A vipr1l protein and its application in biological pesticides and biological breeding

By expressing the VIPR1L protein in plants to form a complex with the VDAL protein, the problems of plant growth and disease resistance under abiotic stress were solved, and the plant's disease resistance, drought resistance, salt tolerance and growth promotion effects were improved, thereby enhancing crop yield and fruit and vegetable preservation capabilities.

CN118725061BActive Publication Date: 2025-11-21BEIJING AGROALADDIN BIOTECHNOLOGY CO LTD
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202311667961.3
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-12-07
Publication Date
2025-11-21
Estimated Expiration
2043-12-07

AI Technical Summary

Technical Problem

There is a lack of effective methods in the current technology to improve the disease resistance, stress resistance and growth promotion of plants, especially under abiotic stress conditions, the immune response and growth regulation of plants are insufficient.

Method used

Using the VIPR1L protein and its derivatives, by forming a complex with the VDAL protein, signal transduction of disease and stress signals is mediated, thereby regulating plant growth, development and immune responses. This includes expressing the VIPR1L protein in plants and linking it with a polypeptide tag, constructing recombinant vectors and transgenic cell lines to achieve these functions.

Benefits of technology

VIPR1L protein can enhance plant disease resistance, drought resistance, and salt tolerance, promote plant growth, increase chlorophyll content, improve crop yield and quality, and has a significant effect on fruit and vegetable preservation.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN118725061B_ABST
    Figure CN118725061B_ABST
Patent Text Reader

Abstract

The present application relates to a kind of VIPR1L protein and its application in biological pesticide and biological breeding.The protein is located on cell membrane, is involved in the resistance of plant to verticillium wilt;With the effect of promoting the germination of wheat and corn and promoting the growth of plant;Can induce the drought resistance, salt resistance, disease resistance of plant;Increase chlorophyll content, increase the yield of grain crops such as corn, vegetables, fruits and tea and all crops;Increase the content of tea polyphenols, improve the taste of tomato, improve the quality of fruits and tea and the like.Based on the protein and the biological preparation prepared by the DNA of coding, in the regulation of plant growth and development or immunity or stress response, improve yield and produce green flavor fruits and vegetables have good application prospect.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to the field of biotechnology, in particular to a VIPR1L protein and its application in biological pesticides and biological breeding. In particular, the present application relates to a VIPR1L protein and its application in promoting plant growth, improving plant disease resistance, improving plant resistance to abiotic stress, improving crop yield, quality, and fruit and vegetable preservation. BACKGROUND

[0002] Plants can induce their own immune response by sensing external pathogenic bacteria pattern molecules, but plants not only recognize the pathogenic factors (Effector) of pathogenic microorganisms, but also recognize endogenous elicitors (Elicitor) such as plant cell wall fragments and endogenous small peptide molecules. Therefore, plants rely on the recognition of endogenous and exogenous pattern molecules to establish an innate immune response mechanism.

[0003] Small peptides generally refer to peptide segments with a length of 5-150 amino acids. Some endogenous small molecule polypeptide precursors in plants can be transformed into functional small molecule polypeptides through modification to regulate plant immunity.

[0004] In 1991, a plant small peptide-phytoalexin was first reported in tomato, which can improve the defense of tomato by regulating the accumulation of protease inhibitors of anti-herbivore defense proteins; in addition, a small molecule polypeptide Pep1 containing 23 amino acids was also reported, which can enhance the resistance to Pseudomonas syringae (tomato DC3000) in Arabidopsis thaliana and increase the resistance to leaf blight fungus in maize, etc. Numerous endogenous small peptides in plants have been found and proved to be involved in the regulation of plant growth and development, plant and microbial interaction, and response to biological and abiotic stress. SUMMARY

[0005] In view of the defects in the prior art, the present application aims to provide a VIPR1L protein and its application in biological pesticides and biological breeding. The VIPR1L protein is involved in plant disease resistance, promotes plant seed germination and plant growth, and also has the effects of inducing plant drought resistance, salt resistance, disease resistance, etc., and improves chlorophyll content. In addition, the VIPR1L protein interacts with VDAL to form a protein complex with a similar receptor kinase RKL1, which can jointly mediate the signal transduction of disease / stress signals, thereby regulating plant growth and development or immunity or stress response.

[0006] To achieve the above purpose, the technical solution adopted by the present application is:

[0007] 1. A VIPR1L protein, characterized in that it comprises:

[0008] (1) the amino acid sequence of the VIPR1L protein is shown as SEQ ID No. 1;

[0009] (2) the amino acid sequence of any substitution of the amino acid sequence of item (1) except for the 50th-114th amino acid, and the amino acid sequence having 75% or more identity with the amino acid sequence of item (1);

[0010] SEQ ID No. 6-10 are only examples of the amino acid sequence of item (2) above, and do not limit the amino acid sequence of item (2), which has 75.38%, 81.54%, 88.46%, 91.5% and 97.69% identity with the amino acid sequence of item (1), respectively;

[0011] (3) the amino acid sequence of any substitution of the amino acid sequence of item (1) except for the 102nd-114th amino acid, and the amino acid sequence having 75% or more identity with the amino acid sequence of item (1);

[0012] SEQ ID No. 11-15 are only examples of the amino acid sequence of item (3) above, and do not limit the amino acid sequence of item (3), which has 75.38%, 80.76%, 86.15%, 91.5% and 96.15% identity with the amino acid sequence of item (1), respectively;

[0013] (4) a polypeptide tag is connected to the N-terminus or C-terminus of the amino acid sequence of the VIPR1L protein of any one of items (1)-(3) above;

[0014] The polypeptide tag includes:

[0015] Poly-Arg, which is an oligomer of Arg, and the number of Arg residues in the oligomer is 5-6;

[0016] Poly-His, which is an oligomer of His, and the number of His residues in the oligomer is 2-10;

[0017] FLAG, the sequence of which is DYKDDDDK;

[0018] Strep-tag II, the sequence of which is WSHPQFEK;

[0019] c-myc, the sequence of which is EQKLISEEDL;

[0020] SEQ ID No. 16-31 are merely examples of the amino acid sequence in which the polypeptide tag described in the above item (4) is added to the amino acid sequence described in the above item (1), and do not limit the amino acid sequence in which the polypeptide tag described in the above item (4) is added to the amino acid sequence described in the above item (1);

[0021] SEQ ID No. 32-47 are merely examples of the amino acid sequence in which the polypeptide tag described in the above item (4) is added to the amino acid sequence described in the above item (2), and do not limit the amino acid sequence in which the polypeptide tag described in the above item (4) is added to the amino acid sequence described in the above item (2); the amino acid sequence described in the above item (2) is exemplified by SEQ ID No. 6;

[0022] SEQ ID No. 48-63 are merely examples of the amino acid sequence in which the polypeptide tag described in the above item (4) is added to the amino acid sequence described in the above item (2), and do not limit the amino acid sequence in which the polypeptide tag described in the above item (4) is added to the amino acid sequence described in the above item (2); the amino acid sequence described in the above item (2) is exemplified by SEQ ID No. 7;

[0023] SEQ ID No. 64-79 are merely examples of the amino acid sequence in which the polypeptide tag described in the above item (4) is added to the amino acid sequence described in the above item (2), and do not limit the amino acid sequence in which the polypeptide tag described in the above item (4) is added to the amino acid sequence described in the above item (2); the amino acid sequence described in the above item (2) is exemplified by SEQ ID No. 8;

[0024] SEQ ID No. 80-95 are merely examples of the amino acid sequence in which the polypeptide tag described in the above item (4) is added to the amino acid sequence described in the above item (2), and do not limit the amino acid sequence in which the polypeptide tag described in the above item (4) is added to the amino acid sequence described in the above item (2); the amino acid sequence described in the above item (2) is exemplified by SEQ ID No. 9;

[0025] SEQ ID No. 96-111 are merely examples of the amino acid sequence in which the polypeptide tag described in the above item (4) is added to the amino acid sequence described in the above item (2), and do not limit the amino acid sequence in which the polypeptide tag described in the above item (4) is added to the amino acid sequence described in the above item (2); the amino acid sequence described in the above item (2) is exemplified by SEQ ID No. 10;

[0026] SEQ ID No. 112-127 are merely examples of the amino acid sequence based on the amino acid sequence described in the above item (3) with the polypeptide tag described in item (4) connected thereto, and do not limit the amino acid sequence based on the amino acid sequence described in item (3) with the polypeptide tag described in item (4) connected thereto; the amino acid sequence based on the amino acid sequence described in item (3) is exemplified by SEQ ID No. 11;

[0027] SEQ ID No. 128-143 are merely examples of the amino acid sequence based on the amino acid sequence described in the above item (3) with the polypeptide tag described in item (4) connected thereto, and do not limit the amino acid sequence based on the amino acid sequence described in item (3) with the polypeptide tag described in item (4) connected thereto; the amino acid sequence based on the amino acid sequence described in item (3) is exemplified by SEQ ID No. 12;

[0028] SEQ ID No. 144-159 are merely examples of the amino acid sequence based on the amino acid sequence described in the above item (3) with the polypeptide tag described in item (4) connected thereto, and do not limit the amino acid sequence based on the amino acid sequence described in item (3) with the polypeptide tag described in item (4) connected thereto; the amino acid sequence based on the amino acid sequence described in item (3) is exemplified by SEQ ID No. 13;

[0029] SEQ ID No. 160-175 are merely examples of the amino acid sequence based on the amino acid sequence described in the above item (3) with the polypeptide tag described in item (4) connected thereto, and do not limit the amino acid sequence based on the amino acid sequence described in item (3) with the polypeptide tag described in item (4) connected thereto; the amino acid sequence based on the amino acid sequence described in item (3) is exemplified by SEQ ID No. 14;

[0030] SEQ ID No. 176-191 are merely examples of the amino acid sequence based on the amino acid sequence described in the above item (3) with the polypeptide tag described in item (4) connected thereto, and do not limit the amino acid sequence based on the amino acid sequence described in item (3) with the polypeptide tag described in item (4) connected thereto; the amino acid sequence based on the amino acid sequence described in item (3) is exemplified by SEQ ID No. 15;

[0031] 2. A DNA, wherein the sequence of the DNA comprises:

[0032] (1) a nucleotide sequence as shown in SEQ ID No. 2 for encoding the VIPR1L protein described in item (1) of claim 1;

[0033] (2) a nucleotide sequence for encoding the VIPR1L protein as described in item (2) of the above item 1;

[0034] SEQ ID Nos. 192-196 are merely illustrative of, but not limiting to, the nucleotide sequences as described in item (2) of the above item 2; SEQ ID Nos. 192-196 are respectively for encoding the amino acid sequences as shown in SEQ ID Nos. 6-10 above;

[0035] (3) a nucleotide sequence for encoding the VIPR1L protein as described in item (3) of the above item 1;

[0036] SEQ ID Nos. 197-201 are merely illustrative of, but not limiting to, the nucleotide sequences as described in item (3) of the above item 2; SEQ ID Nos. 197-201 are respectively for encoding the amino acid sequences as shown in SEQ ID Nos. 11-15 above;

[0037] (4) a nucleotide sequence for encoding the VIPR1L protein as described in item (4) of the above item 1;

[0038] SEQ ID Nos. 202-217 are merely illustrative of, but not limiting to, the nucleotide sequences as described in item (4) of the above item 2; SEQ ID Nos. 202-217 are respectively for encoding the amino acid sequences as shown in SEQ ID Nos. 16-31 above;

[0039] In addition, based on the amino acid sequences as shown in SEQ ID Nos. 32-191 that have been listed, the corresponding nucleotide sequences, though not all listed, are certainly within the scope of the nucleotide sequences as described in item (4) of the above item 2; for the same reason, these unlisted nucleotide sequences are not considered as limiting to the amino acid sequences as described in item (4) of the above item 2.

[0040] 3. an expression cassette, a recombinant vector, a VIPR1L gene-transformed cell line, a VIPR1L gene-transformed plant tissue or a VIPR1L gene-transformed plant organ containing the DNA as described in the above item 2;

[0041] The VIPR1L gene-transformed cell line includes a transgenic microbial cell line, a transgenic animal cell line or a transgenic plant cell line in which the DNA as described in the above item 2 is recombined into the genome;

[0042] The transgenic plant tissue or transgenic plant organ of the above-mentioned item 2 refers to a transgenic plant tissue or transgenic plant organ in which the DNA of the above-mentioned item 2 is recombined into the genome.

