An Aschersonia sichuanensis AKg-2 and its application

Abstract

The present invention relates to the field of microbial technology, and particularly relates to an Aschersonia kawakamii AKg-2 and its application. The preservation number of Aschersonia kawakamii AKg-2 is: CGMCC No. 40511. After investigating and collecting the field-naturally diseased Parasaissetia nigra nymphs, through isolation, purification, virulence determination and screening, it is found that the Aschersonia kawakamii AKg-2 strain has a relatively high pathogenicity to the nymphs of Parasaissetia nigra, and can be widely used for the biological control of Parasaissetia nigra.

Description

Technical Field

[0001] The present invention relates to the field of microbial technology, and particularly relates to an Aschersonia kawakamii AKg-2 and its application. Background Art

[0002] Parasaissetia nigra, also known as rubber scale insect, blackish Parasaissetia, and black light hard scale, belongs to the genus Parasaissetia of the family Coccidae in the superfamily Coccoidea of the order Hemiptera. It has many host plants and is one of the main pests of rubber trees, causing rubber tree yield reduction, weakening of tree vigor, and even death, and has become an important factor seriously affecting the development of the natural rubber industry.

[0003] Li Jiazhi et al. only made morphological observation and identification of the fungal fruiting bodies and conidia parasitizing on scale insects of rubber trees. The scale insect parasite on the rubber tree branches and leaves is Aschersonia kawakamii.

[0004] In the prior art, the control of Parasaissetia nigra mainly adopts chemical control methods. The extensive use of chemical pesticides not only consumes a large amount of labor, but also seriously damages the ecological environment and species diversity, killing a large number of natural enemies of pests, so that the damaged area of Parasaissetia nigra and the damage degree of rubber trees have both increased.

[0005] In addition, since rubber trees are tall arbors, powder sprayers and smoke agents are generally used for pesticide application. The extensive use of pesticides or improper use of pesticides causes serious pollution to the intercropped crops (such as coffee, tea, pineapple, etc.) under rubber trees, increasing the quality safety risk of agricultural products. Therefore, it is imperative to seek a safe and effective control measure other than chemical control. Summary of the Invention

[0006] The purpose of the present invention is to overcome the deficiencies of the prior art and provide an Aschersonia kawakamii AKg-2 and its application.

[0007] To achieve the above purpose, the technical solution designed by the present invention is as follows:

[0008] The present invention provides an Aschersonia kawakamii AKg-2, and its preservation number is: CGMCC No. 40511.

[0009] The above-mentioned Aschersonia kawakamii AKg-2 was preserved in the China General Microbiological Culture Collection Center on February 27, 2023, with the preservation number of CGMCC No. 40511, and the preservation address is: No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing.

[0010] The present invention also provides an application of the above-mentioned Aschersonia kawakamii AKg-2 in controlling Parasaissetia nigra Nietner.

[0011] The present invention also provides a biocontrol suspension for controlling Parasaissetia nigra Nietner, and the biocontrol suspension contains a suspension of Aschersonia kawakamii AKg-2.

[0012] Furthermore, in the biocontrol suspension, the concentration of Aschersonia kawakamii AKg-2 spores is 1.15×10 4 cfu / mL - 1.15×10 8 cfu / mL.

[0013] Still further, in the biocontrol suspension, the concentration of Aschersonia kawakamii AKg-2 spores is 1.15×10 8 cfu / mL.

[0014] Still further, the preparation method of the spore suspension of Aschersonia kawakamii AKg-2 is as follows:

[0015] a. Activate Aschersonia kawakamii AKg-2, inoculate the activated strain onto a PDA medium, place it in an incubator at 25°C for inverted culture, and it can be used after a large amount of sporulation (about 35 days).

