Overexpression of the CiKPI gene and its application in improving the resistance of citrus to Colletotrichum gloeosporioides
By cloning and introducing the CiKPI gene, overexpression vector is constructed to improve the resistance of citrus to anthrax, the chemical dependence and drug resistance of citrus anthrax prevention and treatment in the prior art has been solved, and the effect of significantly reducing the incidence of anthrax is achieved.
Patent Information
- Application Number
- CN202410922644.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-07-10
- Publication Date
- 2025-07-29
- Estimated Expiration
- 2044-07-10
AI Technical Summary
The existing technology lacks research and application to use KPI to improve the resistance of citrus to anthrax. Chemical control leads to resistance to pathogenic bacteria and pesticide residues, affecting citrus production and environmental safety.
By cloning the CiKPI gene, the CiKPI overexpression vector was constructed and introduced into citrus receptor cells to obtain transgenic plants, which significantly increased the content of trypsin inhibitors and enhanced the resistance of citrus to anthrax.
It significantly reduces the size of citrus fungal anthrax lesions and reduces the incidence of anthrax to 48.8% of existing citrus, providing a safe and effective disease-resistant molecular breeding program.
Smart Images
Figure CN118726396B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of biotechnology, and particularly relates to the overexpression of the CiKPI gene and its application in improving the resistance of citrus to anthracnose. Background Art
[0002] Citrus anthracnose is a serious fungal disease that harms citrus worldwide. In China, citrus anthracnose is widespread in all citrus production areas and is one of the main and common diseases in citrus production. The spring shoot stage and the pre-harvest stage are the critical periods when citrus anthracnose causes severe damage. The citrus anthracnose pathogen harms the young leaves and new shoots of spring shoots, causing the leaves and shoots to wilt and die rapidly. In severe cases, it can cause the death of the entire tree. The citrus anthracnose pathogen also harms the flower petals and young fruits, resulting in a large number of young fruits dropping. After the fruit begins to turn color, it mainly harms the fruit stalk, causing the fruit stalk to dry out and the fruit to drop prematurely. The fruits picked and stored in the warehouse may be latent carriers of the pathogen and cause anthracnose during the storage period, with the fruit rotting from the fruit stalk. Therefore, anthracnose is also an important post-harvest disease, which has a great impact on citrus production.
[0003] Currently, the control of citrus anthracnose mainly relies on chemical control. The continuous use of fungicides can lead to the development of drug resistance in pathogens, thereby reducing the effectiveness of chemical control. At the same time, it is also easy to cause pesticide residues in fruits, posing a potential threat to human health and environmental safety. The discovery and utilization of disease-resistant genes are effective, economical, and safe measures for controlling citrus anthracnose.
[0004] Kunitz-type protease inhibitor (KPI) is a class of resistance polypeptides formed by plants during long-term evolution, which can inhibit the activities of serine protease, thiol protease, and aspartic protease. Studies have found that plant protease inhibitors are closely related to plant disease resistance. Wang et al. first found that the KPI of Pseudostellaria heterophylla can inhibit the growth of the fungus Fusarium oxysporum (Wang and Ng, 2006). Currently, there are few studies on using KPI for disease-resistant breeding, and there is no research and application on using KPI to improve the resistance of citrus to anthracnose. Summary of the Invention
[0005] The present invention aims to solve the technical problem that there is a lack of research and application on using KPI to improve the resistance of citrus to anthracnose in the prior art. The purpose is to provide the overexpression of the CiKPI gene and its application in improving the resistance of citrus to anthracnose. The overexpression of CiKPI can significantly reduce the lesion size of fungal anthracnose in citrus and alleviate the incidence of citrus anthracnose. The incidence of anthracnose can be reduced to a maximum of 48.8% of that of existing citrus.
[0006] The present invention is achieved by the following technical solutions:
[0007] The first object of the present invention is to provide an overexpressed CiKPI gene, the encoded protein of the CiKPI gene is a trypsin inhibitor, and the CiKPI gene has a nucleotide sequence as shown in SEQ ID NO.1.
[0008] The second object of the present invention is to provide the application of the overexpressed CiKPI gene in improving the resistance of citrus to anthracnose, including the following application methods:
[0009] Introduce the CiKPI gene into citrus recipient cells to obtain transgenic citrus plants.