[0043] For example, the recombinant vector, the cell line, the transgenic cell line, the transgenic plant tissue or the transgenic plant organ of the expression cassette containing the nucleotide sequence shown in SEQ ID No. 2 or SEQ ID No. 192-217; or the recombinant vector, the recombinant microorganism, the transgenic cell line, the transgenic plant tissue or the transgenic plant organ of the expression cassette containing the nucleotide sequence for encoding the amino acid shown in SEQ ID No. 32-191.

[0044] 4. The recombinant vector, the cell line, the transgenic cell line, the transgenic plant tissue or the transgenic plant organ of the expression cassette of the above-mentioned item 3;

[0045] The cell line includes a microbial cell line, an animal cell line or a plant cell line.

[0046] The transgenic cell line of the above-mentioned item 2 includes a transgenic microbial cell line, a transgenic animal cell line or a transgenic plant cell line in which the DNA of the above-mentioned item 2 is recombined into the genome.

[0047] The transgenic plant tissue or transgenic plant organ of the above-mentioned item 2 refers to a transgenic plant tissue or transgenic plant organ in which the DNA of the above-mentioned item 2 is recombined into the genome.

[0048] For example, the recombinant vector, the cell line, the transgenic cell line, the transgenic plant tissue or the transgenic plant organ of the expression cassette containing the nucleotide sequence shown in SEQ ID No. 2 or SEQ ID No. 192-217; or the recombinant vector, the recombinant microorganism, the transgenic cell line, the transgenic plant tissue or the transgenic plant organ of the expression cassette containing the nucleotide sequence for encoding the amino acid shown in SEQ ID No. 32-191.

[0049] 5. The cell line, the transgenic cell line, the transgenic plant tissue or the transgenic plant organ of the recombinant vector of the above-mentioned item 3;

[0050] The cell line includes a microbial cell line, an animal cell line or a plant cell line.

[0051] The trans-VIPR1L gene cell line includes a transgenic microbial cell line, a transgenic animal cell line or a transgenic plant cell line in which the DNA of item 2 above is recombined into the genome.

[0052] The trans-VIPR1L gene plant tissue or trans-VIPR1L gene plant organ refers to a transgenic plant tissue or plant organ in which the DNA of item 2 above is recombined into the genome.

[0053] For example, a recombinant microbial cell line, a trans-VIPR1L gene cell line, a trans-VIPR1L gene plant tissue or a trans-VIPR1L gene plant organ containing a recombinant vector containing the nucleotide sequence shown in SEQ ID No. 2 or SEQ ID No. 192-217; or a recombinant microbial cell line, a trans-VIPR1L gene cell line, a trans-VIPR1L gene plant tissue or a trans-VIPR1L gene plant organ containing a recombinant vector containing a nucleotide sequence for encoding an amino acid shown in SEQ ID No. 32-191.

[0054] 6. A recombinant microbial, a trans-VIPR1L gene cell line, a trans-VIPR1L gene plant tissue or a trans-VIPR1L gene plant organ containing the recombinant vector of item 4 above;

[0055] The trans-VIPR1L gene cell line includes a transgenic microbial cell line, a transgenic animal cell line or a transgenic plant cell line in which the DNA of item 2 above is recombined into the genome.

[0056] The trans-VIPR1L gene plant tissue or trans-VIPR1L gene plant organ refers to a transgenic plant tissue or plant organ in which the DNA of item 2 above is recombined into the genome.

[0057] For example, a recombinant microbial, a trans-VIPR1L gene cell line, a trans-VIPR1L gene plant tissue or a trans-VIPR1L gene plant organ containing a recombinant vector containing an expression cassette containing the nucleotide sequence shown in SEQ ID No. 2 or SEQ ID No. 192-217; or a recombinant microbial, a trans-VIPR1L gene cell line, a trans-VIPR1L gene plant tissue or a trans-VIPR1L gene plant organ containing a recombinant vector containing an expression cassette containing a nucleotide sequence for encoding an amino acid shown in SEQ ID No. 32-191.

[0058] Particular examples of the expression cassette, the recombinant vector, the recombinant microbial, the cell line, the transgenic cell line, the transgenic plant tissue, the transgenic plant organ of items 3-6 above are as follows:

[0059] I Expression cassette (numbered E1-E7)

[0060] E1 : pET-28a (bacterial expression cassette), which is the expression cassette according to item 3, wherein the DNA comprised is a DNA according to SEQ ID No. 2 or any one of SEQ ID Nos. 192 to 217 or a nucleotide sequence coding for an amino acid according to any one of SEQ ID Nos. 32 to 191

[0061] E2: pPICZ-28a (fungal expression cassette, e.g. in yeast), which is the expression cassette according to item 3, wherein the DNA comprised is a DNA according to SEQ ID No. 2 or any one of SEQ ID Nos. 192 to 217 or a nucleotide sequence coding for an amino acid according to any one of SEQ ID Nos. 32 to 191

[0062] E3: pFastBac TM 1 (insect expression cassette), which is the expression cassette according to item 3, wherein the DNA comprised is a DNA according to SEQ ID No. 2 or any one of SEQ ID Nos. 192 to 217 or a nucleotide sequence coding for an amino acid according to any one of SEQ ID Nos. 32 to 191

[0063] E4: pCAMBIA (plant expression cassette), which is the expression cassette according to item 3, wherein the DNA comprised is a DNA according to SEQ ID No. 2 or any one of SEQ ID Nos. 192 to 217 or a nucleotide sequence coding for an amino acid according to any one of SEQ ID Nos. 32 to 191

[0064] E5: pSV (animal expression cassette), which is the expression cassette according to item 3, wherein the DNA comprised is a DNA according to SEQ ID No. 2 or any one of SEQ ID Nos. 192 to 217 or a nucleotide sequence coding for an amino acid according to any one of SEQ ID Nos. 32 to 191

[0065] E6: pcDNA3.1 V5 His (human expression cassette), which is the expression cassette according to item 3, wherein the DNA comprised is a DNA according to SEQ ID No. 2 or any one of SEQ ID Nos. 192 to 217 or a nucleotide sequence coding for an amino acid according to any one of SEQ ID Nos. 32 to 191

[0066] E7: pCX62 (expression cassette for plant & animal knockout genes), which belongs to the expression cassette of item 3, and contains DNA as shown in any one of SEQ ID No. 2 or SEQ ID No. 192-217, or a nucleotide sequence for encoding amino acids as shown in any one of SEQ ID No. 32-191

[0067] II Recombinant vectors (E8-E10)

[0068] E8: pET-28a recombinant vector, which belongs to the recombinant vector of item 3, and contains DNA as shown in any one of SEQ ID No. 2 or SEQ ID No. 192-217, or a nucleotide sequence for encoding amino acids as shown in any one of SEQ ID No. 32-191

[0069] E9: pFastBac TM 1 Recombinant vector, which belongs to the recombinant vector of item 3, and contains DNA as shown in any one of SEQ ID No. 2 or SEQ ID No. 192-217, or a nucleotide sequence for encoding amino acids as shown in any one of SEQ ID No. 32-191

[0070] E10: Recombinant vector containing any one of the expression cassettes of E1-E7, which belongs to the recombinant vector of item 4

[0071] III VIPR1L gene-transfected cell lines (E11-E17)

[0072] E11: pPICZ VIPR1L gene-transfected cell line, which belongs to the VIPR1L gene-transfected cell line of item 3, and is a yeast cell line, and contains DNA as shown in any one of SEQ ID No. 2 or SEQ ID No. 192-217, or a nucleotide sequence for encoding amino acids as shown in any one of SEQ ID No. 32-191

[0073] E12: pCAMBIA VIPR1L gene-transfected cell line, which belongs to the VIPR1L gene-transfected cell line of item 3, and is a wheat or cotton cell line, and contains DNA as shown in any one of SEQ ID No. 2 or SEQ ID No. 192-217, or a nucleotide sequence for encoding amino acids as shown in any one of SEQ ID No. 32-191

[0074] E13: pcDNA3.1 V5 His-transVIPR1L gene cell line, which is the transVIPR1L gene cell line according to item 3, wherein the DNA contained is the DNA represented by any one of SEQ ID No. 2 or SEQ ID No. 192-217, or a nucleotide sequence for encoding the amino acid represented by any one of SEQ ID No. 32-191

[0075] E14: transVIPR1L gene cell line containing the expression cassette according to any one of E1-E7, which is the transVIPR1L gene cell line according to item 4, wherein the transVIPR1L gene cell line is a HeLa cell line

[0076] E15: transVIPR1L gene cell line containing the expression cassette according to any one of E1-E7, which is the transVIPR1L gene cell line according to item 4, wherein the transVIPR1L gene cell line is a horse cell line

[0077] E16: transVIPR1L gene cell line containing the recombinant vector according to any one of E8-E9, which is the transVIPR1L gene cell line according to item 5, wherein the transVIPR1L gene cell line is a cotton cell line

[0078] E17: transVIPR1L gene cell line containing the recombinant vector according to E10, which is the transVIPR1L gene cell line according to item 6, wherein the transVIPR1L gene cell line is a yeast cell line

[0079] IV. transVIPR1L gene plant tissue (E18-E21)

[0080] E18: pCAMBIA series vector-transVIPR1L gene plant tissue, which is the transVIPR1L gene plant tissue according to item 3, wherein the transVIPR1L gene plant tissue is a cotton tissue, and wherein the DNA contained is the DNA represented by any one of SEQ ID No. 2 or SEQ ID No. 192-217, or a nucleotide sequence for encoding the amino acid represented by any one of SEQ ID No. 32-191

[0081] E19: transVIPR1L gene plant tissue containing the expression cassette according to any one of E1-E7, which is the transVIPR1L gene plant tissue according to item 4, wherein the transVIPR1L gene plant tissue is a cotton tissue,

[0082] E20: A trans-VIPRI L gene plant tissue comprising the expression vector of any one of E8-E9, according to item 5, wherein the trans-VIPRI L gene plant tissue is a cotton tissue

[0083] E21 : A trans-VIPRI L gene plant tissue comprising the expression vector of E10, according to item 6, wherein the trans-VIPRI L gene plant tissue is a cotton tissue

[0084] V. Trans-VIPRI L gene plant organs (items E22-E25)

[0085] E22: A pCAMBIA trans-VIPRI L gene plant organ, according to item 3, wherein the trans-VIPRI L gene plant organ is a cotton organ, and wherein the DNA comprised is the DNA represented by any one of SEQ ID No. 2 or SEQ ID Nos. 192-217, or a nucleotide sequence encoding the amino acid represented by any one of SEQ ID Nos. 32-191

[0086] E23: A trans-VIPRI L gene plant organ comprising the expression cassette of any one of E1-E7, according to item 4, wherein the trans-VIPRI L gene plant organ is a cotton organ

[0087] E24: A trans-VIPRI L gene plant organ comprising the expression vector of any one of E8-E9, according to item 5, wherein the trans-VIPRI L gene plant organ is a cotton organ

[0088] E25: A trans-VIPRI L gene plant organ comprising the expression vector of E10, according to item 6, wherein the trans-VIPRI L gene plant organ is a cotton organ

[0089] VI. Cell lines (items E26-E30)

[0090] E26: A cell line comprising the expression cassette of any one of E1-E7, according to item 4, wherein the cell line is a yeast cell line

[0091] E27: A cell line comprising the expression cassette of any one of E1-E7, according to item 4, wherein the cell line is a maize cell line

[0092] E28: A cell line comprising the expression cassette of any one of E1-E7, according to item 4, wherein the cell line is a rabbit cell line

[0093] E29: a cell line containing the expression cassette according to any one of E1 to E7, according to item 4, wherein the cell line is a HeLa cell line

[0094] E30: a cell line containing the recombinant vector according to any one of E8 to E9, according to item 5, wherein the transgenic cell line is a horse cell line

[0095] E30: a cell line containing the recombinant vector according to any one of E8 to E9, according to item 5, wherein the transgenic cell line is a HeLa cell line

[0096] VII Recombinant microorganism (E31)

[0097] E31: a recombinant microorganism containing the expression vector according to E10, according to item 6, wherein the recombinant microorganism is E. coli

[0098] The above examples (E1 to E31) are merely examples of the expression cassette, the recombinant vector, the recombinant microorganism, the cell line, the transgenic cell line, the transgenic plant tissue, and the transgenic plant organ according to items 3 to 6, and do not limit the expression cassette, the recombinant vector, the transgenic cell line, the transgenic plant tissue, and the transgenic plant organ according to items 3 to 6.

[0099] 7. A biological agent, comprising:

[0100] (1) a VIPR1L protein according to item 1;

[0101] For example, a biological agent comprising the amino acid sequence (VIPR1L protein) shown in SEQ ID No. 1 or SEQ ID No. 6 to 191.

[0102] (2) or a DNA according to item 2;

[0103] For example, a biological agent comprising the nucleotide sequence (DNA) shown in SEQ ID No. 2 or SEQ ID No. 192 to 217.