[0016] b. Use a cell scraper to fully scrape the spores into a sterile 0.05% (v / v) Tween-80 solution, fully shake it in a shaker, then filter out the broken hyphae with a sterilized filter, collect the spore filtrate, add a sterile 0.05% (v / v) Tween-80 solution for dilution and adjust the spore concentration with a hemocytometer to prepare a spore suspension with a concentration of 1.15×10 4 cfu / mL - 1.15×10 8 cfu / mL for standby.

[0017] The present invention also provides an application of the above-mentioned biocontrol suspension in controlling Parasaissetia nigra Nietner on plants. Furthermore, the plant is a pumpkin or a rubber tree.

[0018] The present invention also provides a control method of the above-mentioned biocontrol suspension, and the method is to spray the biocontrol suspension on the plants or fruits of the plants damaged by Parasaissetia nigra Nietner.

[0019] Furthermore, the plant is a pumpkin or a rubber tree. Among them, when spraying on pumpkin fruits, the spraying amount of the biocontrol suspension is 2 - 3 mL per fruit.

[0020] Principle of the present invention:

[0021] Entomopathogenic fungi are a type of fungi that can parasitize on the surface and inside of insects. They directly infect by spores contacting the insect body wall, proliferate inside the insects, and destroy the insect tissue to cause death. Because of their environmental friendliness, continuous control ability against pests, and low tendency to develop drug resistance, they are considered to be the next generation of new biological pesticides most likely to replace chemical pesticides.

[0022] Aschersonia is an important type of entomopathogenic fungi, mainly parasitizing on scale insects and whiteflies. Aschersonia has the advantages of convenient production, safe use, non-pollution to the environment, unique infection mechanism, low tendency for hosts to develop resistance, and strong large-area continuous control ability. It has functional advantages that cannot be replaced by other biological insecticides and has great application prospects with wide distribution in nature. However, currently, there is no Aschersonia strain that has strong pathogenicity to Parasaissetia nigra Nietner and can be used for the biological control of Parasaissetia nigra Nietner.

[0023] In this invention, the Aschersonia sichuanensis strain AKg-2 was isolated from diseased Parasaissetia nigra Nietner on rubber trees in Mengding Town, Gengma County, Lincang City, Yunnan Province on June 14, 2022. After the inventors of this invention investigated and collected the naturally diseased Parasaissetia nigra Nietner insects in the field, through isolation, purification, virulence determination and screening, it was found that the Aschersonia sichuanensis strain AKg-2 has relatively high pathogenicity to the nymphs of Parasaissetia nigra Nietner and can be widely used for the biological control of Parasaissetia nigra Nietner.

[0024] Advantages of this invention:

[0025] 1. The isolated Aschersonia sichuanensis strain AKg-2 is a fungal strain with strong pathogenicity to the nymphs of Parasaissetia nigra Nietner.

[0026] 2. The Aschersonia sichuanensis strain AKg-2 is easy to culture and can be easily mass-cultured and propagated indoors.

[0027] 3. The conidia of the Aschersonia sichuanensis strain AKg-2 have strong pathogenicity to the nymphs of Parasaissetia nigra Nietner, are environmentally friendly and pollution-free, and have low tendency to develop drug resistance, and can be widely used for the biological control of Parasaissetia nigra Nietner. Description of the drawings

[0028] Figure 1 It shows the morphology of the sporocarp of Aschersonia sichuanensis.

[0029] Figure 2 It is a colony morphology diagram of the Aschersonia sichuanensis strain AKg-2 cultured on PDA medium at 25 ± 1°C.

[0030] Figure 3 It is a spore production structure diagram of the Aschersonia sichuanensis strain AKg-2.

[0031] Figure 4 It is a conidia diagram of the Aschersonia sichuanensis strain AKg-2. Detailed implementation methods

[0032] The present invention will be further described in detail below in conjunction with specific embodiments for those skilled in the art to understand.

[0033] Example 1 Isolation and Identification of Aschersonia kawakamii AKg-2

[0034] 1. Materials

[0035] The strain was isolated from diseased Parasaissetia nigra Nietner on rubber trees in Mengding Town, Gengma County, Lincang City, Yunnan Province on June 14, 2022.