[0010] As a further technical solution of the present invention, after the overexpression of the CiKPI gene, the content of trypsin inhibitor in transgenic citrus plants increases.
[0011] As a further technical solution of the present invention, introducing the CiKPI gene into recipient citrus cells to obtain transgenic citrus plants specifically includes:
[0012] Clone the CiKPI gene;
[0013] Construct a CiKPI overexpression vector;
[0014] Transform citrus with the CiKPI overexpression vector, and identify transgenic citrus plants with improved resistance to anthracnose.
[0015] As a further technical solution of the present invention, the method for cloning the CiKPI gene includes:
[0016] Extract total RNA from citrus, reverse transcribe it into cDNA as a template, and perform PCR amplification using primers OE-CiKPI-F and OE-CiKPI-R and recover the target gene DNA fragment;
[0017] The primers OE-CiKPI-F and OE-CiKPI-R have nucleotide sequences as shown in SEQ ID NO.2 and SEQ ID NO.3 respectively.
[0018] As a further technical solution of the present invention, the CiKPI overexpression vector is pLGNe-CiKPI.
[0019] As a further technical solution of the present invention, the method for constructing the CiKPI overexpression vector is:
[0020] The target gene DNA fragment and the pLGNe vector are respectively double-digested with restriction endonucleases KpnⅠ and EcoRⅠ and then ligated to construct the overexpression vector pLGNe-CiKPI.
[0021] As a further technical solution of the present invention, the method for transforming citrus with the CiKPI overexpression vector is:
[0022] The overexpression vector of CiKPI was transformed into Agrobacterium tumefaciens by electroporation, and then the citrus explants were transformed by the Agrobacterium tumefaciens-mediated method. After genetic transformation, the adventitious buds growing from the wounds of the explants were identified by GUS staining, grafted, identified by PCR, and the expression level of CiKPI was analyzed by qRT-PCR to obtain transgenic citrus plants.
[0023] As a further technical solution of the present invention, the primers for PCR identification of transgenic plants are: GUS-F and GUS-R, which have the nucleotide sequences shown in SEQ ID NO.4 and SEQ ID NO.5 respectively.
[0024] As a further technical solution of the present invention, the primers for qRT-PCR analysis of the CiKPI expression level are: RT-CiKPI-F and RT-CiKPI-R, which have the nucleotide sequences shown in SEQ ID NO.6 and SEQ ID NO.7 respectively.
[0025] Compared with the prior art, the present invention has the following advantages and beneficial effects:
[0026] 1. In the present invention, the citrus CiKPI gene was cloned, an overexpression vector was constructed, and then citrus was transformed to obtain transgenic citrus plants. The content of trypsin inhibitor in the transgenic plants increased significantly. Overexpression of CiKPI can significantly reduce the lesion size of citrus fungal anthracnose and alleviate the incidence of citrus anthracnose. The incidence of anthracnose can be reduced to 48.8% of the existing citrus at most.
[0027] 2. The CiKPI gene provided by the present invention can be independently used for disease-resistant molecular breeding, or can be used together with other disease-resistant or disease-susceptible genes for citrus anti-anthracnose molecular breeding, which has great value for citrus anti-anthracnose molecular breeding. BRIEF DESCRIPTION OF THE DRAWINGS
[0028] In order to more clearly illustrate the technical solutions of the exemplary embodiments of the present invention, the following will briefly introduce the drawings required in the embodiments. It should be understood that the following drawings only show some embodiments of the present invention, and therefore should not be regarded as limiting the scope. For those of ordinary skill in the art, other related drawings can be obtained based on these drawings without creative efforts. In the drawings:
[0029] Figure 1 It is a schematic structural diagram of the overexpression vector of CiKPI of the present invention. Among them, GUS:NPTII represents the fusion gene of β-glucuronidase gene and neomycin phosphotransferase gene, CaMV35S represents the constitutive promoter derived from cauliflower mosaic virus, and NosT represents the terminator of the opine synthase gene;
[0030] Figure 2 This is an analysis diagram of the expression of CiKPI in the transgenic plants of the present invention, wherein ** indicates an extremely significant difference compared with the wild type (WT) (P<0.01);
[0031] Figure 3 This is a phenotype diagram of the transgenic plant of the present invention;
[0032] Figure 4 The figure shows the trypsin inhibitor content in the leaves of the transgenic plants of the present invention, wherein ** indicates that the difference is extremely significant compared with the wild type (WT) (P<0.01);
[0033] Figure 5 This is a statistical diagram of the diameter of lesions on the leaves of the transgenic plants of the present invention 5 days after inoculation with anthracnose fungi, wherein ** indicates an extremely significant difference compared with the wild type (WT) (P<0.01). DETAILED DESCRIPTION
[0034] In order to make the purpose, technical solutions and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below in conjunction with the drawings in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments.