[0104] (3) or an expression cassette, a recombinant vector, a trans-VIPR1L gene cell line, a trans-VIPR1L gene plant tissue, or a trans-VIPR1L gene plant organ according to claim 3;

[0105] (4) or a recombinant vector, a recombinant microorganism, a trans-VIPR1L gene cell line, a trans-VIPR1L gene plant tissue, or a trans-VIPR1L gene plant organ according to claim 4;

[0106] (5) Or includes the recombinant microorganism, transgenic VIPR1L cell line, transgenic VIPR1L plant tissue or transgenic VIPR1L plant organ as described in claim 5.

[0107] (6) or includes the recombinant microorganism, transgenic VIPR1L cell line, transgenic VIPR1L plant tissue or transgenic VIPR1L plant organ as described in claim 6.

[0108] For example, biological agents containing any of the expression cassettes, recombinant vectors, recombinant microorganisms, cell lines, transgenic cell lines, transgenic plant tissues, or transgenic plant organs described in items 3-6 above.

[0109] 8. A biological agent, characterized in that: the biological agent is composed of a mixture of the VIPR1L protein and VDAL protein according to claim 1, wherein the mass ratio of the VIPR1L protein to the VDAL protein is 5-10:8.

[0110] 9. The application of the biological agent as described in item 7 or 8 above, characterized in that the biological agent can be used to promote plant growth, improve plant disease resistance, improve plant salt tolerance, improve biological drought resistance, increase crop yield, improve crop quality, and preserve fruits and vegetables.

[0111] The beneficial effects of the VIPR1L protein and its application in biopesticides and biobreeding described in this invention are as follows:

[0112] The VIPR1L protein, a plant protein with an unknown function, is composed of 130 amino acids. This protein participates in plant disease resistance; it improves the germination of wheat and corn and promotes plant growth; it can induce drought resistance, salt tolerance, and disease resistance in plants; it increases chlorophyll content, thereby increasing the yield of grains such as corn and wheat, as well as vegetables, fruits, and tea; it increases the content of tea polyphenols, improves the flavor of tomatoes, and enhances the quality of fruits, vegetables, and tea; and it has a remarkably significant preservation effect on fruits and vegetables.

[0113] In addition, the VIPR1L protein, VDAL and its receptor RKL1 constitute a protein complex that mediates the signal transduction of disease / stress signals, thereby regulating plant growth and development or immune or stress response.

[0114] Overexpression of the VIPR1L gene in plants can enhance plant resistance to Verticillium wilt. VIPR1L protein can be developed into a dry powder product for the development of biochemical pesticides, showing promising application prospects in improving crop disease resistance, stress resistance, yield, and the production of green and flavorful fruits and vegetables. Attached Figure Description

[0115] The present invention includes the following figures:

[0116] Figure 1 Coding sequence of GbVIPR1L protein and its conserved domains.

[0117] Figure 2 Statistical results of GbVIPR1L gene expression levels before and after the GbVIPR1L protein treatment of Verticillium dahliae in Example 1.

[0118] Figure 3 Experimental results of the Vd991 strain inoculation by stem injection method in Example 1.

[0119] Figure 4 Experimental results of the VIPR1L mechanism research in Example 2.

[0120] Figure 5 Experimental results of the VIPR1L mechanism research in Example 2.

[0121] Figure 6 VIPR1L crude protein prepared in Example 3 and Western-blot detection results.

[0122] Figure 7 Experimental results of the VIPR1L protein treatment of wheat seeds followed by water loss treatment and rehydration treatment after water loss in Example 3: (a) plant height statistics on the first day of sowing; (b) plant height statistics after one week of sowing; (c) photos of some treatment groups after one week of sowing; (d) experimental results of water loss and rehydration.

[0123] Figure 8 Results of the VIPR1L protein treatment to improve the germination rate of corn seeds in Example 3.

[0124] Figure 9 Results of the VIPR1L protein treatment to promote corn growth in Example 3.

[0125] Figure 10 Promotion of corn plant height, leaf width, and chlorophyll by the VIPR1L protein treatment in Example 3.

[0126] Figure 11 Effects of the VIPR1L protein exogenous treatment on corn water loss, rehydration, and the like in Example 3.

[0127] Figure 12 Effects of the VIPR1L protein exogenous treatment to improve the salt resistance of corn in Example 3.

[0128] Figure 13 Effects of the VIPR1L protein exogenous spraying to promote corn growth, disease resistance, and yield increase in field experiments in Example 3.

[0129] Figure 14 Effects of the VIPR1L protein exogenous treatment to increase tomato yield and prevent early decline in Example 3.

[0130] Figure 15 Effect of VIPR1L protein treatment on the yield of Camellia sinensis cv. 'English Red No. 9' in Example 3: (a) Fresh leaf yield after 15 days of treatment; (b) Fresh leaf yield after 25 days of treatment.

[0131] Figure 16 Effect of VIPR1L protein treatment on the shoot density and 100- shoot weight of Camellia sinensis cv. 'English Red No. 9' in Example 3: (a) Shoot density; (b) 100- shoot weight.

[0132] Figure 17 Effect of VIPR1L protein treatment on the total polyphenol content of fresh leaves of Camellia sinensis cv. 'English Red No. 9' in Example 3.

[0133] Figure 18 Effect of VIPR1L protein treatment on the total free amino acid content of fresh leaves of Camellia sinensis cv. 'English Red No. 9' in Example 3.

[0134] Figure 19 Effect of VIPR1L protein treatment on the content of catechins and alkaloids in Example 3: GA: Gallic acid; GC: Gallo catechin; EGC: Epigallocatechin; C: Catechin; CAF: Caffeine; EC: Epicatechin; EGCG: Epigallocatechin gallate; ECG: Epicatechin gallate; CG: Catechin gallate (all data are triplicates, different letters represent significance).

[0135] Figure 20 Effect of VIPR1L protein treatment on the preservation of blueberries in Example 3: Compared with the control, VIPR1L3 had the best preservation effect on blueberries, with a rot index 33.3% lower than that of the control CK and 23.3% lower than that of the preservative on the 11th day, and 4.2% lower than that of the control CK and the preservative on the 31st day; followed by VDP33, with a rot index 2.5% lower than that of the control CK and the preservative on the 31st day. Figure legend: The upper graph shows the preservation results of blueberries on the 11th day and the 31st day. (All data are triplicates) DETAILED DESCRIPTION

[0136] The application will be further described in conjunction with the accompanying drawings. The examples given are only to illustrate the application, and are not intended to limit the scope of the application. The examples provided below can serve as a guide for further improvement by those of ordinary skill in the art, and do not in any way constitute a limitation on the application.

[0137] In the following examples, the experimental methods are conventional methods, and are performed according to the techniques or conditions described in the literature in the art or according to the product instructions, unless otherwise specified. The materials, reagents, etc. used in the following examples can be obtained commercially, unless otherwise specified.

[0138] The nucleotide sequence of the following GbVIPR1L gene is shown as SEQ ID No. 2, which is derived from Gossypium barbadense Linn. Chromosome 4. The amino acid sequence of the VIPR1L protein encoded by the GbVIPR1L gene is shown as SEQ ID No. 1, and the cDNA sequence thereof is shown as SEQ ID No. 2. The GbVIPR1L gene is induced in response to VDAL and Verticillium dahliae in cotton.

[0139] The VIPR1L protein coding and its conserved domain are shown as Figure 1 wherein Figure 1 A is the VIPR1L protein coding, Figure 1 B is the VIPR1L protein conserved domain.

[0140] Example 1 Research on the function of GbVIPR1L gene (anti-Verticillium wilt)

[0141] 1. Preparation of TRV::VIPR1L plants and TRV::GFP plants

[0142] (1) The GbVIPRIL gene (the sequence is shown as SEQ ID No. 2) is constructed into a TRV vector and transformed into Agrobacterium, and the successfully transformed strain is named TRV::GbVIPRIL. The plasmids pTRV-GFP, pTRV-GhCLA1 and pTRV-RNA1 are respectively transformed into Agrobacterium, and the successfully transformed strains are respectively named TRV::GFP, TRV::CLA1 and TRV::RNA1.

[0143] (2) The TRV::GbVIPRIL / GFP / CLA1 / RNA1 is activated on R+K resistant solid medium, and is cultured at 28°C for 1-2 days under inversion.

[0144] (3) Small-scale shaking culture: the above activated single colony cells are picked and cultured in 2-3 ml YEP liquid medium containing R+K resistance at 28°C, 220 rpm shaking culture overnight, and a plastic bag is wrapped outside the test tube to prevent contamination.

[0145] (4) Large-scale inoculation: 100 μl of kanamycin mother liquor, 100 μl of rifampicin antibiotic mother liquor, 10 μl of 200 mM As, 1 ml of 0.5 mM MES, and 1 ml of small-scale shaking culture liquid are gradually added to 100 ml of YEP medium in the above order, and the mixture is cultured at 220 rpm and 28°C for 12 h, and a newspaper is wrapped around the conical flask mouth to prevent contamination.

[0146] (5) Collecting bacteria: Dispense 100ml of the bacterial solution obtained in step (4) into two 50ml centrifuge tubes, centrifuge at 6000rpm for 8min at room temperature to collect the bacterial cells, add a small amount of resuspension, mix well by pipetting, add about 40ml of resuspension, measure the bacterial concentration, and continuously dilute until the OD value of the bacterial solution reaches about 1.5.

[0147] (6) Mix the TRV::RNA1 obtained in step (5) with the other bacterial cultures (TRV::GbVIPRIL / GFP / CLA1) obtained in step (5) at a volume ratio of 1:1, invert the mixture back and forth until homogeneous, wrap it in a black plastic bag and place it at room temperature in the dark for 3 hours to obtain a mixed bacterial culture of GbVIPRIL, GFP and CLA1.

[0148] (7) Seedlings of upland cotton variety Xinluzao 48 were transplanted about one week after sowing, leaving 3 seedlings in each pot. After about two weeks of growth, when the cotton cotyledons unfolded but the true leaves had not yet grown, a wound was made on the back of the leaf with a needle for injection until both cotyledons were fully immersed in a mixed bacterial solution of GbVIPRIL, GFP, or CLA1. The seedlings were then bagged and kept in the dark for 24 hours before the bags were removed. After inoculation, the seedlings were placed in a 25°C greenhouse for 16 hours of light followed by 8 hours of darkness for cultivation. Two pots of seedlings were injected for each treatment, with three replicates.

[0149] (8) Approximately 10-14 days later, the cotton true leaves emerged and unfolded. The true leaves of cotton seedlings injected with CLA1 showed an albino phenotype, confirming the success of the VIGS silencing treatment. Plants successfully silenced by injection of the mixed bacterial solution GbVIPRIL were named TRV::GbVIPR1L, plants successfully silenced by injection of the mixed bacterial solution GFP were named TRV::GFP, and plants successfully silenced by injection of the mixed bacterial solution CLA1 were named TRV::CLA1.

[0150] Expression levels were detected in silent plants, and silencing efficiency was statistically analyzed.

[0151] The reagents used above are prepared using the following methods:

[0152] 200mM As: Weigh 0.7848g of solid As, dissolve it in 20ml of DMSO, filter to remove bacteria, and dispense into sterilized 1.5ml centrifuge tubes for later use.

[0153] 0.5M MES: Weigh 10.66g of solid MES, dissolve it in 100ml ddH2O, adjust the pH to 5.6 with KOH, filter to sterilize, and dispense into sterilized 5ml centrifuge tubes for later use.

[0154] 2M MgCl2: Weigh 20.33g of solid MgCl2, dissolve it in 50ml of ddH2O, and autoclave at 121℃ for 15min.

[0155] YEP medium (1 L): yeast powder 10 g, peptone 10 g, NaCl 5 g, distilled water to 1 L, solid medium add 12 g agar powder, sterilize at 121 °C for 15 min;

[0156] R+K resistant solid medium: add 100 μL of kanamycin and rifampicin mother liquor to each 100 ml YEP solid medium, mix well and pour the plate.

[0157] Kanamycin antibiotic mother liquor (50 mg / ml): 2.5 g of kanamycin sulfate (Kan) powder was dissolved in 50 ml of ultrapure water, sterilized by filtration, and then 1 ml / tube was aliquoted into sterilized centrifuge tubes for standby.

[0158] Rifampicin antibiotic mother liquor (25 mg / ml): 2.5 g of rifampicin (Rif) was dissolved in 100 ml of methanol, sterilized by filtration, and then 1 ml / tube was aliquoted into sterilized centrifuge tubes for standby.

[0159] The resuspension solution formula is shown in Table 1.