[0036] 2. Isolation and Culture of the Strain

[0037] The collected diseased Parasaissetia nigra Nietner together with rubber tree leaves were taken back to the laboratory in a sterile fresh-keeping bag. The stromata (see Figure 1 ) were cut into uniform and neat slices of 1 mm, immersed in 75% alcohol for about 10 s, taken out and rinsed 3 times with sterile water, about 3 min each time. After picking out the slices and blotting them dry on sterilized filter paper, the slices were placed on PDA medium for culture. After dark culture for 3 - 7 d, the growth of the colony was observed. When white mycelia grew, the mycelial blocks not contaminated by miscellaneous bacteria were carefully transferred to a new plate medium together with the medium using a sterile scalpel for continued culture. Then single spore isolation and purification culture were carried out to obtain a pure culture strain, and the strain was preserved.

[0038] 3. Morphological Identification

[0039] The isolated and purified fungus was inoculated on PDA medium, placed at (25 ± 1)°C for dark culture. After 7 d, mycelia were picked to prepare slides and observed under an optical microscope for the mycelial morphology of the strain; after 14 d, conidia were picked to prepare slides and observed for the morphology and size of the conidia, and the morphological characteristics of the colony were observed and measured every day.

[0040] 4. DNA Sequence Determination and Molecular Identification

[0041] The DNA of the strain was extracted using a Tsingke DNA extraction kit. After appropriate dilution of the extracted DNA sample, it was used as a PCR template, and gene primers were used to perform PCR amplification on the genomic DNA of the strain respectively.

[0042] ITS primer pair:

[0043] ITS1: 5′-TCCGTAGGTGAACCTGCGG-3′,

[0044] ITS4: 5′-TCCTCCGCTTATTGATATGC-3′;

[0045] LSU primer pair:

[0046] LRO: 5′-ACCCGCTGAACTTAAGC-3′,

[0047] LR5: 5′-TCCTGAGGGAAACTTCG-3′;

[0048] EF1-α primer pair:

[0049] 983f: 5′-GCYCCYGGHCAYCGTGAYTTYAT-3′,

[0050] 2218r: 5′-ATGACACCRACRGCRACRGTYTG-3′;

[0051] RPB1 primer pair:

[0052] cRPB1Af: 5′-CAYCCWGGYTTYATCAAGAA-3′,

[0053] RPB1Cr: 5′-CCNGCDATNTCRTTRTCCATRTA-3′.

[0054] Each component of the amplification system includes 1 μL of each primer, 1 μL of template DNA, and 45 μL of Tsingke TSE101 Gold Mix. The PCR amplification was completed on an amplifier. The reaction program was as follows: pre-denaturation at 94 °C for 2 min, denaturation at 94 °C for 10 s, annealing at 56 °C for 10 s, extension at 72 °C at a rate of 10 s / kb for 35 cycles, and extension at 72 °C for 5 min. The annealing temperatures of the LSU and EF1-α gene PCR reaction programs were 55 °C and 53 °C respectively, and the annealing temperature for the amplification of the remaining genes was the same as that of ITS, which was 56 °C. The amplified PCR products were detected by agarose gel electrophoresis (2 μl of sample + 6 μl of bromophenol blue), observed and photographed under a gel imaging system. The prepared PCR products were sent to Kunming Qingke Biotechnology Co., Ltd. for sequencing; they were as follows:

[0055] The nucleotide sequence of the ITS gene is shown in SEQ ID NO:1:

[0056] cttaagttcagcgggtatccctgcctgattcgaggtcgactcggagagcgctgtcgcgatttgcggcggtggccgcgccgcggcccccggtgcggcgtgcgatacttcgcagggggggtcgcggcgcggacgccgatgcatttcgggggcggcgggcgccgctggggcgcccgccggtccccaacaccaagcggtcgcttgaggggtgaaatgacgctcgaacaggcatgcccgccagagtgctggcgggcgcaatgtgcgttcaaagattcgatgactcactgagatctgcaattcgcattacttatcgcatttcgctgcgttcttcatcgatgccagagccaagagatccgttgttgaaagttttgattcgtttcgcgtgtactcagaaggtccggcgccgcggggacgccgggatgaagggaggttcggggtgtccccggcgggggaggagcgccgcggcgggggacgatccccgccgcgccgcgccgcgtcccgccgaagcaacgtcttggtatgtgttcacaggggttgggagtcgggcgaactcggtaatgatccctccgca;

[0057] The nucleotide sequence of the LSU gene is shown in SEQ ID NO:2:

[0058] gccccagtaacggcgagtgaagcggcagcagctcaaatttgaaatctggcgcccccccggggagcccgagttgtaatttgcagaggatgcttttggcgaggcgccttccgagttccctgggacgggacgccgcagagggtgagagccccgtcgggtcggacgccgagcctctgtaaagctccctcgacgagtcgagtagtttgggaatgctgctctaaacgggaggtatatgtcttctaaagctaaataccggccagagaccgatagcgcacaagtagagtgatcgaaagatgaaaagcactttggaaagagggttaaacagcacgtgaaattgttgaaagggaagcgctcgtgaccagacttgggcgcggcggaccagccggcgttccgcgccggcgcactccgccgcgcccaggccagcatcggctcgcgccgggggacaaaggcggcgggaacgtggccccccagggggtgttatagcccgccgcgcaatgccccggggcggtccgaggttcgcgcgtccagcacggatgctggcgtaatggtcaccagcgacccgtcttgaaacacggaccaaggagtcgtcctcgtatgcgagtgttggggcgtgaaacccccgcgcggaatgaaagtgaacgctggtgagagcctcggcgcatcaccgaccgatcctgatgtcctcggatggatttgagtaggagcatacggggccggacccgaaagaaggtgaactatgcctgtgtagggtgaagccagaggaaactctggtggaggctcgcagcggttctgacgtgcaaatcgatcgtcaaacatgggcatgggggcgaaagactaatcgaaccttcta;

[0059] The nucleotide sequence of the EF1-α gene is shown in SEQ ID NO: 3:

[0060] Tagtcggtgaaggcctcaacgcacatgggcttggagggaaccatcttaacgatggcagagtcgccggacttgatgaacttgggcgcctcttcgacagcctttccggtacgtcggtcgatcttctccttgatctcggcgaacttgcaggcaatgtgggcggtgtggcaatcgaggacgggggcgtagccagcaccgacctggccggggtggttgaggacgatgacctgagcgtcgaaagaggcagcacccatgggggggtcgttcttggagtcaccagcaacgttgccacgacggatgtccttgacggacacgttcttcacgttgaagccgacgttgtcaccgggctgaccctcggtgagctgctcgtggtgcatttcgactgacttgacttcggtggtgacgttggagggagcgaaggtgacgaccataccgggcttgagaacacctgtctcgatacggccgacaggaacagttccgataccgccgatcttgtacacatcctggagggggagacggaggggcttgtcggtgggacgcttggggggctcgatggagtcgatggcctcgagcagagtcttgccagacgatttgccagccttggtctccttctcccagcccttgtaccagggacagttggtggagttttccagcatgttgtcgccgtggaatccggaaatggggacaaaggcgaccgtcttggggttgtatccgaccttcttgatgaagttggaagtctccttgatgatttcctggaaacgggcctcggaccacttggttgtgtccatcttgttgatggcaacgatgagctgcttgacacccagagtgtaggcaagcagggcgtgctcacgagtctggccatccttggaaataccagcctcgaactcaccagtgccggcagcgatgatgaaaatagcacagtcggcctgggaggacca;

[0061] The nucleotide sequence of the RPB1 gene is shown in SEQ ID NO:4:

[0062] tcaagaagatcttggagattgtctgtcacaactgcagcaaggtgttggccgatactgttggtctaccacaaatcattcaagacttttggtatggcttgcgtgatggctaacagtcattttctccagagcgatcctgagtttgttgccgctatcaacactcgcgacgccaaacttcgatttactcgtgtttgggcagtctgcaagaagaagcggagatgtgagaacgaagatcgcactgagaagcatgatgaagatttcgctcctggcatgaagccagtggtgaacaatcatggcggctgtggcaacgtgcaaccgcaagtacggcaggcagcgctacagctcaaggccgccttcgatgtggtgcaggaggatgggcccaagcgacgtgagacagtgcccatcacccctgaaatggcccatggaatcttgagaaggatttccgaggaagatattcgccacatgggcctcaattcagactacgcacgtcctgaatggatgatcatcaccgtccttcctgtccctccccccccggttcgccccagtatctcaatggacggcactggcaccggcatgcgcaacgaggacgacttgacatacaagctgggcgatatcatccgtgccaatggtaacgtgaaacaagccatccgcgaaggctctcctcagcatatcgccagagactttgaggagctacttcagtatcacgtggcaacatacat。

[0063] The measured sequence was submitted to the NCBI database and homology alignment was performed among the known sequences using Blast.

[0064] 5. Results

[0065] After obtaining the pure culture of Aschersonia kawakamii strain AKg-2, its morphological characteristics were identified. The results are as follows: When the strain grew on PDA medium at 25°C for 14 days, the colony diameter was 8.05 - 10.40 mm. The colony was round or nearly round, with an orange-yellow front and a reddish-brown back. The mycelium was white at first and then turned orange-yellow, bulging in the center. A mucilaginous spore mass was formed around 14 days, and the mucilaginous spore mass was milky white. The conidia were milky white, unicellular, fusiform or ovoid, wide in the center and gradually narrowing at both ends, with a spore size of (4.35 - 7.67 μm) × (2.45 - 4.30 μm). (See Figures 2 - 4 )

[0066] The ITS-rDNA sequence of strain AKg-2 was sequenced and analyzed. The sequence results were aligned through the Blast program. The highest homology of ITS was 90.68% with Hypocrella siamensis (accession number KF016995.1) in the NCBI database, the highest homology of LSU was 99.65% with Moelleriella sp. (accession number OR828403.1) in the NCBI database, the highest homology of EF1-α was 97.33% with Hypocrella schizostachyi (accession number DQ522346.1) in the NCBI database, and the highest homology of RPB1 was 96.90% with Hypocrella africana (accession number DQ000344.1) in the NCBI database. Hypocrella and Moelleriella are the teleomorphs of Aschersonia. Combining the morphological characteristics and relevant molecular biology information, strain AKg-2 is Aschersonia kawakamii of the genus Aschersonia, named Aschersonia kawakamii AKg-2.

[0067] The above-mentioned Aschersonia kawakamii AKg-2 was deposited in the General Microbiology Center of the China Committee for Culture Collection of Microorganisms on February 27, 2023, with the deposit number CGMCC No. 40511 and the deposit address at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing.

[0068] Example 2 Preparation of biocontrol suspension 1

[0069] The biocontrol suspension 1 for controlling Parasaissetia nigra contains a suspension of Aschersonia kawakamii AKg-2. In the biocontrol suspension 1, the concentration of Aschersonia kawakamii AKg-2 spores is 1.15×10 4 cells / mL.

[0070] Preparation method of the biocontrol suspension 1 for controlling Parasaissetia nigra

[0071] a. Activate Aschersonia kawakamii AKg-2, inoculate the activated strain onto a PDA medium, and incubate it in an inverted position in an incubator at 25°C. It can be used after a large amount of sporulation (about 35 days).