[0035] Therefore, the following detailed description of the embodiments of the present invention provided in the accompanying drawings is not intended to limit the scope of the invention as claimed, but rather merely represents selected embodiments of the present invention. All other embodiments derived by persons of ordinary skill in the art based on the embodiments of the present invention without creative effort are intended to fall within the scope of protection of the present invention.
[0036] It should be noted that the present invention uses Wanjin orange as the experimental object. In practical applications, this method can also be used to improve the resistance of other citrus varieties to anthracnose.
[0037] Example 1
[0038] Cloning of CiKPI Gene from Citrus
[0039] 1. RNA Extraction and cDNA Synthesis
[0040] Total RNA was extracted from leaves of Clementine mandarin orange using a plant total RNA extraction kit (Adlai, CAT: RN09). The RNA quality was verified by agarose gel electrophoresis and the RNA concentration was determined using Nanodrop 2000 Thermo. 500 ng of RNA was used to extract the total RNA using iScript TM cDNA Synthesis Kit (Bio-Rad, Hercules, CA, USA) synthesized 10 μL cDNA.
[0041] 2. PCR Amplification of CiKPI Coding Sequence
[0042] Amplify from citrus cDNA using primers OE-CiKPI-F (SEQ ID NO.2), OE-CiKPI-R (SEQ ID NO.3) and high-fidelity enzyme PrimeSTAR Max DNA Polymerase (TaKaRa, CAT: R045Q) to obtain a DNA fragment of CiKPI coding sequence with a length of 660 bp. Under ultraviolet light, cut the agarose gel block containing the target fragment with a clean blade, and use a kit (BioFlux, CAT: BSC02M1) to recover the target gene DNA fragment. The recovered target gene DNA fragment was determined to be the coding sequence of citrus CiKPI gene (SEQ ID NO.1) by sequencing.
[0043] The PCR amplification program is: 95°C, 3 min; 95°C, 30 s, 60°C, 30 s, 72°C, 30 s, 32 cycles; 72°C extension for 10 min.
[0044] Example 2
[0045] Construction of CiKPI Overexpression Vector and Transformation into Agrobacterium
[0046] The CiKPI coding sequence DNA fragment and pLGNe vector were double digested with restriction enzymes KpnⅠ and EcoRⅠ (ThermoFisher), then subjected to gel recovery and ligated overnight at 16°C. The ligation was carried out using T4 DNA Ligase kit (Promega, CAT: M1801), and the ligation product was transformed into Escherichia coli DH5α. The plasmid of positive clone was extracted using a plasmid extraction kit (Omega, CAT: D6942), digested with KpnI and EcoRI, and the plasmid whose digestion product contained a 660 bp fragment was determined to be the overexpression vector pLGNe-CiKPI( Figure 1 ). The pLGNe-CiKPI plasmid was introduced into Agrobacterium strain EHA105 by electroporation, and the bacterial solution was stored in a -80°C freezer.
[0047] Example 3
[0048] Genetic Transformation of Citrus with CiKPI Overexpression Vector
[0049] 1. Obtaining of Epicotyls of Citrus Seedlings
[0050] Fresh citrus fruits were washed, surface disinfected with 70% alcohol, and seeds were taken out under sterile conditions. The seed coats were removed, and the seeds were germinated on a seed germination medium, and dark-cultured at 28 °C for 2 weeks, and then cultured under the conditions of 16 h light / 8 h darkness for 1 week; The epicotyls of the germinated seedlings were cut into 1-cm stem segments under sterile conditions for Agrobacterium tumefaciens-mediated genetic transformation.
[0051] 2. Preparation of Agrobacterium tumefaciens suspension
[0052] Before transfection, the Agrobacterium tumefaciens (containing the pLGNe-CiKPI plasmid) for transfection was streaked on an LB solid medium containing 50 mg / L kanamycin; single colonies were picked and inoculated into 25 mL of an LB liquid medium containing the same antibiotic, and cultured overnight with shaking at 28 °C; the bacterial suspension was diluted to OD = 0.1 and then continued to be cultured until OD = 0.5, centrifuged at 5000 r / min for 10 min, the supernatant was discarded, and the cells were resuspended with an MS liquid medium at pH 5.4 for transfection.