[0160] Table 1 Resuspension solution formula

[0161]

[0162] 2. Inoculation of Verticillium wilt

[0163] (1) After the appearance of the silent phenotype of the above cotton plants (CLA1 appears white phenotype), the total RNA of TRV::GFP / GbVIPR1L cotton plants was extracted, and the GbVIPR1L silencing level was detected by quantitative PCR.

[0164] The primers used are GhVIPR1L-RT-F: AGCCAAGGTTTCTAGCTTGGAG; GhVIPR1L-RT-R: GAAGGCTATCCGGCTTGTCATT.

[0165] (2) Activate Vd991 strain on PDA medium.

[0166] (3) Observe the growth of Vd991 strain after 10 days, if there are white mycelial patches, it means that the growth state is good. First add a small amount of ddH2O to the plate, pick up the mycelium with a gun head, filter it with gauze into a conical flask, then add about 100 ml of ddH2O for dilution, dilute it to 10x, 100x spore solution, count with a hemocytometer, to a spore concentration of 2x106-3x106cfu / ml, prepare and use immediately.

[0167] (4) Use a 1ml syringe to draw up the above-mentioned Verticillium spore liquid and inject it into the cotton plant after the silent phenotype has appeared through the cotton stem.

[0168] (5) About three weeks later, the cotton plants showed the phenotype of Verticillium wilt (yellowing of leaf edges, wilting, and drooping). The disease incidence of cotton was observed, and the incidence and disease index of TRV::GFP and TRV::GbVIPR1L were counted according to Table 2. Photos were taken and recorded.

[0169] Table 2. Cotton Disease Grading Standards

[0170]

[0171] Disease index = [∑(number of diseased plants at each level × disease level value) / (total number of plants surveyed × 4)] × 100

[0172] Root dipping method:

[0173] (1) When inoculating, use TRV::GbVIPR1L plant material treated with VIGS as described above, and inoculate when the two true leaves have expanded.

[0174] (2) Treatment of Verticillium wilt with root-cutting dip method: First dilute to 2×10 6 ~3×10 6 Pour the cfu / ml *Variegata* spore solution into a 50ml centrifuge tube. Then, remove the cotton from the bottom of the plastic pot, rinse it with distilled water, and place it into the centrifuge tube. Incubate at 25℃ in a greenhouse with light for 16 hours and in the dark for 8 hours.

[0175] (3) Samples were taken before and 1, 2, 3, 4 and 5 days after the root dip treatment with Verticillium wilt. RNA was extracted and reverse transcribed into cDNA. The expression level of GbVIPR1L was detected by quantitative PCR.

[0176] The primers used were GhVIPR1L-RT-F: AGCCAAGGTTTCTAGCTTGGAG and GhVIPR1L-RT-R: GAAGGCTATCCGGCTTGTCATT.

[0177] The results are as follows Figure 2 As shown, CK represents the GbVIPR1L expression level of cotton plants before Verticillium wilt root dipping treatment, and Vd991-1D, Vd991-2D, Vd991-3D, Vd991-4D, and Vd991-5D represent the GbVIPR1L expression levels of cotton plants 1, 2, 3, 4, and 5 days after Verticillium wilt root dipping treatment, respectively. This indicates that soaking cotton roots in Verticillium wilt significantly upregulated the GbVIPR1L gene expression level within one day, and gradually decreased after two days.

[0178] The results of stem injection method for inoculating Vd991 strain are shown in Figure 3 , Figure 3 The upper left graph in A is the disease condition of TRV::GFP cotton plants after inoculation, and the upper right graph is the disease condition of TRV::GbVIPR1L cotton plants after inoculation. Figure 3 The lower graph in A is the difference in leaf phenotype, compared with the TRV::GFP plant (TRV::00) plant and leaf, the TRV::GbVIPR1L plant (TRV::GbVIPR1L) plant has severe disease, and the leaf turns yellow and withers.

[0179] Figure 3 B is the relative expression level of GbVIPR1L gene silenced by VIGS technology, compared with the TRV::GFP plant (TRV::00), the relative expression level of GbVIPR1L gene of the TRV::GbVIPR1L plant (TRV::GbVIPR1L) is reduced.

[0180] Figure 3 C is the disease index statistics of VIPR1L-VIGS plants and control GFP-VIGS, compared with the TRV::GFP plant (TRV::00), the disease index of the TRV::GbVIPR1L plant (TRV::GbVIPR1L) is increased. The silencing of GbVIPR1L gene in Gossypium hirsutum L. Xinluzao 48 by VIGS shows that the TRV::GbVIPR1L plant has early and severe disease under the condition of Verticillium wilt inoculation, most of the leaves turn yellow, wither and fall off, while the control TRV::GFP plant only has partial leaf yellowing, with mild disease, and the withering and falling off phenotype almost does not exist, so the RNA interference GbVIPR1L gene cotton plant is more susceptible to Verticillium wilt than the wild type, and the RNAi plant is more susceptible to Verticillium wilt, and it is preliminarily speculated that the gene is involved in the Verticillium wilt resistance process of cotton.

[0181] Example 2 Study on the mechanism of VIPR1L

[0182] 1. Yeast double-hybrid experiment

[0183] (1) The target gene and the gene to be verified for interaction are respectively constructed into AD

[0184] (pGADT7) and BD (pGBKT7) vectors, and transformed into golden PLUS yeast strain.

[0185] (2) The yeast strain stored at -80°C is streaked on YPDA to restore its activity, and incubated in an incubator (28°C) for 3 days.

[0186] (3) Select 2-3 fresh single clones, use 3-4 ml of liquid YPDA medium to shake the bacteria in a small amount, and incubate overnight at 28℃ and 220 rpm on a shaker.

[0187] (4) Transfer the above bacterial culture to 100ml YPDA liquid culture medium and incubate at 28℃ and 220rpm for 3-5h. The OD value should be between 0.5 and 0.6.

[0188] Bacteria collection:

[0189] (5) Transfer the bacterial culture to a 50ml centrifuge tube, balance the liquid, and centrifuge at 2500rpm for 5min at room temperature to collect the bacteria. Discard the supernatant. (At this time, the ssDNA can be boiled at 900w for 20min and immediately placed on ice.)

[0190] (6) First, resuspend the two tubes of bacterial solution with a small amount of ddH2O, then combine them into one tube, bring the volume to 50ml with ddH2O, centrifuge at 2500r / 5min at room temperature to collect the bacteria, and discard the supernatant.

[0191] Suspended bacteria:

[0192] (7) Prepare competent yeast cells by resuspending the bacterial cells in 1xTE / LiAc (calculate the required volume first). The formula is 10xTE:10xLiAc:ddH2O = 1:1:8 (100 μl is needed for one reaction).

[0193] Transformation

[0194] (8) Beforehand, aspirate 300 ng of AD and BD vector plasmids into 1.5 ml sterilized centrifuge tubes and add 10 μl sDNA and mix well.

[0195] (9) Add 100 μl of competent yeast cells to the above mixed plasmid and mix by pipetting.

[0196] (10) After mixing 50% PEG: 10xTE: 10xLiAc = 8:1:1, add 600 μl to the system in step (9) above and gently mix.

[0197] Resumption of cultivation

[0198] (11) Restore culture at 30℃ and 200rpm for 30min, while turning on the 42℃ water bath.

[0199] (12) Add 70 μl DMSO to the above system, gently mix, heat in a 42°C water bath for 15 min, and immediately place on ice for 5 min.

[0200] (13)Centrifuge at room temperature 12000rpm for 1 min to collect the bacteria, then pipette the supernatant with sterilized blue tip, resuspend the bacteria with 50μl 1xTE (10xTE:ddH2O=1:9), then spread on 2D solid medium, and incubate at 30°C for 2-3 days.

[0201] (14)Pick the single colony on 2D medium, resuspend with 100μl ddH2O, mix well, then dilute with ddH2O for 10 times and 100 times, respectively, and drop 6μl on 2D and 4D medium, and incubate at 28°C for 3 days, then observe the growth of the yeast. If the yeast grows normally on 4D medium but not on the negative control, it means that the two proteins may interact with each other.

[0202] 2. Luciferase Complementation Assay (LCI)

[0203] The luciferase gene is divided into two parts, and each part is connected to the pCAMBIA vector, i.e. N-LUC and C-LUC. The target gene is constructed in these two vectors, and then injected into tobacco for transient expression in tobacco. If the two proteins interact with each other, they will approach each other, so that N-LUC and C-LUC re-form luciferase, which will produce luminescence when encountering the substrate.

[0204] (1) Construct the target gene to be detected into N-LUC and C-LUC vectors, and transform into Agrobacterium.

[0205] (2) Streak the strain on solid medium containing only rifampicin resistance, and incubate at 28°C in an incubator for 48h to recover activity (in addition, P19, N-LUC, and C-LUC also need to be activated). P19 can inhibit gene silencing.

[0206] (3) Pick single colony of Agrobacterium, and use 2-3ml YEB liquid medium containing R+K resistance to culture overnight at 28°C, 220rpm in a shaker.

[0207] (4) Measure the OD value between 0.3 and 0.6, and calculate the required volume of bacterial solution.

[0208] V = 1 / OD600

[0209] V(P19) = 0.6 / OD600

[0210] (5) The two bacterial liquids to be verified for possible interaction are mixed in a 2 ml centrifuge tube according to the calculated volume, and the corresponding volume of P19 is added. The bacteria are collected by centrifugation at 12000 rpm at room temperature for 1 min. The supernatant is discarded, and the remaining liquid is poured onto a water-absorbing paper. 1 ml of resuspension is added to the centrifuge tube, mixed by blowing, and then 1 ml of resuspension is added and mixed by inversion. The mixture is placed at room temperature in the dark for more than 2 h, and then injected onto a one-month-old tobacco leaf from the back.

[0211] (6) After 2-3 days of culture, the tobacco leaf is cut into a whole piece and attached to a white paper. The LUC substrate after ice bath is sprayed, and the CDD imaging system is used to observe the luminescence. If the experimental group and the positive control emit light but the negative control does not emit light, the interaction is verified.

[0212] The composition of the LUC / BIFC resuspension is shown in Table 3.

[0213] Table 3 Composition of LUC / BIFC resuspension

[0214]

[0215] 3. Bi-molecular fluorescence complementation experiment

[0216] (1) The target gene to be detected is constructed into YNE and YCE vectors and transformed into Agrobacterium.

[0217] (2) The bacterial strain is streaked on solid medium containing only rifampicin resistance and incubated at 28°C in an incubator for 48 h to recover activity (in addition, P19, GUS-YNE, and GUS-YCE also need to be activated). P19 can inhibit gene silencing.

[0218] (3) Single colony of Agrobacterium is picked and cultured in 2-3 ml of YEB liquid medium containing R+K resistance at 28°C and 220 rpm on a shaker overnight

[0219] (4) The OD value is measured to be between 0.3 and 0.6, and the required volume of bacterial liquid is calculated

[0220] V = 1 / OD600

[0221] V(P19) = 0.6 / OD600

[0222] (5) The two bacterial liquids to be verified for possible interaction are mixed in a 2 ml centrifuge tube according to the calculated volume, and the corresponding volume of P19 is added. The bacteria are collected by centrifugation at 12000 rpm at room temperature for 1 min. The supernatant is discarded, and the remaining liquid is poured onto a water-absorbing paper. 1 ml of resuspension is added to the centrifuge tube, mixed by blowing, and then 1 ml of resuspension is added and mixed by inversion. The mixture is placed at room temperature in the dark for more than 2 h, and then injected onto a one-month-old tobacco leaf from the back.

[0223] (6) After 2-3 days of culture, small pieces of tobacco leaves are cut to make a sample, and a confocal microscope is used to observe the luminescence. If the cells in the experimental group emit light but the negative control cells do not, the interaction is verified.

[0224] The objective gene is GbVIPR1L gene, and the gene to be verified for possible interaction is VDAL gene (nucleotide sequence is shown in SEQ ID No. 4). Yeast two-hybrid, firefly luciferase complementation and bi-molecular fluorescence complementation experiments are performed, and the experimental results are shown in Figure 4 The results prove that GbVIPR1L protein directly interacts with VDAL. In Figure 4 , A is the yeast two-hybrid experiment of VIPR1L and VDAL: this figure proves that the two directly interact in the yeast cell, because the yeast can grow normally on the medium lacking Leu, Trp, His and Ade in the presence of the two. B is the firefly luciferase complementation experiment, which proves that VIPR1L interacts with VDAL, so that the left upper corner of the figure emits similar fluorescence to the right upper corner positive control under the irradiation of ultraviolet light. C is the green fluorescent protein complementation experiment, which further proves that the two proteins directly interact.

