A strain of Fusarium acuminatum G5 and its applications
The application of Fusarium acuminatum G5 enhances seed germination rates and vigor in North cinnamon and other plants by using fermentation products, addressing the challenges of low germination and inconsistent seed quality in North cinnamon cultivation.
Patent Information
- Application Number
- CN202411064595.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-08-05
- Publication Date
- 2025-07-15
- Estimated Expiration
- 2044-08-05
AI Technical Summary
The seed germination rate of Atractylodes Atractylodes is low, the quality is uneven, it is difficult to cultivate and breed artificially, and it also has high requirements for the growth environment, resulting in uneven seed germination and long growth cycle.
Fusarium acuminatum G5 strain was used to treat the seeds of Atractylodes through fermentation broth to promote their germination.
The germination rate, germination potential and germination index of the seeds of Atractylodes are significantly improved, and the germination index of Atractylodes is increased by 330.23%, 291.42% and 281.11%.
Smart Images

Figure CN118726112B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of microbial technology, and more specifically to a strain of Fusarium acuminatum G5 and its applications. Background Art
[0002] Atractylodes rhizome, a traditional Chinese medicine name, is the dried rhizome of plants belonging to the genus Atractylodes of the family Asteraceae. According to different origins, Atractylodes rhizome has multiple varieties, mainly including southern Atractylodes rhizome and northern Atractylodes rhizome. There are obvious differences between them in production areas and appearances. The content of atractylodin in northern Atractylodes rhizome is higher than that in southern Atractylodes rhizome among the medicinal components. As a multi-functional medicinal plant, northern Atractylodes rhizome has significant effects of drying dampness and strengthening the spleen, and has good therapeutic effects on symptoms such as abdominal distension, lack of appetite, weakness, and diarrhea caused by spleen deficiency. And it can effectively relieve pain for treating symptoms such as rheumatic arthralgia, joint pain, and muscle soreness, especially playing a significant role in the epidemic in recent years. However, northern Atractylodes rhizome has high requirements for the growth environment, is suitable for planting in hilly mountainous areas, semi-shady and semi-sunny slopes or wastelands, is intolerant to high temperature, strong light and soil conditions with poor drainage, and also has a certain regionality. In the artificial cultivation of northern Atractylodes rhizome, seed propagation is mostly used. Under natural conditions, the seeds of Atractylodes rhizome have a short lifespan and are not suitable for storage for more than one year. There are problems such as low seedling emergence rate, long growth cycle, and difficult breeding in the process of field planting. And most of the northern Atractylodes rhizome seeds sold on the market nowadays face serious problems such as low germination rate and uneven quality.
[0003] Therefore, providing a substance or method for promoting the healthy and efficient germination of northern Atractylodes rhizome seeds is an urgent problem to be solved by those skilled in the art. Summary of the Invention
[0004] In view of this, the present invention provides a strain of Fusarium acuminatum G5 and its applications.
[0005] In order to achieve the above object, the present invention adopts the following technical scheme:
[0006] A strain of Fusarium acuminatum G5, with the preservation number of CGMCC NO.41351, was preserved in the China General Microbiological Culture Collection Center on June 28, 2024. The preservation address is the Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing. The taxonomic name is Fusarium acuminatum.
[0007] The Fusarium acuminatum G5 provided by the present invention is an endophytic fungus isolated from Atractylodes chinensis, and has a remarkable effect on promoting the seed germination of Atractylodes chinensis. Endophytes are a class of microorganisms that can parasitize different parts of healthy plants at different stages of the growth cycle, but have no pathogenic effect on the host, including endophytic bacteria, endophytic fungi and endophytic actinomycetes. Through long-term co-evolution with host plants, endophytic fungi have various beneficial functions for host plants, such as promoting plant growth.
[0008] Another object of the present invention is to provide a microbial inoculum, comprising the above-mentioned Fusarium acuminatum G5.
[0009] Another object of the present invention is to provide a fermentation product, comprising the fermentation product of the above-mentioned Fusarium acuminatum G5.
[0010] Another object of the present invention is to provide the application of the above-mentioned Fusarium acuminatum G5, or the above-mentioned microbial inoculum, or the above-mentioned fermentation product in promoting the germination of plant seeds.
[0011] As a preferred embodiment, the plant is Atractylodes chinensis.
[0012] As a preferred embodiment, the plant is maize or tobacco.