[0072] b. Add a sterile 0.05% (v / v) Tween-80 solution using a pipette, scrape the spores thoroughly with a cell scraper, then pour them into a conical flask, shake well in an oscillator, and filter out the broken hyphae with a sterilized filter. Collect the spore filtrate, dilute it with a sterile 0.05% (v / v) Tween-80 solution, and adjust the spore concentration using a hemocytometer to prepare a spore suspension with a concentration of 1.15×10 4 spores / mL, which is the biocontrol suspension 1 and is reserved for use.

[0073] Example 3 Preparation of biocontrol suspension 2

[0074] The preparation method of biocontrol suspension 2 is basically the same as that of biocontrol suspension 1 in Example 2, except that:

[0075] The biocontrol suspension 2 for controlling Parasaissetia nigra Nietner contains a suspension of Aschersonia kawakamii AKg-2, and in the biocontrol suspension 2, the spore concentration of Aschersonia kawakamii AKg-2 is 1.15×10 5 spores / mL.

[0076] Example 4 Preparation of biocontrol suspension 3

[0077] The preparation method of biocontrol suspension 3 is basically the same as that of biocontrol suspension 1 in Example 2, except that:

[0078] The biocontrol suspension 3 for controlling Parasaissetia nigra Nietner contains a suspension of Aschersonia kawakamii AKg-2, and in the biocontrol suspension 3, the spore concentration of Aschersonia kawakamii AKg-2 is 1.15×10 6 spores / mL.

[0079] Example 5 Preparation of biocontrol suspension 4

[0080] The preparation method of biocontrol suspension 4 is basically the same as that of biocontrol suspension 1 in Example 2, except that:

[0081] The biocontrol suspension 4 for controlling Parasaissetia nigra Nietner contains a suspension of Aschersonia kawakamii AKg-2, and in the biocontrol suspension 4, the spore concentration of Aschersonia kawakamii AKg-2 is 1.15×10 7 spores / mL.

[0082] Example 6 Preparation of biocontrol suspension 5

[0083] The preparation method of the biocontrol suspension 5 is basically the same as that of the biocontrol suspension 1 in Example 2, except that:

[0084] The biocontrol suspension 5 for controlling Parasaissetia nigra Nietner contains a suspension of Aschersonia kawakamii AKg-2, and in the biocontrol suspension 5, the concentration of Aschersonia kawakamii AKg-2 spores is 1.15×10 8 per mL.

[0085] Pathogenicity determination of biocontrol suspensions 1-5 against Parasaissetia nigra Nietner in Example 7

[0086] 1 Materials

[0087] 1.1 Test insects and host plants

[0088] Parasaissetia nigra Nietner were all collected from rubber trees in the experimental base of the Tropical Agricultural Science Research Institute of Dehong, Yunnan Province. Pumpkins (Cucurbita moschata) that were eight-ripe, with intact surfaces and no damage, weighing 300-350 g and of the variety Japanese pumpkin, were selected. Parasaissetia nigra Nietner were inoculated onto the pumpkins in the incubator for rearing. The relative humidity (RH) in the incubator was 75±5%, and the photoperiod was L:D = 12:12. After one generation of rearing of Parasaissetia nigra Nietner, when the 1st instar nymphs hatched, other instars were removed for use.

[0089] 1.2 Spraying method

[0090] The biocontrol suspensions 1-5 were respectively filled into spray bottles and evenly sprayed onto the pumpkins inoculated with Parasaissetia nigra Nietner, with a spraying amount of 2-3 ml per individual. The control (CK) was sprayed with 0.05% sterile Tween-80 and left to dry naturally. There were 50-100 nymphs on each pumpkin, and each treatment had 3 replicates.

[0091] The pumpkins were placed in an incubator under the conditions of relative humidity (RH) 75±5% and photoperiod L:D = 12:12. The number of infected and dead individuals was examined and recorded under a microscope every day.

[0092] 1.3 Data analysis

[0093] Excel software was used for data collation, and the virulence regression equation was calculated using SPSS software.