[0225] The objective gene is GbVIPR1L gene, and the gene to be verified for possible interaction is RKL1 gene (sequence is shown in SEQ ID No. 5). Yeast two-hybrid, firefly luciferase complementation and bi-molecular fluorescence complementation experiments are performed, and the experimental results are shown in Figure 5 The results prove that GbVIPR1L protein directly interacts with RKL1. RKL1 is a leucine-rich repeat receptor-like kinase, which forms a dynamic complex with a receptor kinase by recognizing pathogen-associated pattern molecules, thereby triggering downstream defense responses.

[0226] Figure 5 A is the firefly luciferase complementation experiment, which proves that VIPR1L 49-109 interacts with VDAL, and then proves that the minimum peptide segment is VIPR1L 50-114 interacts with VDAL, so that the left upper corner of the figure emits similar fluorescence to the right upper corner positive control under the irradiation of ultraviolet light. B is the green fluorescent protein complementation experiment (left lower corner), which further proves that the two proteins directly interact. It is thus believed that GbVIPR1L gene plays an important role in the signal transduction process of cotton resistance to Verticillium wilt, and VIPR1L 49-109 is the core sequence of the gene.

[0227] Example 3: VIPR1L protein treatment of plants

[0228] In this embodiment, all the contents related to VIPR1L protein are exemplified by the VIPR1L protein shown in SEQ ID No. 1, unless otherwise specified.

[0229] 1. Preparation of VIPR1L protein

[0230] (1) The GbVIPR1L gene (the sequence is shown in SEQ ID No. 2) is used to replace the small sequence between the Ncol and Sail recognition sites of the His vector, and the other sequences of the His vector are kept unchanged to obtain a recombinant vector, which is named as HIS-GbVIPR1L. The recombinant vector HIS-GbVIPR1L expresses the protein VIPR1L-His, which is the VIPR1L protein with 6 His tags (the sequence is shown in SEQ ID No. 18) added to the carboxyl terminal.

[0231] The GbVIPR1L gene (the sequence is shown in SEQ ID No. 2) is used to replace the small sequence between the BamHI and Sail recognition sites of the GST vector, and the other sequences of the GST vector are kept unchanged to obtain a recombinant vector, which is named as GST-GbVIPR1L. The recombinant vector GST-GbVIPR1L expresses the protein VIPR1L-GST, which is the VIPR1L protein with a GST tag added to the carboxyl terminal.

[0232] The recombinant vector HIS-GbVIPR1L and the recombinant vector GST-GbVIPR1L are transformed into Pichia pastoris strains, respectively.

[0233] (2) The transformed strain stored at -80°C is streaked on a solid LB medium containing Kanamycin / ampicillin resistance, and is allowed to recover activity and is cultured in an incubator (37°C) for 1 day. Two to three fresh single colonies are picked, and the corresponding liquid LB is cultured at 37°C in a 220 rpm shaker for overnight to obtain a small amount of shaking culture.

[0234] (3) The small amount of shaking culture is transferred to 300 ml of the corresponding liquid LB (LB + 100 μg / ml Amp liquid medium (the LB + 100 μg / ml Amp liquid medium is a liquid medium obtained by adding ampicillin to the LB liquid medium, and the content of ampicillin in the LB + 100 μg / ml Amp liquid medium is 100 μg / ml)), and is cultured at 37°C in a 220 rpm shaker for about 3 h to control the OD value between 0.8-1 to obtain the pre-induction culture.

[0235] (4) After 1 ml of the bacteria solution before induction is taken in the super-clean table, 0.65 mM IPTG is added, and the bacteria are induced overnight at 22°C and 110 rpm (HIS-GbVIPR1L) and at 30°C and 110 rpm (GST-GbVIPR1L) in a shaker to obtain the bacteria solution after induction.

[0236] (5) 1 ml of the bacteria solution after induction is taken, and the bacteria are collected in a 500 ml centrifuge tube (centrifuged at 6000 rpm in a 4°C high-speed centrifuge for 10 min, and the supernatant is discarded).

[0237] (6) A small amount of Lys (HIS-GbVIPR1L) / PBS (GST-GbVIPR1L) is added, the bacteria solution is completely resuspended by blowing with a pipette, and the bacteria solution is transferred to a 50 ml centrifuge tube, and the volume is adjusted to 30 ml with the corresponding buffer. Then, the bacteria solution is transferred to a 50 ml beaker, and the beaker is placed in an ice-water mixture, and the bacteria are broken by ultrasonic treatment at 4°C for 20 min (the power is not greater than 40%). After the ultrasonic treatment is completed, the bacteria solution is poured back into the original 50 ml centrifuge tube, and the volume is adjusted at 4°C in a centrifuge at 7500 rpm for 30 min. The supernatant is filtered with gauze into a new 50 ml centrifuge tube. A certain amount of beads is taken in advance using a sheared import gun head, and 100 μl of HIS beads (HIS-GbVIPR1L) / GST beads (GST-GbVIPR1L) is added according to the calculation of the amount of supernatant required per tube (the beads are washed as follows: 1 ml of buffer is added to the beads, and the beads are gently popped up with the finger pulp, and the beads are placed in a 4°C refrigerator and rotated for 5 min. After taking out, the beads are centrifuged at 3000 rpm in a 4°C centrifuge for 3 min, and the supernatant is removed. The above steps are repeated 3 times to completely wash the beads. Then, 100 μl of the washed beads is added to the supernatant, and the beads are combined with the protein by rotating in a 4°C refrigerator for more than 2 h.

[0238] (7) The beads are centrifuged at 3000 rpm in a 4°C centrifuge for 3 min, and the supernatant is discarded. A small amount of resuspension liquid is added to suspend the beads, and the beads are transferred to a 1.5 ml centrifuge tube using a sheared blue gun head.

[0239] (8) The beads are washed 3 times according to the above method.

[0240] (9) 200 μl of imidazole / GSH is added to the beads obtained in the final centrifugation of step (8), and the beads are combined with the protein by rotating in a 4°C refrigerator for 20 min. The beads are centrifuged at 3000 rpm in a 4°C centrifuge for 3 min, and 200 μl of the supernatant is transferred to a 1.5 ml centrifuge tube. The supernatant is the eluted protein VIPR1L-His and VIPR1L-GST.

[0241] The bacterial cells obtained in step (5) above were broken, high-temperature dehumidified, and spray dried to obtain crude VIPR1L-His protein and crude VIPR1L-GST protein, respectively. The crude proteins were stored at -20°C. Figure 6 The VIPR1L-His crude protein was detected by the following detection method, and the content of VIPR1L protein in the crude protein was 12.5%.

[0242] Protein detection method:

[0243] 0.01 g of protein dry powder was dissolved in 2 ml of ddH2O, and the bovine serum protein was diluted to 1 mg / ml of protein standard solution. Then, 0, 1, 2, 3, 4, 5, 6, and 7 μl of the protein standard solution were added to the first to eighth standard wells of the 96-well plate, respectively, and 1 μl of the sample to be tested was added to the other sample wells. PBS was added to a constant volume of 200 μl. The protein concentration was determined by an enzyme marker. The total protein content in the protein dry powder was obtained by the total protein content in the protein dry powder = protein concentration x sample volume / dry powder mass.

[0244] The VIPR1L protein was detected by Western-blot method, and the primary antibody was Anti-His Tag Mouse. The results are shown in the right side of the figure. Figure 6 The right side of the figure shows the results, in which lane CK is CFP-His protein dry powder, lane VIPR1 is VIPR1L-His protein dry powder, and lane M is Marker.

[0245] 2. Preparation of VDAL protein and VDAL-HIS mother liquor

[0246] The VDAL protein and VDAL-HIS mother liquor were purchased from Beijing Zhijie Sifang Co., Ltd. (Application Effect of New Plant Immune Activating Protein VDAL on Green Cabbage, Hebei Agricultural Science, 2021, 108(2)2, 77-82), which was prepared by the company according to the following method:

[0247] (1) Construction of recombinant vector and recombinant bacteria

[0248] The DNA molecule shown in SEQ ID No. 4, i.e., the VdAL gene, was artificially synthesized. The sequence between the NdeI and KpnI recognition sites of the vector pET42a(+) (product of Beijing Biorange Blue Biotechnology Co., Ltd.) was replaced with the DNA molecule shown in SEQ ID No. 5 (i.e., the VdAL gene), and the other sequences of pET42a(+) were kept unchanged to obtain a recombinant vector, which was named pET42a-VdAL. The recombinant vector pET42a-VdAL expressed the protein VdAL shown in SEQ ID No. 3.

[0249] SEQ ID No. 4 consists of 894 nucleotides, and encodes the amino acid sequence shown in SEQ ID No. 3.

[0250] The pET42a-VdAL was introduced into Agrobacterium tumefaciens E. coli JM109 to obtain a recombinant bacterium, and the obtained recombinant bacterium was named JM109-pET42a-VdAL. The JM109-pET42a-VdAL expressed the protein shown in SEQ ID No. 3.

[0251] The recombinant microorganism culture step is as follows:

[0252] Step 1, double enzyme digestion of the PCR product of VIPR1L:

[0253] The PCR product of the VIPR1L open reading frame sequence containing NcoI at 5' and HindIII at 3' was directly double-digested with NcoI and HindIII to make the VIPR1L sequence with sticky ends;

[0254] The enzyme digestion system is as follows:

[0255]

[0256] Expansion strain: DH5α, preserved in the laboratory (purchased from BioVector Plasmid Vector Strain Cell Protein Antibody Gene Preservation Center)

[0257] Prokaryotic expression strain: BL21, produced by BoBai TeKe Company

[0258] Step 2, double enzyme digestion of pET-28a vector:

[0259] The pET-28a plasmid was double-digested with NcoI and HindIII, electrophoresed and the linear carrier with sticky ends was recovered;

[0260] The pET-28a plasmid was purchased from BioVector Plasmid Vector Strain Cell Protein Antibody Gene Preservation Center

[0261] Step 3, connection of pET-28a vector and target fragment:

[0262] The pET-28a large carrier containing NcoI and HindIII enzyme digestion sites and the VIPR1L target fragment were connected with T4 ligase at 4°C for 72h.

[0263] The connection system is as follows:

[0264]

[0265] Step 4, transformation of pET-28a-VIPR1L into BL21:

[0266] The transformed DH5α E. coli was first transformed, and the plasmid pET-28a-VIPR1L was extracted from the identified positive strain, and then the BL21 expression strain was transformed by the competent transformation step of Betek Company to obtain the BL21 expression strain containing the pET-28a-VIPR1L plasmid.

[0267] Step 5, detection of prokaryotic expression amount

[0268] The BL21 expression strain containing the pET-28a-VIPR1L plasmid was picked and induced for expression of VIPR1L by IPTG according to the method of prokaryotic expression in the third edition of Molecular Cloning Experiment Guide, with BL21 containing only pET-28a empty plasmid as a control. From 1 to 16 hours after induction, samples were taken every hour, and the expression product was detected by 6% PAGE.

[0269] (2) Preparation of VDAL protein

[0270] The JM109-pET42a-VdAL was fermented at 37°C to an OD value of 0.6 to obtain a pre-fermentation solution, IPTG was added to the pre-fermentation solution to obtain an induction solution, and the concentration of IPTG was 1 mM. The induction solution was fermented at 25°C for 6 hours to obtain a fermentation solution. The fermentation solution was centrifuged, and the supernatant was discarded. The obtained bacterial pellet was crushed, the bacterial pellet was resuspended with lysis Buffer (HIS), PMSF (1%) was added and mixed, the bacterial cells were fully lysed by ultrasonic crushing, and the bacterial cells were centrifuged at 4°C and 7000 rpm for 30 min. The supernatant was transferred to a new tube. After equilibrating the beads, 200 μl of beads were added to the supernatant, and the beads were combined at 4°C for 3 hours. The beads were centrifuged at 4°C and 3000 rpm for 3 min, and the beads were eluted 3 times to wash away the impurities with weak binding force. The target protein was eluted by adding 500 μl of HIS tag eluent (imidazole eluent), and the elution was performed at 4°C for 20 min. The elution was centrifuged at 4°C and 3000 rpm for 3 min, and the supernatant was obtained, which was the purified VDAL protein. The concentration was measured, and the purified VDAL protein was stored at -80°C.

[0271] (3) Preparation of VDAL-HIS mother liquor

[0272] The VDAL-HIS mother liquor had a concentration of 40 ppm and was prepared by dissolving VDAL-HIS in ddH2O. VDAL-HIS is a carboxyl terminal of VDAL protein connected with 3 His tags prepared in step (2) above.

