably, in the SNP6-117625901, the content of ginsenoside Rg1 of the TT genotype is higher than that of the CC / CT genotype.
[0009] The present application also provides application of a KASP primer pair for detecting a SNP molecular marker related to the content of ginsenoside Rg1 in Panax notoginseng in breeding of the content of ginsenoside Rg1 in Panax notoginseng, wherein the KASP primer pair comprises an upstream primer SNP6-F1 and SNP6-F2 and a downstream primer SNP6-R for detecting the SNP6-117625901.
[0010] Preferably,
[0011] The SNP6-F1 is 5'-GAAGGTGACCAAGTTCATGCTGAATTAAAGGGGCAGTTCCTTCC-3';
[0012] The SNP6-F2 is 5'-GAAGGTCGGAGTCAACGGATTGAATTAAAGGGGCAGTTCCTTCT-3';
[0013] The SNP6-R is 5'-TGTCTACCCTTGCCAACTCG-3'.
[0014] The present application also provides a method for detecting the content of ginsenoside Rg1 in Panax notoginseng, comprising the following steps:
[0015] (1) extracting DNA of a sample of Panax notoginseng to be detected as a template;
[0016] (2) performing PCR amplification on the template by using the KASP primer pair in claim 3 or 4;
[0017] (3) reading the fluorescence signal after PCR amplification is completed by a high-throughput genotyping system GeneMatrix, and analyzing and converting the fluorescence signal to genotype the SNP6-117625901 molecular marker site of the ginsenoside Rg1 content sample to be identified;
[0018] (4) the method for determining the ginsenoside Rg1 content phenotype of the ginsenoside Rg1 content trait to be identified in step (3) is as follows: if the genotype determined is TT, it is determined that the ginsenoside Rg1 content in the ginseng sample is high; if the genotype determined is CC / CT, it is determined that the ginsenoside Rg1 content in the ginseng sample is low.
[0019] As preferred, the program of the PCR amplification is as follows: pre-denaturation at 95℃ for 10 min; denaturation at 95℃ for 20 sec; annealing at 61-55℃ for 40 sec, decreasing by 0.6℃ for each cycle, 10 cycles; denaturation at 95℃ for 20 sec, annealing at 55℃ for 40 sec, 35 cycles.
[0020] As preferred, the system of the PCR amplification is as follows: 1 μL of 15 ng / μL of DNA template; 1 μL of 2×KASP Master mix; 0.01 μL of KASP mixed primers, wherein the volume ratio of the upstream primer SNP6-F1, the upstream primer SNP6-F2 and the downstream primer SNP6-R is 1:1:3.
[0021] The present application has the following beneficial effects:
[0022] The SNP significantly related to the ginsenoside Rg1 content in ginseng provided by the present application is obtained by performing association analysis on 236 ginseng natural populations, using the SNP site as the genotype data, using the ginsenoside Rg1 content as the phenotype data, using the EMMAX software, and using the mixed linear model (MLM) to perform whole genome association (GWAS) analysis screening. The SNP molecular marker SNP6-117625901 is located at the 117625901th base of the Chr11 chromosome, and provides technical support for molecular marker assisted breeding of the ginsenoside Rg1 content trait in ginseng.
[0023] The KASP primer combination developed by the application can directly distinguish and detect the mutation site C or T base of SNP6-117625901. When the KASP primer combination is used to identify the content of ginsenoside Rg1, two genotypes can be clearly separated. In the molecular marker SNP6-117625901, the dot close to the Y axis is the TT allelic variation site, and the genotype is TT. The content of ginsenoside Rg1 of the panax notoginseng with the genotype is relatively high. The dot close to the X axis is the CC allelic variation site, and the genotype is CC. The content of ginsenoside Rg1 of the panax notoginseng with the genotype is relatively low. The KASP primer combination developed by the application has good application value, can realize the pre-selection and molecular assisted breeding of the content of ginsenoside Rg1 of panax notoginseng, and has important theoretical and practical guiding significance for improving the breeding selection efficiency of the content of ginsenoside Rg1 of panax notoginseng. BRIEF DESCRIPTION OF DRAWINGS
[0024] Figure 1 It is a Manhattan and QQ-plot diagram of GWAS results of ginsenoside Rg1 in panax notoginseng;
[0025] Figure 2 It is a statistical diagram of allelic variation and phenotype significance of ginsenoside Rg1 content in panax notoginseng;
[0026] Figure 3 It is a genotyping result of different panax notoginseng samples by KASP special primer. DETAILED DESCRIPTION
[0027] The specific embodiments of the application will be further described below. It should be noted that the description of these embodiments is used to help understand the application, but does not constitute a limitation on the application. In addition, the technical features involved in each embodiment of the application described below can be combined with each other as long as they do not conflict with each other.