[0094] 2. Results

[0095] As can be seen from Table 1, when Aschersonia kawakamii AKg-2 in the biocontrol suspensions 1-5 infected the 1st instar nymphs of Parasaissetia nigra Nietner, the corrected mortality rates on the 10th day were 28.50%, 41.50%, 59.50%, 82.00% and 93.00% respectively. It can be seen from this that Aschersonia kawakamii AKg-2 has good pathogenicity to the nymphs of Parasaissetia nigra Nietner.

[0096] Based on the infection and pathogenic effects of biocontrol suspensions 1 - 5 on the 1st instar nymphs of Parasaissetia nigra Nietner, the LC of the biocontrol suspensions against the 1st instar nymphs of Parasaissetia nigra Nietner was calculated. 50 was 1.69×10 5 individuals / mL, and the LC 95 was 3.72×10 8 individuals / mL. This indicates that biocontrol suspensions 1 - 5 have good lethal effects on the 1st instar nymphs of Parasaissetia nigra Nietner, and biocontrol suspension 5 has the best effect.

[0097] Table 1 Toxicity of biocontrol suspensions against the 1st instar nymphs of Parasaissetia nigra Nietner (10 days after inoculation)

[0098]

[0099] In summary, the Aschersonia epiphylla AKg - 2 provided by the present invention is a biocontrol fungus that can be used to control Parasaissetia nigra Nietner. It has the characteristics of strong pathogenicity to the nymphs of Parasaissetia nigra Nietner, environmental protection and no pollution, and is not easy to produce drug resistance. It can be widely used in the biological control of Parasaissetia nigra Nietner.

[0100] Other parts not described in detail are prior art. Although the above embodiments have described the present invention in detail, they are only a part of the embodiments of the present invention, not all embodiments. People can also obtain other embodiments without creative efforts based on this embodiment, and these embodiments all belong to the protection scope of the present invention.

Claims

1. An Aschersonia kawakamii AKg-2, whose deposit number is: CGMCC No.40511.

2. Use of Aschersonia kawakamii AKg-2 according to claim 1 in controlling wax scale.

3. A biocontrol suspension for controlling wax scale, characterized in that: The biocontrol suspension contains a suspension of Aschersporum kawakamiensis AKg-2.

4. The biocontrol suspension according to claim 3, characterized in that: In the biocontrol suspension, the concentration of Aschersporum kawakamiensis AKg-2 spores is 1.15×10 4 / mL-1.15×10 8 Pieces / mL.

5. The biocontrol suspension according to claim 4, characterized in that: In the biocontrol suspension, the concentration of Aschersporum kawakamiensis AKg-2 spores is 1.15×10 8 Pieces / mL.

6. The biocontrol suspension according to claim 3, 4 or 5, characterized in that: The preparation method of the spore suspension of Aschersporum kawakamiensis AKg-2 is as follows: a. Activate Aschersporum kawakamiense AKg-2, inoculate the activated strain onto PDA medium, place it in an incubator at 25°C and invert it for culture until a large number of spores are produced; b. Scrape the spores thoroughly with a cell scraper and place them in a sterile 0.05% Tween-80 solution. Oscillate them thoroughly in an oscillator. Then filter the broken mycelia with a sterilized filter. Collect the spore filtrate, dilute it with a sterile 0.05% Tween-80 solution, and adjust the spore concentration using a hemocytometer to a concentration of 1.15×10 4 / mL-1.15×10 8 Prepare a spore suspension of 500 μg / mL for later use.

7. Use of the biocontrol suspension according to claim 3 for controlling Parasitium balsamiferum on plants.

8. The use according to claim 7, characterized in that: The plant is pumpkin or rubber tree.

9. A control method of the biocontrol suspension according to claim 3, characterized in that: The method comprises spraying the biocontrol suspension on the plants or fruits of the plants damaged by the wax scale of Paracotyledon rubrum.

10. The control method of the biocontrol suspension according to claim 9, characterized in that: The plant is pumpkin or rubber tree.

Images