[0273] 3. Effect of VIPR1L protein treatment on wheat seed on wheat growth and drought resistance

[0274] Mother liquor configuration:

[0275] VIPR1L-His protein (sequence as shown in SEQ ID NO. 18) mother liquor (100 ppm): 70 μl of eluted protein VIPR1L-His (5 mg / ml) prepared according to the content described in Item 1 of this Example was taken into a 5 ml centrifuge tube, and ddH2O was added to 3.5 ml.

[0276] GFP-HIS (10 ppm): 1.25 μl of purified GFP-HIS (40 mg / ml) was taken into a 5 ml centrifuge tube, and ddH2O was added to 5 ml.

[0277] The GFP-HIS protein was prepared as follows:

[0278] GFP (GenBank: AMQ45836.1) was constructed in a prokaryotic expression vector pET28a (His) to form a recombinant plasmid which was transformed into E. coli BL21; a single colony with correct sequence was selected and inoculated into a small amount of bacteria which was shaken at 37°C, 220 rpm for 8-12 h; 6 ml of the bacterial liquid was added into 300 ml of LB, which was shaken at 37°C, 220 rpm for 2 h to measure OD600 value; when OD600 was about 0.8-1.2, 1 ml was taken out as pre-induction, and the remaining bacterial liquid was added with 150 μl of IPTG, which was induced at 16°C, 220 rpm overnight; 1 ml of the bacterial liquid was taken out after induction, centrifuged to collect bacteria, and protein expression was detected: 80 μl of ddH2O was added to the centrifuged bacteria, 20 μl of loading was added, boiled for 5 min, centrifuged for 5 min, and then loaded for SDS-PAGE electrophoresis, followed by staining with Coomassie brilliant blue and decolorization, to observe and compare whether the protein was induced and expressed; the induced and expressed protein was subjected to subsequent purification; the bacterial liquid was centrifuged to collect bacteria; the bacteria were resuspended with lysis Buffer (HIS) and PMSF (1%) was added to mix; the bacterial cells were sufficiently lysed by ultrasonic wave crusher; the mixture was centrifuged at 4°C, 7000 rpm for 30 min, and the supernatant was transferred to a new tube; after the beads were balanced, 200 μl of beads were added to the supernatant, which was combined at 4°C on a shaker for 3 h; the beads were centrifuged at 4°C, 3000 rpm for 3 min, and then washed 3 times to wash away the impure proteins which were not strongly combined; the target protein was eluted: 500 μl of HIS tag eluent (imidazole solution) was added, which was eluted at 4°C on a shaker for 20 min, centrifuged at 4°C, 3000 rpm for 3 min, and the supernatant was taken to measure the concentration, which was stored at -80°C.

[0279] The experiment was divided into 10 treatment groups, which were H2O, GFP-HIS, VDAL, VDAL+GFP-HIS, VDAL+VIPR1L-His 5ppm, VDAL+VIPR1L-His 10ppm, VDAL+VIPR1L-His 20ppm, VIPR1L-His 5ppm, VIPR1L-His 10ppm and VIPR1L-His 20ppm.

[0280] Each treatment group used different reagents to soak 30 wheat seeds as shown in Table 4, and after germination, they were sown on the dish (4 layers of water absorption paper and 1 layer of filter paper were prepared in advance) and the water amount was controlled every day, the germination rate was counted, and the plant height was measured. After 1 week, the wheat was subjected to water loss treatment, and the photos were recorded. 3 biological repeats.

[0281] Table 4 Reagents used in the treatment groups and preparation methods

[0282]

[0283]

[0284] The experimental results are shown in the following table (Table 5), and the results are shown in Figure 7 (a)-(c) as shown, wherein (a) is the plant height statistics on the first day of sowing, (b) is the plant height statistics after one week of sowing, and (c) is the photos of part of the treatment groups after one week of sowing.

[0285] Table 5 Experimental results

[0286] a. First day plant height (mm)

[0287] Treatment group First repetition Second repetition Third repetition Average value [H2O] 5.26 7.00 7.33 6.53 GFP-HIS 5.23 7.00 8.46 6.90 VDAL 4.16 9.63 8.10 7.30 VDAL+GFP-His 4.76 9.40 10.90 8.35 VDAL+VIPR1L-His 5ppm 4.33 8.230 8.30 6.95 VDAL+VIPR1L-His 10ppm 5.60 8.50 6.76 6.95 VDAL+VIPR1L-His 20ppm 4.90 8.30 11.660 8.28 VIPR1L-His 5ppm 4.46 8.43 10.10 7.66 VIPR1L-His 10ppm 5.6 9.03 10.60 8.41 VIPR1L-His 20ppm 5.16 6.36 6.16 5.90

[0288] b. Plant height after one week (mm)

[0289] Treatment group First repetition Second repetition Third repetition Average value H2O 89.76 76.56 50.30 72.21 GFP-HIS 96.10 77.00 51.73 74.94 VDAL 81.73 92.90 45.80 73.47 VDAL+GFP-His 84.46 86.43 54.13 75.01 VDAL+VIPR1L-His 5ppm 83.63 85.76 54.46 74.62 VDAL+VIPR1L-His 10ppm 92.70 95.13 47.23 78.35 VDAL+VIPR1L-His 20ppm 95.70 83.86 55.76 78.44 VIPR1L-His 5ppm 80.86 82.00 51.83 71.56 VIPR1L-His 10ppm 98.63 90.76 54.33 81.24 VIPR1L-His 20ppm 91.46 82.33 46.36 73.38

[0290] When the seed was treated with VIPR1L protein, the wheat plant with a concentration of 10 ppm was the highest, higher than the corresponding plant height under the treatment of control GFP-HIS, 5ppm GbVIPR1L-HIS and 20ppm GbVIPR1L-HIS protein; the drought resistance of the treated wheat seedlings was the best after one week of water loss, so it is considered that VIPR1L is involved in the process of wheat drought resistance, and this example shows that 10ppm may be the optimal concentration for applying GbVIPR1L-HIS pure protein to improve the drought resistance of wheat. The preliminary results of the VIPR1L and VDAL superposition experiment showed that the wheat grew best and had the best drought resistance when 10ppm of VIPR1L pure protein was added to 8ppm of VDAL.

[0291] Wheat seeds were soaked for at least 24 hours and then divided into nine treatment groups: H2O (CK), VDAL (8 ppm pure VDAL protein, VD8), VDAL 8 ppm + VIPR1L-His 5 ppm (8 ppm pure VDAL protein + VIPR1L-His 5 ppm, VD + VP5), VDAL 8 ppm + VIPR1L-His 10 ppm (8 ppm pure VDAL protein + VIPR1L-His 10 ppm, VD + VP10), and VDAL 8 ppm + VIPR1L-His 20 ppm (8 ppm pure VDAL protein + VIPR1L-His 20 ppm, VD + VP20). Purified GbVIPR1L-GST and VDAL-HIS were prepared into different treatment solutions according to the above proportions. Twenty wheat seeds with sprouting white hairs from each treatment group were soaked in the corresponding treatment solution. After 4 hours, the seeds were sown on sterilized vermiculite, with the water volume controlled daily. One week later, the wheat was dehydrated (i.e., no watering was applied), and photos were taken to record the results. One week after dehydration, a rehydration experiment was conducted (i.e., sufficient water was applied), and photos were taken to record the results.

[0292] The results are as follows Figure 7 As shown in (d), the left figure shows the condition of wheat after one week of water loss, and the right figure shows the condition of wheat after the rehydration experiment. The results show that VDAL alone cannot rehydrate under extreme drought conditions, while the combined treatment of VIR1L and VDAL can rehydrate under extreme drought conditions.

[0293] 4. Effects of VIPR1L protein on maize germination

[0294] To investigate the effect of exogenous treatment with VIPR1L protein on maize germination, plump maize seeds were selected and soaked in control protein (same labeled empty vector protein, hereinafter the same) and different concentrations of VIPR1L protein solutions for 4-5 hours before cultivation. Seed germination was then observed. After 24 hours of cultivation, compared with the control, soaking in different concentrations of VIPR1L protein solutions all increased the germination rate of maize seeds. Soaking in 20 mg / L and 40 mg / L VIPR1L protein solutions significantly increased the germination rate compared to the control, by 19.35% and 32.26%, respectively. After 36 hours of cultivation, the difference in germination rate between the control and experimental groups decreased, but the germination rates of maize seeds soaked in 20 mg / L and 40 mg / L VIPR1L protein solutions were still higher than the control. Therefore, exogenous treatment with VIPR1L protein can promote maize germination, and the promoting effect is more pronounced in the short term.

[0295] On this basis, the effect of exogenous VIPR1L protein treatment on maize seed germination under abiotic stress was explored. 10 mL of 150 mM NaCl solution or 10 mL of 15% PEG6000 solution was added to the square culture dish for cultivating maize seeds, and the maize seed germination was observed. The results are shown in Figure 8 B, C. Under NaCl stress, it was found that the germination rate of maize seeds treated with 10 mg / L, 20 mg / L, and 40 mg / L VIPR1L protein solution was significantly higher than that of the control, which was increased by 13.54%, 19.80%, and 19.80%, respectively. At 48 h, the germination rate of maize seeds treated with 25 mg / L and 40 mg / L VIPR1L protein solution was still higher than that of the control, and the germination rate was increased by 13.54% and 13.54%, respectively Figure 8 B). Under high osmotic stress, there was no significant difference between the control and the experimental group Figure 8 C). Therefore, under NaCl stress, exogenous VIPR1L protein treatment can also significantly promote maize seed germination in a short time.

[0296] Figure 8 A is the effect of VIPR1L protein treatment on maize germination rate. Maize seeds were soaked with control protein (same tag empty protein), 3 mg / L, 5 mg / L, 10 mg / L, 15 mg / L, 20 mg / L, and 40 mg / L VIPR1L protein solution for 4-5 h, and then placed in a 25°C dark culture. The germination rate was counted at 24 h and 36 h, respectively. The experiment was repeated 3 times independently, and the data represented the mean ± standard deviation. The significance analysis used t-test detection, ** represented p<0.01, and * represented p<0.05.

[0297] Figure 8 B is the effect of VIPR1L protein treatment on maize germination rate under NaCl stress. Maize seeds were soaked with control protein (same tag empty protein), 5 mg / L, 10 mg / L, 20 mg / L, and 40 mg / L VIPR1L protein solution for 4-5 h, and then 10 mL of 150 mM NaCl solution was added to the culture dish and placed in a 25°C dark culture. The germination rate was counted at 36 h and 48 h, respectively. The experiment was repeated 3 times independently, and the data represented the mean ± standard deviation. The significance analysis used t-test detection, *** represented p<0.001, ** represented p<0.01, and * represented p<0.05.

[0298] Figure 8C. Effect of VIPR1L protein treatment on maize germination rate under high osmotic stress. Maize seeds were soaked with control protein (same tag empty protein), 5 mg / L, 10 mg / L, 20 mg / L, 40 mg / L protein solution for 4-5 h, 10 mL 15% PEG6000 solution was added in the petri dish, placed in 25 °C, dark culture, and the germination rate was counted at 36 h and 48 h, respectively. The experiment was repeated 3 times independently, and the data represent the mean ± standard deviation. Significant analysis was detected by t-test, ns represents not significant.

[0299] 5. Effect of VIPR1L on maize growth and salt resistance, disease resistance, and lodging resistance performance

[0300] The maize seeds treated with different concentrations of VIPR1L protein solution were observed and the growth status of the radicles was counted after 3-4 days of culture in the light incubator, as shown in Figure 9 A, Figure 9 B. The average radicle length of the maize seeds treated with 10-40 mg / L VIPR1L protein solution was significantly higher than that of the control, and the number of lateral radicles was more.

[0301] Figure 9 A. Growth status of maize radicle treated with VIPR1L protein. Maize seeds were soaked with control protein (same tag empty protein) or different concentrations of VIPR1L protein solution for 4-5 h, and then placed in a light incubator at 25 °C, with 16 h light and 8 h darkness, and cultured for 3-4 days. The scale in the figure is 2 cm.

[0302] Figure 9 B. Statistical results of maize radicle length. Each group counted 30 seeds, and the experiment was repeated 3 times independently. The statistical results were displayed using a box plot, and the three horizontal lines of the rectangle represented the upper quartile (Q3, 75%), the median (Q2, 50%), and the lower quartile (Q1, 25%) from top to bottom, and the lowermost horizontal line and the uppermost horizontal line represented the minimum value and the maximum value, respectively. Significant analysis was detected by t-test, *** represents p<0.001, and ** represents p<0.01.