[0053] 3. Transformation of citrus epicotyls
[0054] The citrus epicotyl stem segments were soaked in the Agrobacterium tumefaciens suspension for 13 min and then dried, and the stem segments were transferred to a co-culture medium and dark-cultured at 26 °C for 3 d; after co-culture, the epicotyls were transferred to a selection medium and dark-cultured at 28 °C for 7 d. The epicotyls were cultured at 28 °C under the conditions of 16 h light / 8 h darkness and subcultured every two weeks, and then the adventitious buds growing on the explant ports were identified by GUS staining.
[0055] The GUS staining solution contains the following components: 100 mM NaH2PO4, 100 mM Na2HPO4, 0.5 mM K4[Fe(CN)6], 0.5 mM K3[Fe(CN)6], 10 mM EDTA-Na2, 1 mM X-gluc, 0.1% Sodium azide, 0.1% Triton-100.
[0056] 4. Seedling culture of transformants
[0057] When the GUS-positive buds grew to more than 1 cm, they were cut off and grafted onto the seedlings of late Jincheng oranges in sterile test tubes, and cultured in a seedling culture medium; when the seedlings grew to about 5 cm, they were grafted onto the seedlings of trifoliate orange seedlings and cultured in a greenhouse at 28 °C.
[0058] The media used in this example are as follows:
[0059] Seed germination medium: MS + 30 g / L sucrose + 2.5 g / L Gelrite, pH 5.8.
[0060] Co-culture medium: MS + 2 mg / L BA + 0.5 mg / L IAA + 1 mg / L 2,4–D + 100 μmol AS + 30 g / L sucrose + 2.5 g / L Gelrite, pH 5.8.
[0061] Screening medium: MS + 2 mg / L BA + 0.5 mg / L IAA + 500 mg / L Cef + 50 mg / L Kan + 30 g / L sucrose + 2.5 g / L Gelrite, pH 5.8.
[0062] Seedling medium: MS + 30g / L sucrose, pH 5.8.
[0063] Example 4
[0064] Verification of CiKPI overexpressing transgenic plants
[0065] 1. PCR Identification of Transgenic Plants
[0066] Genomic DNA was extracted from 100 mg of transgenic plant leaves using a DNA extraction kit (Adlai, Cat: DN15). PCR was then performed to detect the integration of the GUS sequence into the citrus genome. The primers used were GUS-F (SEQ ID NO. 4) and GUS-R (SEQ ID NO. 5). Amplified fragments of approximately 500 bp were obtained from positive plants, while no such fragments were observed in WT plants.
[0067] PCR reaction conditions: 95°C for 3 min; 30 cycles of 95°C for 30 s, 58°C for 30 s, and 72°C for 30 s; and 72°C for 10 min.
[0068] 2. qRT-PCR Analysis of Transgenic Plants
[0069] Total RNA (Adlai, CAT No: RN09) was extracted from leaves of PCR-positive plants, and the RNA quality was verified by agarose gel electrophoresis and its concentration was determined using a NanoDrop 2000 Thermo concentration meter. 500 ng of RNA was used to analyze the RNA using iScript TMThe cDNA Synthesis Kit (Bio-Rad, Hercules, CA, USA) was used to synthesize 10 μL of cDNA, which was diluted 5-fold. The expression level of the CiKPI gene was detected by real-time fluorescence quantitative PCR. The primers used were RT-CiKPI-F (SEQ ID NO.6) and RT-CiKPI-R (SEQ ID NO.7). The reference gene for quantitative PCR was the citrus Actin gene, and the primers used were Actin-F (SEQ ID NO.8) and Actin-R (SEQ ID NO.9). Reaction system: iTaqTM Universal 6 μL, 0.3 μL each of 100 μmol / L RT-CiKPI-FR and T-CiKPI-F primers, 1 μL of cDNA, and ddH2O was added to make up to 12 μL. Reaction conditions: 95 °C for 3 min, 94 °C for 10 s; 56 °C for 10 s, 72 °C for 10 s, 40 cycles; 72 °C for 10 min. The experiment was repeated three times. Using the WT plants as a reference, the relative expression level of the CiKPI gene in the transgenic plants was calculated by the 2 -△△Ct -method.