[0028] Example 1
[0029] Obtaining of nucleotide mutation site (SNP) related to ginsenoside Rg1 content in panax notoginseng
[0030] (1) DNA extraction and high-throughput sequencing:
[0031] Take 236 panax notoginseng natural population materials, extract genomic DNA by CTAB method, and perform 10X whole genome resequencing.
[0032] (2) Determination of ginsenoside Rg1 content:
[0033] The notoginseng sample was dried at 50°C until constant weight, and then crushed with a pulverizer and passed through a No. 4 sieve. 0.6 g of the sample was precisely weighed, 50 ml of methanol was added, weighed, and the bottle opening was sealed with a sealing film. The mixture was ultrasonicated for 30 min, and then left to stand for 20 h. The sealing film was removed, the weight was determined, the lost weight was made up with methanol, and the mixture was shaken and filtered with a 0.22 μm microporous filter to obtain 1 ml of a test solution. The ginsenoside Rg1 was quantitatively analyzed by using a high performance liquid chromatography (HPLC) technique and an external standard method. The chromatographic column was Agilent ZORBAX SB-AQ (3.5 μm, 4.6 x 150 mm), the flow rate was 0.7 ml / min, the column temperature was 30°C, the sample volume was 10 μl, the detection wavelength was 203 nm, and the mobile phase was acetonitrile (A) and H2O (B) with an elution gradient of 0-12 min, 19% (A); 12-60 min, 19-36% (A). The compounds were identified according to the retention time, and quantified by using an external standard method, and the peak area was used as the quantitative basis.
[0034] (3) Genome-wide association analysis (GWAS)
[0035] The SNP site was used as the genotype data, the content of ginsenoside Rg1 was used as the phenotype data, the EMMAX software was used, and the mixed linear model (MLM) was used for genome-wide association (GWAS) analysis. The results are shown in Table 1. Figure 1 The threshold value of -log10(P) > 6 was used, and the SNP molecular marker SNP6-117625901 significantly associated with ginsenoside Rg1 was located at the 117625901th base of Chr11 chromosome. The sequence allelic variation of the SNP was extracted by comparing the notoginseng reference genome, and the content of ginsenoside Rg1 of the population material was combined for joint analysis. The SNP6-117625901 had three genotypes CC, TT and CT, and the T test found that the content of ginsenoside Rg1 in the TT genotype was higher, which was the dominant genotype. Figure 2
[0036] The gene sequence containing 100 bp before and after the SNP6-117625901 site is shown in SEQ ID NO. 1:
[0037] GATGCCAAGTTATGGTGGCGTACAAAGGTGGGAGATGGAACATGTGTTGTTGTAACAATATGGACAGAATTGAAGATGGAATTAAAGGGGCAGTTCCTTC[C / T]AGCGAATTCGAGTTGGCAAGGGTAGACACTCGAAATTTCATTTTCCTGTTACTAACTATGCAGATGGACAAAAGCGTCTTTCTCACACTCCAAAGATAAC (SEQ ID NO: 1)
[0038] Example 2
[0039] Development of SNP marker KASP specific primers
[0040] Three primers were designed according to the sequence of SEQ ID NO. 1 using the Primer-BLAST function of NCBI, the upstream primer SNP6-F1, the upstream primer SNP6-F2 and the downstream primer SNP6-R, wherein SNP6-F1 and SNP6-F2 respectively contain FAM and HEX fluorescent linker sequences (underlined), and the sequences are as follows:
[0041] The SNP6-F1: 5'-TGAATTAAAGGGGCAGTTCCTTCC-3'; GAAGGTGACCAAGTTCATGC
[0042] The SNP6-F2: 5'-TGAATTAAAGGGGCAGTTCCTTCT-3'; GAAGGTCGGAGTCAACGGAT
[0043] The SNP6-R: 5'-TGTCTACCCTTGCCAACTCG-3'.
[0044] Example 3
[0045] Detection of genotypes of SNP sites in different Panax notoginseng samples and application thereof
[0046] The authenticity of SNP6-117625901 in the natural population of Panax notoginseng was verified by high-throughput genotyping system GeneMatrix (GM). Ninety-four Panax notoginseng single plant materials were randomly selected, and the genomic DNA of the samples was extracted. The genomic DNA was used as a template, and the SNP marker KASP specific primers developed in Example 2 were used for PCR amplification.