[0303] The maize seeds treated with different concentrations of VIPR1L protein solution were observed and the growth status of the radicles was counted after 3-4 days of culture in the light incubator, as shown in Figure 9 C, Figure 9 D. The average radicle length of the maize seeds treated with 10-40 mg / L VIPR1L protein solution was significantly higher than that of the control, and the average radicle length of the maize seeds treated with 20 mg / L VIPR1L protein solution was significantly higher than that of the control.

[0304] Figure 9C is the growth status of VIPR1L protein exogenous treatment of corn embryo. Corn seeds were soaked with control protein (same tag empty protein) or different concentrations of VIPR1L protein solution for 4-5h, and then placed in a light incubator at 25°C, 16h light, 8h dark, and cultured for 5-6 days. The scale in the figure is 2cm.

[0305] Figure 9 D is the statistical result of corn embryo length, 30 seeds per group, 3 independent repeated experiments. The statistical result is shown by box plot, and the three horizontal lines of the rectangle represent the upper quartile (Q3, 75%), the median (Q2, 50%) and the lower quartile (Q1, 25%) from top to bottom. The lowermost horizontal line and the uppermost horizontal line represent the minimum value and the maximum value. Significant analysis uses t-test detection, *** represents p<0.001, ** represents p<0.01, and * represents p<0.05.

[0306] In Figure 10 , Figure 10 A is the corn seedling treated with different concentrations of VIPR1L. As can be seen from the figure, corn seedlings treated with 5ppm to 20ppm of VIPR1L are significantly better than the control; Figure 10 B is the chlorophyll content of the first to third leaves, and 20ppm treatment is the best; Figure 10 C is the plant height 15 days after sowing, and each treatment is significantly better than the control, with 10ppm and 20ppm being the best; Figure 10 D is the leaf width of corn in vitro leaf treated with different concentrations of VIPR1L, and the results show that GbVIPR1L is beneficial to promote the width of corn leaves.

[0307] Figure 11 The VIPR1L improves the drought resistance of corn,

[0308] Figure 11 A is the leaf surface temperature of corn seedlings detected by infrared thermal imager, and the lower the leaf temperature, the higher the leaf water loss rate.

[0309] Figure 11 B is the leaf temperature statistical chart. Three leaves were selected for each treatment, and the average value of three points at the same height was taken. The data represent the mean ± standard deviation. Significant analysis uses t-test detection, *** represents p<0.001, ** represents p<0.01.

[0310] Figure 11 C is the statistical chart of in vitro leaf water loss rate. Water loss rate (%) = (initial fresh weight - weight after water loss) / initial fresh weight 100%, and the average value of three repeated results is taken. The data represent the mean ± standard deviation.

[0311] Figure 11D is soil drought treatment and rehydration experiment. Corn seeds were soaked with control protein (same tag empty protein) or different concentrations of VIPR1L protein solution for 4-5h, then sowed in plastic pots, and placed in a greenhouse for culture. The culture conditions were 25°C, 16h light, and 8h darkness. When the corn seedlings grew to the three-leaf stage, the excess water in the tray was removed, and drought treatment was started. After about a week of drought treatment, the wilting phenotype of the corn seedling leaves was observed. After about 10 days of drought treatment, an equal amount of sufficient water was added to the tray, and the growth status of the corn seedlings was observed after 1-2 days.

[0312] Figure 12 The VIPR1L improves the salt resistance of corn during germination. The control and VIPR1L 10ppm to 40ppm treatment were placed in 150mM NaCl conditions for germination, and it was found after 5 days of observation.

[0313] Figure 12 A is the effect of VIPR1L protein treatment on corn embryo growth under NaCl stress. Corn seeds were soaked with control protein (same tag empty protein) or different concentrations of VIPR1L protein solution for 4-5h, then placed in a culture dish for culture. In the culture dish, 10mL of 150mM NaCl solution was added every 2 days, and the culture was performed under light for about 7 days. The scale in the figure is 2cm.

[0314] Figure 12 B is the statistical result of corn embryo length under NaCl stress. Each group has 30 seeds, and the experiment is repeated 3 times independently. The statistical result is shown using a box plot. The three horizontal lines of the rectangle represent the upper quartile (Q3, 75%), the median (Q2, 50%), and the lower quartile (Q1, 25%) from top to bottom. The lowermost horizontal line and the uppermost horizontal line represent the minimum value and the maximum value, respectively. The significance analysis uses t-test detection, and * indicates p<0.05.

[0315] Figure 13 The field test results show that VIPR1L alone and in combination with VDAL protein can regulate corn growth and resistance, and the yield-increasing effect is better when the two are used together. VIPR1L protein has a promoting effect on the improvement of corn resistance by VDAL protein. Exogenous spraying of a mixed solution of VIPR1L and VDAL protein at a certain ratio can significantly improve corn disease resistance, lodging resistance, promote corn growth, and increase corn yield. Compared with the control, spraying corn leaves with 5mg / L VIPR1L protein solution (yield increase of 4.41%), 3mg / L VDAL protein solution (yield increase of 7.91%), 2:10 (yield increase of 14.48%), and 2:5 mixed solution of VIPR1L and VDAL protein (yield increase of 11.82%) can significantly increase corn yield.

[0316] Figure 13A is the diameter of the middle part of the ear of field corn. Randomly select 30 corns in each test plot, measure the diameter of the middle part of all corn ears, and calculate the average value. The data represent the mean ± standard deviation, and the significance analysis uses t-test detection, ** indicates p<0.01.

[0317] Figure 13 B is the index of aerial root of field corn. Randomly select 30 corns in each test plot, evaluate according to the number of layers and strips of aerial roots, and divide into 0-4 levels. Level 0: the number of aerial root strips is 0; level 1: the number of aerial root layers is 1, and the number of aerial root strips is less than 10; level 2: the number of aerial root layers is 1, and the number of aerial root strips is more than 10; level 3: the number of aerial root layers is 2, and the number of aerial root strips is less than 20; level 4: the number of aerial root layers is 2, and the number of aerial root strips is more than 20. Calculate the index of aerial root: aerial root index = (∑number of plants in each level × corresponding level) / (total number of corn plants × highest level) × 100. The data represent the mean ± standard deviation, and the significance analysis uses t-test detection, ** indicates p<0.01, and * indicates p<0.05.

[0318] Figure 13 C is the disease index of corn large spot. Randomly select 30 corns in each test plot, evaluate the large spot condition, record the disease level according to the following grading standard, level 0: no disease spot on the whole leaf; level 0.5: scattered disease spots on the whole leaf, accounting for about 1% of the leaf area; level 1: a small amount of disease spots on the whole leaf, accounting for 5%-10% of the leaf area; level 2: a moderate amount of disease spots on the whole leaf, accounting for 10%-25% of the leaf area; level 3: a large amount of disease spots on the lower leaves of the plant, accounting for more than 50% of the leaf area. Calculate the disease index: disease index = (∑number of diseased plants in each level × corresponding disease level) / (total number of corn plants × highest disease level) × 100. The data represent the mean ± standard deviation, and the significance analysis uses t-test detection, *** indicates p<0.001, and ** indicates p<0.01.

[0319] Figure 13 D is the fresh weight of the whole corn plant. Randomly select 3 three-meter double-row sample points in each test plot, weigh the total fresh weight of all corn plants in each sample point, and calculate the average value. The data represent the mean ± standard deviation, and the significance analysis uses t-test detection, ** indicates p<0.01, and * indicates p<0.05.

[0320] Figure 13 E is the equivalent yield per mu. Randomly select 3 three-meter double-row sample points in each test plot, count the number of corn plants, the average number of ears per plant, and the hundred-grain weight (after drying), and then calculate according to the following formula: equivalent yield per mu = number of plants per mu × average number of ears per plant × average number of grains per ear × hundred-grain weight / 100.

[0321] Figure 13F is the yield increasing rate. The yield change rate per mu of other treatment plots is calculated by taking the test plot sprayed with the control protein as the control.

[0322] Table 6 Comparison of resistance functions of VIPR1L treatment with other biological agents

[0323]

[0324]

[0325] 6. Effect of VIPR1L protein powder on tomato growth

[0326] To verify the immune induction, early senescence prevention and yield increasing effects of VIPR1L on tomatoes, we conducted experiments on tomatoes using VIPR1L alone, VIPR1L+VDAL, VDAL and water spraying as controls.

[0327] Materials and methods: The tomato variety was Juzi Banxiatuo (purchased from Shandong Weier Seed Co., Ltd.)

[0328] Using the VDAL protein powder with a purity of 2wt% and the GbVIPR1L powder with a purity of 12.5wt% (i.e. the aforementioned prepared VIPR1L-His crude protein) prepared in the foregoing, solutions were prepared: the VDAL protein powder was prepared into a 3ppm (VDAL) aqueous solution, the VIPR1L-His crude protein was prepared into a 15ppm (VIPR1L) aqueous solution, and the VDAL+VIPR1L-His was prepared into a 3ppm (VDAL)+15ppm (VIPR1L) aqueous solution. The spraying agent was prepared in an amount of 15L of protein aqueous solution per 667L of water, and was uniformly sprayed 7 days after the tomatoes were transplanted. The plot area was 130m2, and each treatment was randomly repeated 4 times. The investigation (recording the number of fruits and flower clusters per ear) was conducted once 15 days after the spraying, and the taste was tasted multiple times after the fruits were matured.

[0329] The results are shown in Figure 14 : After 15 days of spraying, the growth of tomatoes treated with VDAL, VIPR1L and VDAL+VIPR1L was better than that of the control Figure 14 A), the number of first layer, second layer fruits and top layer flower clusters was more than that of the control, and VDAL+VIPR1L was the best Figure 14 B)

[0330] After 3 months of spraying, the anti-senescence effect of tomatoes treated with VDAL, VIPR1L and VDAL+VIPR1L was obviously better than that of the control, which was manifested as the leaves still being green, and the large fruits being more than those of the control. VIPR1L was the best, followed by VDAL Figure 14 C).

[0331] The yield results prove that VDAL, VIPR1L and VDAL+VIPR1L treatment is better than the control, and VDAL+VIPR1L treatment is the highest, followed by VDAL Figure 14 At the same time, after repeated tasting, the taste of tomatoes sprayed with VIPR1L is the sweetest, and VDAL+VIPR1L tastes sweet and sour.

[0332] In summary, VIPR1L protein powder has the effects of immune induction, early senescence prevention and yield increase on tomatoes. If combined with VDAL, it can produce higher yield and more unique flavor.

[0333] 7. Effect of VIPR1L protein powder on the growth of tea trees

[0334] To verify the yield-increasing effect of VIPR1L on tea trees, we conducted experiments on tea trees sprayed with VIPR1L alone, VIPR1L+VDAL, VDAL and water as controls.

[0335] (1) Experimental materials: The selected experimental tea trees were Yinghong No. 9, cultivated in Yingde Tea World Tea Garden in Yingde City, Guangdong Province. The fresh leaves used for measurement were frozen in liquid nitrogen and then crushed into tea powder by a high-performance tissue lyser (model: Absolute 1100). The tea powder was stored in a -80°C ultra-low temperature refrigerator and used for subsequent quality metabolite determination and analysis.

[0336] (2) Experimental method

[0337] Spraying treatment experimental method:

[0338] VDAL treatment: 0.15 g VDAL was added to 2 L water to prepare a solution, which was sprayed on 15 m2 of tea trees every 5 days. 2 The spraying method was liquid surface spraying during the growth period, and the following was the same.

[0339] VIPR1L treatment: 0.12 g VIPR1L was added to 2 L water to prepare a solution, which was sprayed on 15 m2 of tea trees every 5 days. 2

[0340] VIPR1L+VDAL treatment: 0.15 g VDAL and 0.12 g VIPR1L (mass ratio 10:8) were added to 2 L water to prepare a solution, which was sprayed on 15 m2 of tea trees every 5 days. 2

[0341] Control (CK): blank control, 15 m2 of tea trees were sprayed with the same amount of water every 5 days. 2

[0342] Growth index determination method:

[0343] ​​​Sprouting density: 5 points were randomly selected in the treatment area and the control area, with an area of 33 cm x 33 cm, and the number of one bud and one leaf initial expansion in the point was investigated. The total number of buds in each point was converted into per m 2 The total number of buds is the sprouting density.

[0344] Hundred bud weight: 100 buds were randomly selected from the buds collected in each batch in the treatment area and the control area, and the average value was obtained by repeating 3 times, that is, the fresh weight of 100 buds was obtained. 100 buds were dried at 103°C to obtain the dry weight of 100 buds.

[0345] Yield determination: The treatment area and the control area were each divided into 5 regions (3m 2 ), and fresh leaves were picked from each region, and the tea tree fresh leaf yield was counted.