[0070] The results showed that the CiKPI gene was highly expressed in the transgenic plants compared to the WT plants (up to more than 10,000 times that of the control) ( Figure 2 ).
[0071] Example 5
[0072] Observation of the performance of transgenic plants and determination of the content of trypsin inhibitor
[0073] 1. Phenotype observation of transgenic plants
[0074] The phenotypes of 3 transgenic plants were observed and analyzed, and no obvious abnormalities were found in appearance and growth trend ( Figure 3 ). It shows that overexpression of the CiKPI gene has no obvious effect on the phenotype and development of the plants.
[0075] 2. Determination of the content of trypsin inhibitor in transgenic plants
[0076] The content of trypsin inhibitor in transgenic plants was detected using a plant trypsin inhibitor (Trasylol) enzyme-linked immunosorbent assay kit (the kit was purchased from Jiangsu Enzyme Immunoassay Industry Co., Ltd., model: MM-0633O1).
[0077] The results showed that after overexpression of CiKPT, the content of trypsin inhibitor in transgenic plants increased significantly ( Figure 4 ).
[0078] Example 6
[0079] Resistance Evaluation of Transgenic Plants with Overexpressed CiKPI
[0080] For each transgenic plant, 10 young leaves were taken, washed and rinsed with sterile water, and placed in a laminar flow hood. Two fungal cakes containing Colletotrichum gloeosporioides spores with a diameter of 5 mm were inoculated on each leaf. The inoculated leaves were placed in a tray lined with absorbent cotton, covered with plastic wrap, and cultured at 28 °C with humidity. The diameter of the lesion was measured on the 5th day. The experiment was repeated 3 times.
[0081] The results showed that 5 days after inoculation with Colletotrichum gloeosporioides, both the overexpressing plants and the WT plants grafted at the same time showed varying degrees of disease after inoculation with Colletotrichum gloeosporioides, and there were certain differences in the diameter of the lesions. After statistical analysis, it was found that the diameter of the lesions of the transgenic plants was significantly smaller than that of the WT control, accounting for 48.8%-62.9% of the control ( Figure 5 ). Thus, it can be seen that overexpression of CiKPI can significantly reduce the size of the lesions of citrus fungal anthracnose and alleviate the incidence of citrus anthracnose.
[0082] Thus, it can be seen that overexpression of CiKPI can greatly reduce the diameter of the lesions of anthracnose and alleviate the incidence of anthracnose. This gene can be independently used for disease-resistant molecular breeding, or can be used together with other disease-resistant or disease-susceptible genes for citrus anti-anthracnose molecular breeding.
[0083] The following is the nucleotide sequence involved in the present invention:
[0084] SEQ ID NO.1:
[0085] ATGAAGACTCCTTTTGTGATGGCAATCTCCTTCCTTCTTCTTGCCTTTGCCGCAAAGCCTCTTGTGGGAAGCCGTTTGCATGATATCAATGGCGACGATGTCCGAGCAGACCAAGAATACTATGTTTTGGAAAGTGGCAACGGCCGTGGTTTAACCACCTTGCGGCACAGAGGCGATTCCTGCCCACTTGATGTTGCCCAAGTAACATCCGCACCACGTACAGGAAAGCCTTTAAAATTCAAAGCGTATAACAGCAGTCGTTTTATCTATGAAGCCGTGGATCTGAATGTGAAATTCTCGATAGTCGATTCCTGCTCTGATTCACTAGTATGGAAGGTTGACAACTATGACGAAGAGAGAGGAAAATGGTTTATAACAACTGGTGGAAATGAAGGAGACCCTGGAGCTAAAACTTTGCTAAACTGGTTCAAATTTGAGAGAATTGGGACAAGCGATCCAGCCACATACAGGATTGTTTATTGCCCTTCAGTTTGTGCTTCCTGCCTATTTCTCTGCCAGAATGTTGGGGTTTCTTTTGAAGACAGTGCTCGACGTTTGGTTCTCAAGGCGGATTATGAGCCTGTGTTTCCTGTTGTTATATTCCCGGCTGAAGGAGCAGCTAAATGCGAGTCTCGAATGCCCGTGCATTATAACTCTTAG
[0086] SEQ ID NO.2:
[0087] GGTACCATGAAGACTCCTTTTGTGATGGC
[0088] SEQ ID NO.3:
[0089] GAATTCCTAAGAGTTATAATGCACGGG
[0090] SEQ ID NO.4:
[0091] 5′-AGTCTTACTTCCATGATTTC-3′
[0092] SEQ ID NO.5:
[0093] 5′-TAGGAGTTGGCCCCAATCCA-3′
[0094] SEQ ID NO.6:
[0095] TGCTCGACGTTTGGTTCTCA
[0096] SEQ ID NO.7:
[0097] ACTCGCATTTAGCTGCTCCT
[0098] SEQ ID NO.8:
[0099] 5′-CATCCCTCAGCACCTTCC-3′
[0100] SEQ ID NO.9:
[0101] 5′-CCAACCTTAGCACTTCTCC-3′
[0102] The specific embodiments described above further elaborate on the purpose, technical solution, and beneficial effects of the present invention. It should be understood that the above are only specific embodiments of the present invention and are not used to limit the protection scope of the present invention. Any modifications, equivalent replacements, improvements, etc. made within the spirit and principle of the present invention shall be included within the protection scope of the present invention.