[0013] Another object of the present invention is to provide a method for promoting the germination of Atractylodes chinensis seeds, by soaking Atractylodes chinensis seeds with the fermentation broth of the above-mentioned Fusarium acuminatum G5, or the above-mentioned microbial inoculum, or the above-mentioned fermentation product.
[0014] As a preferred embodiment, the soaking time is 8 h.
[0015] Beneficial effects: The present invention provides a strain of Fusarium acuminatum G5. Compared with clear water, PDA, and X0, the fermentation broth of this strain can significantly improve the germination rate, germination potential, and germination index of Atractylodes chinensis seeds (p < 0.05). Compared with the clear water control, the germination rate of Atractylodes chinensis seeds treated with the G5 strain increased by 330.23%, the germination potential increased by 291.42%, and the germination index increased by 281.11%. At the same time, this strain also has a significant promoting effect on the germination of maize and tobacco seeds. BRIEF DESCRIPTION OF THE DRAWINGS
[0016] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required for the description of the embodiments or the prior art. Obviously, the drawings in the following description are only the embodiments of the present invention. For those of ordinary skill in the art, other drawings can be obtained according to the provided drawings without creative efforts.
[0017] Figure 1This is a schematic diagram of the colony of strain G5 of the present invention on a PDA plate. The left figure is a top view, and the right figure is a bottom view.
[0018] Figure 2 This is a diagram of the conidia of strain G5 of the present invention.
[0019] Figure 3 This shows the effect of the fermentation broth of strain G5 of the present invention on the germination of Atractylodes chinensis (DC.) Koidz. seeds.
[0020] Figure 4 This shows the effect of the fermentation broth of strain G5 of the present invention on the germination of maize seeds.
[0021] Figure 5 This shows the effect of the fermentation broth of strain G5 of the present invention on the germination of tobacco seeds. Detailed implementation manners
[0022] Next, the technical solutions in the embodiments of the present invention will be clearly and completely described in conjunction with the accompanying drawings in the embodiments of the present invention. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative efforts shall fall within the protection scope of the present invention.
[0023] Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by those of ordinary skill in the art to which the present invention pertains.
[0024] The experimental methods in the following embodiments are all conventional methods unless otherwise specified. The experimental materials used in the following embodiments are all commercially available products unless otherwise specified.
[0025] Example 1
[0026] 1. Isolation and purification of the strain
[0027] The endophytic fungus G5 of Atractylodes chinensis (DC.) Koidz. was isolated from the rhizome of one-year-old seedlings of Atractylodes chinensis (DC.) Koidz. in Chengde City, Hebei Province. The method is as follows: After the collected plants were rinsed with running water, they were soaked and disinfected with 75% ethanol for 1 min and rinsed 3 times with sterile water; then disinfected with 2% sodium hypochlorite solution for 10 min and rinsed 3 times with sterile water. 100 μL of the sterile water from the last rinse was spread on a PDA medium to detect the generation of any contaminants. After using a sterile blade to cut the disinfected rhizome part into small pieces of 5 mm × 5 mm, they were placed on a PDA medium and cultured at 28 °C for 7 d. Observe the situation in the plate every day. When hyphae grew from the cut end, pick the fungal block from the edge and transfer it to a new PDA solid medium. After it grew into a colony, pick the fungal block from the edge, and repeat this process until a single strain was obtained and then cultured in a constant temperature incubator at 28 °C.
[0028] 2. Identification of the strain
[0029] 2.1 Morphological Observation
[0030] After culturing the endophytic fungus G5 of Atractylodes chinensis (DC.) Koidz. on PDA medium at 28 °C for 7 days, the colony was round, the mycelium was red and cottony, and the colony matrix was red, as shown in the appendix Figure 1 The conidia produced by this strain are as shown in the appendix Figure 2 as shown
[0031] 2.2 Molecular Biology Identification
[0032] The genomic DNA of strain G5 was extracted using the Fungal Genomic DNA Extraction Kit of Sangon Biotech (Shanghai) Co., Ltd., and the method was referred to the kit instruction manual. Using the extracted DNA as a template, and using the universal primers ITS1 and ITS4 for PCR amplification to identify the species
[0033] ITS1: 5’-TCCGTAGGTGAACCTGCGG-3’, SEQ ID NO.2;
[0034] ITS4: 5’-TCCTCCGCTTATTGATATGC-3’, SEQ ID NO.3
[0035] PCR amplification conditions: pre-denaturation at 94 °C for 5.0 min, denaturation at 94 °C for 30 s, annealing at 52 °C for 30 s, extension at 72 °C for 1 min, 35 cycles, and extension at 72 °C for 7 min
[0036] After recovering the PCR amplification product, sequencing was performed. The sequencing results are as follows
[0037] GGGGAATACGGAGCTTCACTCCCAACCCCTGTGAACATACCTTAATGTTGCCTCGGCGGATCAGCCCGCGCCCCGTAAAACGGGACGGCCCGCCAGAGGACCCAAACTCTAATGTTTCTTATTGTAACTTCTGAGTAAAACAAACAAATAAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCAAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCTGGTATTCCGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCCCCCGGGTTTGGTGTTGGGGATCGGCTCTGCCCTTCTGGGCGGTGCCGCCCCCGAAATACATTGGCGGTCTCGCTGCAGCCTCCATTGCGTAGTAGCTAACACCTCGCAACTGGAACGCGGCGCGGCCATGCCGTAAAACCCCAACTTCTGAATGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAA, SEQ ID NO.1.