[0047] PCR reaction system is as follows: 15 ng / μL of DNA template 1 μL; 2 × KASP Master mix 1 μL; KASP mixed primer 0.01 μL, wherein the volume ratio of upstream primer SNP6-F1, upstream primer SNP6-F2 and downstream primer SNP6-R is 1:1:3. The PCR amplification procedure is as follows: 95 ℃ pre-denaturation for 10 min; 95 ℃ denaturation for 20 sec; 61-55 ℃ annealing for 40 sec, decreasing 0.6 ℃ for each cycle, 10 cycles; 95 ℃ denaturation for 20 sec, 55 ℃ annealing for 40 sec, 35 cycles. After the completion of PCR amplification, the fluorescence signal is read, the conversion fluorescence signal is analyzed, and the fluorescence scanning result is automatically converted into a graph, and two pairs of marker primers can clearly separate two genotypes.
[0048] In the molecular marker SNP6-117625901, the dot close to the Y axis carries a TT allelic variation site, and the genotype is TT, and the content of ginsenoside Rg1 in the three seven is relatively high; the dot close to the X axis carries a CC allelic variation site, and the genotype is CC, and the content of ginsenoside Rg1 in the three seven is relatively low. Figure 3
[0049] The above has made a detailed description on the embodiments of the present application, but the present application is not limited to the described embodiments. For those skilled in the art, various changes, modifications, replacements and variations can be made to the embodiments without departing from the principles and spirits of the present application, and still fall within the protection scope of the present application.
Claims
1. The application of a kit for detecting SNP molecular markers related to the content of ginsenoside Rg1 in Panax notoginseng in the breeding of Panax notoginseng with ginsenoside Rg1 content, characterized in that: The SNP molecular marker is SNP6-117625901, located at base 117625901 on chromosome Chr11, and its mutation type is C / T. The gene sequence containing 100 bp before and after the SNP6-117625901 site is shown in SEQ ID NO.1 and SEQ ID NO.
2. In the SNP6-117625901, the TT genotype has a higher content of ginsenoside Rg1 than the CC / CT genotype.
2. The application of the KASP primer pair for detecting the SNP6-117625901 molecular marker associated with the content of ginsenoside Rg1 in Panax notoginseng as described in claim 1 in the breeding of the ginsenoside Rg1 content trait in Panax notoginseng, characterized in that: The KASP primers include upstream primers SNP6-F1 and SNP6-F2 and downstream primer SNP6-R for detecting SNP6-117625901; in SNP6-117625901, the content of ginsenoside Rg1 in the TT genotype is higher than that in the CC / CT genotype. The SNP6-F1 is: 5'- GAAGGTGACCAAGTTCATGCTGAATTAAAGGGGCAGTTCCTTCC -3'; The SNP6-F2: 5'-GAAGGTCGGAGTCAACGGATTGAATTAAAGGGGCAGTTCCTTCT -3'; The SNP6-R is: 5'- TGTCTACCCTTGCCAACTCG -3'.
3. A method for detecting the content of ginsenoside Rg1 in Panax notoginseng, characterized in that: Includes the following steps: (1) Extract DNA from the Panax notoginseng sample to be tested as a template; (2) PCR amplification of the template using the KASP primers described in claim 2; (3) After PCR amplification, the fluorescence signal was read and converted by the high-throughput genotyping system GeneMatrix. The fluorescence signal was analyzed and converted to perform genotyping on the SNP6-117625901 molecular marker site as described in claim 1 in the sample of Panax notoginseng ginsenoside Rg1 content to be identified. (4) The method for determining the phenotypic phenotype of ginsenoside Rg1 content in step (3) is as follows: if the identified genotype is TT, then the ginsenoside Rg1 content in the Panax notoginseng sample is high; if the identified genotype is CC / CT, then the ginsenoside Rg1 content in the Panax notoginseng sample is low.
4. The method according to claim 3, characterized in that, The PCR amplification program was as follows: 95℃ pre-denaturation for 10 min; 95℃ denaturation for 20 sec; 61-55℃ annealing for 40 sec, decreasing by 0.6℃ per cycle, for 10 cycles; 95℃ denaturation for 20 sec, 55℃ annealing for 40 sec, for 35 cycles.
5. The method according to claim 4, characterized in that, The quantitative PCR amplification system is as follows: 1 μL of 15 ng / μL DNA template; 1 μL of 2×KASP Master mix; 0.01 μL of KASP mixed primers, wherein the volume ratio of upstream primer SNP6-F1, upstream primer SNP6-F2 and downstream primer SNP6-R is 1:1:3.
Citation Information
Patent Citations
Application of pseudo-ginseng SSR marker in determining ginsenoside Rb1 content
CN109486997A
SSR polymorphic primer of pseudo-ginseng, polymorphic detection method and application of SSR marker in determining total amount of total saponins
CN109486999A