Claims
1. Overexpression CiKPI Application of the gene in improving the resistance of citrus to anthracnose, characterized in that The said CiKPI The nucleotide sequence of the gene is shown in SEQ ID NO.1 and includes the following application methods: Introduce CiKPI genes into citrus recipient cells to obtain transgenic citrus plants.
2. Use of the overexpressed CiKPI gene in enhancing the resistance of citrus to anthracnose, characterized in that CiKPI After gene overexpression, the content of trypsin inhibitor in transgenic citrus plants increased.
3. Use of the overexpressed CiKPI gene in enhancing the resistance of citrus to anthracnose, characterized in that Introduce CiKPI the gene into recipient citrus cells to obtain transgenic citrus plants, specifically including: Clone CiKPI gene; Construct CiKPI Overexpression vector; CiKPI Overexpressing vectors were used to transform citrus, and transgenic citrus plants with improved anthracnose resistance were obtained through identification.
4. Use of the overexpressed CiKPI gene in enhancing the resistance of citrus to anthracnose, characterized in that Cloning CiKPI The methods for Extract total RNA from citrus, reverse transcribe it into cDNA as a template, and use primers OE- CiKPI -F and OE- CiKPI -R to perform PCR amplification and recover the target gene DNA fragment; Primer OE- CiKPI -F and OE- CiKPI -R have nucleotide sequences shown in SEQ ID NO.2 and SEQ ID NO.3, respectively.
5. Use according to claim 3 of overexpression CiKPI of the gene in enhancing the resistance of citrus to anthracnose, characterized in that CiKPI The overexpression vector is pLGNe- CiKPI .
6. Use of the overexpressed CiKPI gene in enhancing the resistance of citrus to anthracnose, characterized in that CiKPI The construction method of the overexpression vector is as follows: The target gene DNA fragment and the pLGNe vector were respectively double digested with restriction endonucleases Kpn Ⅰ and EcoR Ⅰ, and then ligated to construct the overexpression vector pLGNe- CiKPI .
7. Use of the overexpressed CiKPI gene in enhancing the resistance of citrus to anthracnose, characterized in that CiKPI The method for transforming citrus with an overexpression vector is as follows: CiKPI The overexpression vector was transformed into Agrobacterium tumefaciens by electroporation, and then the citrus explants were transformed by Agrobacterium-mediated transformation. The adventitious buds growing from the wounds of the explants after genetic transformation were identified by GUS staining, grafted, identified by PCR, and analyzed by qRT-PCR CiKPI After determining the expression level, transgenic citrus plants were obtained.
8. Use of the overexpressed CiKPI gene in enhancing the resistance of citrus to anthracnose, characterized in that The primers for PCR identification of transgenic plants are: GUS-F and GUS-R, and the nucleotide sequences are shown in SEQ ID NO.4 and SEQ ID NO.5 respectively.
9. Use of the overexpressed CiKPI gene in enhancing the resistance of citrus to anthracnose, characterized in that qRT-PCR analysis CiKPI The primers for expression level are: RT- CiKPI -F and RT- CiKPI -R, and the nucleotide sequences are shown in SEQ ID NO.6 and SEQ ID NO.7 respectively.