[0038] The sequencing results were compared by BLAST (www.ncbi.nlm.nih.gov / ) on the NCBI website. Combining with the morphological identification results, it was determined that the endophytic fungus G5 of Atractylodes chinensis (DC.) Koidz. was Fusarium acuminatum.
[0039] 3. Preservation of the strain
[0040] Fusarium acuminatum G5 was preserved in the China General Microbiological Culture Collection Center. The preservation address is Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing. The preservation date is June 28, 2024, and the preservation number is CGMCC NO. 41351. The taxonomic name is Fusarium acuminatum.
[0041] Example 2
[0042] Strain G5 promotes the germination of Atractylodes chinensis (DC.) Koidz. seeds
[0043] 1. Preparation of the fermentation broth of strain G5
[0044] Under sterile conditions, the G5 strain was cultured on a PDA plate at 28°C for 7 days, and a 0.5 cm diameter bacterial cake was taken from the edge of the colony and then inoculated into a sterilized and cooled 50 ml liquid PDA medium. The control group was inoculated with a sterile agar block of the same size. The culture medium was fully fermented at a constant temperature of 28°C and a shaker at 180 r / min for 3 days. After the fermentation was completed, the liquid fermentation product was filtered with a 0.22 μm sterile filter membrane to obtain the fermentation liquid, which was stored at 4°C for later use.
[0045] 2. Effect of fermentation liquid on germination of Atractylodes macrocephala seeds
[0046] The seeds of Atractylodes lancea were disinfected with 2% sodium hypochlorite for 15 min and rinsed with sterile water three times.
[0047] The sterilized Atractylodes lancea seeds were soaked in a 25-fold dilution of the fermentation liquid obtained in step 1 for 8 hours, and the surface moisture of the seeds was dried with sterile filter paper and evenly placed in a culture dish covered with two layers of sterile filter paper. 25-fold PDA dilution, sterile water, and another Atractylodes lancea endophytic fungus X0 fermentation liquid screened by the same method were used as controls. 4 ml of liquid was added to each plate to keep the filter paper moist, and 3 groups were repeated. The culture dish was placed in a 25°C constant temperature artificial climate box for seed germination test. The number of seeds germinated in each treatment was observed and recorded every day. The germination of seeds was based on the radicle length breaking through the seed coat by 2 mm. The treatment was 7 days, and the germination rate, germination potential, and germination index were finally calculated (see Appendix Figure 3 , Table 1).
[0048] Germination rate (GR) = (number of germinated seeds / number of test seeds) × 100%
[0049] Germination potential (GE) = (number of normal germination seeds within the germination potential days / number of test seeds) × 100%
[0050] Germination index (GI) = ∑(Gt / Dt), where Gt is the number of germinations per day in the germination test, and Dt is the number of germination days corresponding to the number of germinations.
[0051] Table 1 Effect of strain G5 fermentation liquid on Atractylodes macrocephala seed germination
[0052]
[0053] From the results in Table 1, it can be seen that the fermentation broth of G5 strain significantly improved the germination rate, germination potential and germination index of Atractylodes lancea seeds compared with PDA, water and X0 (p < 0.05). Compared with the clear water control, the germination rate of Atractylodes lancea seeds treated with G5 strain increased by 330.23%, the germination potential increased by 291.42%, and the germination index increased by 281.11%.
[0054] Example 3
[0055] 1. G5 Strain Promotes the Germination of Other Seeds
[0056] (1) Prepare the fermentation broth of G5 strain, using the same method as in Example 2.