[0346] Due to the growth rate of tea shoots, the picking standard after 15 days of treatment was one bud and one leaf, and the picking standard after 25 days of treatment was one bud and two leaves.

[0347] Extraction and analysis of tea polyphenols

[0348] 0.2 g of Yinghong No. 9 fresh leaf tea powder was weighed, 10 mL of methanol solution was added, and the extraction was carried out in an ice bath for 30 min. After centrifugation at 8000 r / min for 5 min, the supernatant was taken, and the total polyphenol determination used Folin phenol determination method, 50 μL of the extract was taken and diluted 20 times with 950 μL of methanol solution. 200 μL of the diluted solution was taken, 500 μL of 10% Folin phenol solution was added, and it was shaken well and reacted. After 4 min, 400 μL of 7.5% Na2CO3 solution was added, and it was placed at room temperature for 60 min. The enzyme label was detected at a wavelength of 765 nm.

[0349] Extraction and analysis of total free amino acids

[0350] 10 mL of cold water was added to 0.2 g of tea powder, and the extraction was carried out in an ice bath for 30 min, shaking every 5 min. Centrifugation at 10000 g for 5 min, taking the supernatant and constant volume to 10 mL. 1 mL of the extract was taken and diluted 10 times. 200 μL of the diluted solution was taken, 100 μL of buffer and 100 μL of indantrione color developing agent were added, and it was heated in a boiling water bath for 15 min to develop color. After cooling to room temperature, the absorbance value was measured at 540 nm.

[0351] High performance liquid chromatography analysis of catechins and caffeine

[0352] Take 0.2 g of tea powder, add 10 mL of methanol solution, extract for 30 min under ice bath condition, centrifuge at 8000 r / min for 5 min, take the supernatant, and dilute to 10 mL. Take the extract through a 0.22 μm membrane, and analyze the extract by an HPLC analyzer (Alliance, Waters, Milford, MA, USA). The analysis is performed on a ZORBAX Eclipse C18 chromatographic column (4.6 mm x 150 mm, 5 μm; Agilent, Santa Clara, California, USA) with a sample injection amount of 10 μL and a column temperature of 35°C. Solvent phase B is acetonitrile containing 2% glacial acetic acid, and solvent phase C is deionized water containing 9% acetonitrile and 2% glacial acetic acid. The linear gradient of the solvent is 0-32 min, 0%-30% B; 32.1-52 min, 30% B; 52-52.1 min, 30%-100% B; 67-67.1 min, 100%-0% B; 0.0-22.0 min, 100% C; 22.1-52.0 min, 100%-70% C; 52.1-67 min, 70%-0% C; 67.1-97 min, 0% C; and the flow rate of the mobile phase is 1 mL / min. The ultraviolet absorption wavelength is 278 nm.

[0353] (3) Experimental results

[0354] Effects of VDAL and VIPR1L proteins on growth traits of Yinghong No. 9 tea plants:

[0355] The four experimental treatments are VDAL protein treatment, VIPR1L protein treatment, VDAL+VIP treatment, and a control group CK. The results show that spraying VDAL, VIP, and VDAL+VIP can significantly improve the yield of Yinghong No. 9 tea plants (P<0.05, Fig. VIP refers to VIPR1L protein). Figure 15

[0356] Effects of VDAL and VIPR1L proteins on the hundred-bud weight and bud density of Yinghong No. 9 tea plants:

[0357] Spraying VDAL protein or VIPR1L protein alone has no significant effect on the bud density of tea plants, while spraying VDAL protein and VIPR1L protein together can significantly improve the bud density of tea plants. Spraying VDAL protein alone has no significant effect on the hundred-bud weight of tea plants, while spraying VIPR1L protein alone and spraying VIPR1L and VDAL proteins together can significantly improve the hundred-bud weight of tea plants (P<0.05, Fig. VIP refers to VIPR1L protein). Figure 16

[0358] Effects of VDAL and VIPR1L proteins on fresh leaf quality metabolites of Yinghong No. 9 tea plants: ​​

[0359] Tea polyphenols (TPP) is the main secondary metabolites in tea, including catechins, flavones and flavonoid glycosides, anthocyanins and flavanols, phenolic acids and other substances (Wan Xiaochun, 2003). It contributes to the astringency of tea soup. Amino acids are organic compounds with amino and carboxyl groups in tea, which are one of the main chemical components in tea. The composition, content and degradation and transformation products of total amino acids (TAA) in tea directly affect the quality of tea. It is generally believed that high amino acid content is beneficial to the freshness of tea soup. Caffeine (CAF) is the main component of tea alkaloids, belonging to xanthine alkaloids, accounting for 2%-5% of the dry weight of tea, and is the main contributor to the bitterness of tea soup. Studies have shown that spraying VDAL protein alone and spraying VIPR1L and VDAL proteins together can significantly increase the content of total polyphenols in tea fresh leaves, and spraying VIPR1L protein alone has no significant effect on the content of total polyphenols. Figure 17 Figure VIP refers to VIPR1L protein)

[0360] The content of amino acids in tea fresh leaves is high, which is an important metabolite that constitutes the quality of tea. The content of amino acids is generally positively correlated with the quality of tea. Through our research, we found that spraying VDAL protein or VIPR1L protein alone and VDAL+VIP spraying together did not significantly change the total amount of free amino acids in English red No. 9 tea fresh leaves. Figure 18 Figure VIP refers to VIPR1L protein)

[0361] Through high performance liquid chromatography analysis of the content of catechins and alkaloids in English red No. 9 tea fresh leaves after four treatments, we found that spraying VDAL protein or VIPR1L protein alone and spraying VIPR1L and VDAL proteins together can significantly reduce the content of EGC and EGCG, and have no significant effect on other catechins and caffeine. Figure 19 Figure VIP refers to VIPR1L protein)

[0362] 8. Blueberry preservation experiment treated with VIPR1L protein

[0363] The experiment includes CK and treatment, a total of 5: control CK, preservative, VDAL, VIPR1L, VDAL 3ppm+VIPR1L 3ppm. According to the calculation of 500ml water, weigh the protein, after the protein is fully dissolved, dip the blueberries in the corresponding solution and place them on the absorbent paper to dry naturally, so as to observe, 30 blueberries in each group. The dosage and working concentration of VDAL & VIPR1L used for blueberries are shown in Table 7.

[0364] Table 7 Dosage and working concentration of VDAL & VIP used for blueberries

[0365] Number (B) 2% VDAL (g) 12.5% VIPR1L (g) Water amount (ml) CK - - 500 Preservative - - 500 VDAL 0.075 - 500 VIPR1L - 0.012 500 VIPR1L+VDAL 0.075 0.012 500

[0366] Timing to observe the freshness of blueberries, and record the grade determination from the fruit hardness, disease spot ratio, etc.

[0367] Note: The blueberry rot grade is divided into 0-4 levels, 0 level is fruit is harder, no disease spot, 1 level is fruit is softer or rot area accounts for 25% or less of fruit area, 2 level is rot area accounts for 25%-50% of fruit area, 3 level is rot area accounts for 50%-75% of fruit area, 4 level is rot area accounts for 75% or more of fruit area.

[0368] As shown in Figure 20 VIPR1L protein treatment compared with the control, VIPR1L has the best fresh-keeping effect on blueberries, the rot index of the 11th day is 33.3% lower than the control CK, 23.3% lower than the preservative, the rot index of the 31st day is 4.2% lower than the control CK and the preservative; followed by VDAL+VIPR1L, the rot index of the 31st day is 2.5% lower than the control CK and the preservative.

[0369] VIPR1L spraying blueberry fruit, not only can delay fruit rot time, persistent preservation, but also can slow down water loss, prevent dryness, reduce loss, can be widely used in fruit and vegetable preservation.

[0370] Example 4 Other VIPR1L protein or biological agent treatment of plants

[0371] (1) Use other VIPR1L proteins described in the application instead of the VIPR1L protein shown in SEQ ID No. 1 used in Example 3 (make the use amount of the above other proteins equivalent to the use amount of the VIPR1L protein shown in SEQ ID No. 1 in Example 3).

[0372] (2) Use the nucleotide sequence (DNA) shown in SEQ ID No. 2 or SEQ ID No. 192-217 or the nucleotide sequence (DNA) for encoding any one of the amino acid shown in SEQ ID No. 32-191 instead of the VIPR1L protein shown in SEQ ID No. 1 used in Example 3 (make the use amount of the above DNA equivalent to the use amount of the VIPR1L protein shown in SEQ ID No. 1 in Example 3).

[0373] (3) using the following biological agents instead of the VIPR1L protein shown in SEQ ID No. 1 used in Example 3 (the amount of the VIPR1L protein or DNA encoding the VIPR1L protein in the biological agent is equivalent to the amount of the VIPR1L protein shown in SEQ ID No. 1 in Example 3) to conduct experiments, specifically:

[0374] a biological agent comprising an amino acid sequence (VIPR1L protein) shown in SEQ ID No. 6-191;

[0375] or a biological agent comprising a nucleotide sequence (DNA) shown in SEQ ID No. 2 or SEQ ID No. 192-217 or a nucleotide sequence (DNA) for encoding an amino acid shown in any one of SEQ ID No. 32-191;

[0376] or a biological agent comprising any one of the expression cassettes, recombinant vectors, recombinant microorganisms, cell lines, transgenic cell lines, transgenic plant tissues, or transgenic plant organs described in items 3-6 in the summary of the application section of the specification.

[0377] The experimental results of (1)-(3) above show that the use of other proteins, DNAs, or biological agents described above is consistent with the use of the VIPR1L protein shown in SEQ ID No. 1 described in Example 3 in promoting plant growth, improving plant salt resistance, disease resistance, and drought resistance, increasing crop yield, quality, and fruit and vegetable preservation.

[0378] Some specific test examples are as follows:

[0379] 1. The experimental results of the effect of treating wheat seeds with the VIPR1L protein described in item 3 of Example 3 on wheat growth and drought resistance are shown in the following table:

[0380]

[0381]

[0382] 2. The experimental results of the effect of the VIPR1L protein described in item 4 of Example 3 on corn germination are shown in the following table:

[0383]

[0384]

[0385] 3. The experimental results of the effect of the VIPR1L protein described in item 5 of Example 3 on corn growth are shown in the following table:

[0386]

[0387]

[0388] 4. The results of the experiment on the effect of the tomato growth according to item 6 in Example 3 are shown in the following table:

[0389]

[0390]

[0391] 5. The results of the experiment on the yield increase of tea trees according to item 7 in Example 3 are shown in the following table:

[0392]

[0393]

[0394]

[0395] 6. The results of the experiment on the preservation of blueberries according to item 8 in Example 3 are shown in the following table:

[0396]

[0397]

[0398] The present application has been described in detail. For those skilled in the art, without departing from the spirit and scope of the present application, and without unnecessary experiments, the present application can be implemented in a wider range under the same parameters, concentrations and conditions. Although the present application gives a special example, it should be understood that the present application can be further improved. In summary, according to the principle of the present application, the present application intends to include any change, use or improvement of the present application, including the change made by the conventional technology known in the art, which is out of the range disclosed in the present application. Some basic features can be applied within the scope of the following attached claims.

[0399] The contents not described in detail in the specification belong to the prior art known to those skilled in the art.

Claims

1. A VIPR1L protein, characterized in that, The VIPR1L protein is: An amino acid sequence as shown in SEQ ID No.

1.

2. A DNA, characterized in that, The sequence of the DNA is: As shown in SEQ ID No. 2, for encoding the VIPR1L protein as claimed in claim 1.

3. A biological agent, characterized in that: (1) comprising the VIPR1L protein as claimed in claim 1; (2) or comprising the DNA as claimed in claim 2.

4. A biological agent, characterized by: The biological agent is mixed by the VIPR1L protein as claimed in claim 1 and VDAL protein, and the mass ratio of the above-mentioned VIPR1L protein and VDAL protein is 5-10:

8.

5. The use of the biological preparation according to claim 3, characterized in that, The biological agent is applied to: promoting the growth of wheat, corn, tomato or tea tree, improving the salt resistance of corn, improving the drought resistance of wheat or corn, improving the yield of corn, tomato or tea tree, improving the quality of tomato, and preserving blueberry.

6. The use of the biological preparation according to claim 4, characterized in that, The biological agent is applied to: promoting the growth of wheat, corn, tomato or tea tree, improving the disease resistance of corn against large spot disease, improving the drought resistance of wheat, improving the yield of corn, tomato or tea tree, improving the quality of tomato, and improving the content of tea polyphenol in tea leaves.

Citation Information

Patent Citations

  • Multi-PCR detection method for minim DNA

    CN101245389A

  • Application of MYB6 protein and coding gene thereof in regulating verticillium wilt resistance of plants

    CN110317250A