[0057] (2) Select corn and tobacco seeds with consistent growth vigor and disinfect them respectively: Disinfect corn seeds with 2% sodium hypochlorite for 10 min and rinse them 3 times with sterile water; Place tobacco seeds on sterile filter paper and disinfect them with 1 ml of a disinfectant solution prepared by mixing 85% ethanol and 30% H2O2 in a ratio of 4:1.
[0058] Place the disinfected corn seeds evenly in a petri dish lined with two layers of sterile filter paper. Use 25-fold diluted PDA solution, sterile water, and the fermentation broth of another Atractylodes chinensis (DC.) Koidz. endophytic fungus X0 as controls. Add 4 ml of liquid to each petri dish, keep the filter paper moist, and repeat in 3 groups. Place the petri dishes in a constant-temperature artificial climate chamber at 28 °C for a seed germination test. Observe and record the number of germinated seeds in each treatment every day. Consider a seed to have germinated when the radicle length breaks through the seed coat by 2 mm. Treat for 5 days, and finally calculate the germination rate, germination potential, and germination index (see Appendix Figure 4 and Table 2).
[0059] Place the disinfected tobacco seeds in a 1 / 2 ms solid medium supplemented with a 25-fold diluted fermentation broth. Use 25-fold diluted PDA solution, sterile water, and the fermentation broth of another Atractylodes chinensis (DC.) Koidz. endophytic fungus X0 as controls. Place the petri dishes in a constant-temperature artificial climate chamber at 22 °C for a seed germination test. Observe and record the number of germinated seeds in each treatment every day. Consider a seed to have germinated when the radicle length breaks through the seed coat by 2 mm. Treat for 7 days, and finally calculate the germination rate, germination potential, and germination index (see Appendix Figure 5 and Table 3).
[0060] Table 2 Effects of the Fermentation Broth of Strain G5 on the Germination of Corn Seeds
[0061]
[0062] Table 3 Effects of the Fermentation Broth of Strain G5 on the Germination of Tobacco Seeds
[0063]
[0064] The germination rate of corn seeds treated with the fermentation broth of strain G5 was as high as 85%, significantly promoting the germination of corn seeds compared with clear water and X0 (P < 0.05). Moreover, the germination potential and germination index of corn seeds treated with the fermentation broth of strain G5 reached 61.67% and 21.37 respectively, showing a significant difference compared with PDA (P < 0.05). Overall, it shows that the treatment with the fermentation broth of G5 can promote the germination of corn seeds.
[0065] The germination rate of tobacco seeds treated with the fermentation broth of strain G5 was as high as 78.67%, which significantly promoted the germination of maize seeds compared with that of clear water, X0, and PDA (P<0.05). Moreover, the germination potential and germination index of tobacco seeds treated with the fermentation broth of strain G5 reached 58% and 38.98, respectively, which were increased by 32.21% compared with that of clear water, 20.34% compared with the PDA control, and 43.22% compared with X0.
[0066] The various embodiments in this specification are described in a progressive manner. Each embodiment focuses on the differences from other embodiments. For the same or similar parts among the various embodiments, reference can be made to each other.
[0067] The above description of the disclosed embodiments enables those skilled in the art to implement or use the present invention. Various modifications to these embodiments will be obvious to those skilled in the art. The general principles defined herein can be implemented in other embodiments without departing from the spirit or scope of the present invention. Therefore, the present invention will not be limited to the embodiments shown herein, but will be accorded the widest scope consistent with the principles and novel features disclosed herein.
Claims
1. Fusarium acuminatum( Fusarium acuminatum ) G5, characterized in that The preservation number is CGMCC NO. 41351.
2. A microbial inoculant, characterized in that, It includes Fusarium acuminatum G5 described in claim 1.
3. A fermentation product, characterized in that, It includes the fermentation broth of Fusarium acuminatum G5 described in claim 1.
4. Use of Fusarium acuminatum G5 according to claim 1, or the microbial inoculum according to claim 2, or the fermentation product according to claim 3 in promoting germination of plant seeds, characterized in that, The plant is Atractylodes chinensis (DC.) Koidz., corn or tobacco.
5. A method for promoting the germination of Atractylodes chinensis (DC.) Koidz. seeds, characterized in that, Soak the seeds of Atractylodes chinensis (DC.) Koidz. with the fermentation broth of Fusarium acuminatum G5 described in claim 1 or the microbial inoculum described in claim 2 or the fermentation product described in claim 3.
6. The method for promoting the germination of Atractylodes chinensis seeds according to claim 5, wherein, The soaking time is 8 h.