Nucleic acids, recombinant vectors, targeted integration cells, gene expression methods and applications
By using targeted integration technology in host cells and using recombinase to site-directly integrate exogenous nucleic acid fragments, the problems of long time, high cost and instability caused by traditional random integration are solved, and efficient and stable cell line construction and high yield expression are achieved.
Patent Information
- Application Number
- CN202311493439.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Priority Date
- 2023-03-28
- Filing Date
- 2023-11-09
- Publication Date
- 2025-07-08
- Estimated Expiration
- 2043-11-09
AI Technical Summary
When building host cell lines, random integration leads to long-term generation, high cost, unstable copy number, uncertain expression levels, difficult to predict, resulting in low productivity.
Nucleic acid fragments are used for targeted integration, and exogenous nucleic acid fragments are site-directed to specific sites through recombinant enzymes such as Bxb1 integrase, and combined with selectable marker genes and promoters to build stable and high-yield targeted integrated cells.
It realizes rapid construction and efficient expression of cell lines, reduces costs, improves production efficiency and expression stability, and simplifies subsequent process development.
Smart Images

Figure CN118726475B_ABST
Abstract
Description
[0001] Cross - reference to related applications
[0002] This application claims the priority of a Chinese patent application with the application number 2023103474969, titled "Nucleic Acid, Recombinant Vector, Targeted Integration Cell, Gene Expression Method and Application", filed with the Chinese Patent Office on March 28, 2023, the entire content of which is incorporated herein by reference. Technical field
[0003] This application relates to the field of biotechnology, and particularly to a nucleic acid, a recombinant vector containing the same, a targeted integration cell, and a method and application for producing a target gene expression product. Background art
[0004] Host cells (such as Chinese hamster ovary cells) have always been the main standard expression platform for producing recombinant proteins. The traditional method for developing suitable host cells is to randomly insert the target gene into the genome and then selectively culture the cells carrying the transgene. However, during the implementation of the traditional method: in the cell line generation stage of the upstream process, a non - targeted transgene integration method is used to generate a pool of stably transfected cells, and then multiple clones are obtained through monoclonal means, and then multiple clones are screened in a cumbersome manner to determine the clones with suitable production characteristics; in the subsequent process, process development and medium optimization need to be carried out for each cell line, consuming a large amount of repetitive labor, with high costs and causing waste of resources. In terms of the quality of the prepared cell line, the expression stability of the cell line obtained by this method is difficult to predict during the culture process. Moreover, the information of the random integration site is not clear, and the site effect of the exogenous target gene integration will also lead to a significant decrease in the expression level of the target gene.
[0005] Overall, using the traditional random integration method to construct a cell line usually takes more than 6 months to possibly obtain a stable cell line. Random integration has the disadvantages of extremely large workload, extremely high cost, unstable copy number and site, and there are also uncertainties in the impact of the site on cell physiology, all of which may lead to the loss of the target gene during the growth process of the produced cell line and the loss of production value.
[0006] In view of this, this application is specifically proposed. Summary of the invention
[0007] One of the purposes of the embodiments of this application is to provide a nucleic acid, and a host cell containing this nucleic acid can stably and highly express an exogenous nucleic acid fragment integrated into SEQ ID No.1.
[0008] In the first aspect of this application, a nucleic acid is provided, and the nucleic acid contains a nucleic acid fragment shown in SEQ ID No.1, and the nucleic acid fragment is used for integrating an exogenous nucleic acid fragment.
[0009] In some embodiments of the present application, the integration site of the exogenous nucleic acid fragment corresponds to any site within the base interval of the 11th to 430th bases of the nucleic acid fragment.
[0010] In some embodiments of the present application, the integration site of the exogenous nucleic acid fragment corresponds to any site within the base interval of the 21st to 414th bases of the nucleic acid fragment.
[0011] In some embodiments of the present application, the integration site of the exogenous nucleic acid fragment corresponds to any site within the base interval of the 38th to 402nd bases of the nucleic acid fragment.
[0012] In some embodiments of the present application, the integration site of the exogenous nucleic acid fragment corresponds to any site within the base interval of the 53rd to 389th bases of the nucleic acid fragment.
[0013] In some embodiments of the present application, the integration site of the exogenous nucleic acid fragment corresponds to any site within the base interval of the 73rd to 373rd bases of the nucleic acid fragment.
[0014] In some embodiments of the present application, the integration site of the exogenous nucleic acid fragment corresponds to any site within the base interval of the 91st to 360th bases of the nucleic acid fragment.
[0015] In some embodiments of the present application, the integration site of the exogenous nucleic acid fragment corresponds to any site within the base interval of the 108th to 342nd bases of the nucleic acid fragment.
[0016] In some embodiments of the present application, the integration site of the exogenous nucleic acid fragment corresponds to any site within the base interval of the 126th to 326th bases of the nucleic acid fragment.
[0017] In some embodiments of the present application, the integration site of the exogenous nucleic acid fragment corresponds to any site within the base interval of the 143rd to 310th bases of the nucleic acid fragment.
[0018] In some embodiments of the present application, the integration site of the exogenous nucleic acid fragment corresponds to any site within the base interval of the 160th to 295th bases of the nucleic acid fragment.
[0019] In some embodiments of the present application, the integration site of the exogenous nucleic acid fragment corresponds to any site within the base interval of the 178th to 274th bases of the nucleic acid fragment.
[0020] In some embodiments of the present application, the integration site of the exogenous nucleic acid fragment corresponds to any site within the base interval of the 194th to 263rd bases of the nucleic acid fragment.
[0021] In some embodiments of the present application, the integration site of the exogenous nucleic acid fragment corresponds to any site within the base interval of positions 209-253 of the nucleic acid fragment.
[0022] In some embodiments of the present application, the integration site of the exogenous nucleic acid fragment corresponds to any site within the base interval of positions 221-242 of the nucleic acid fragment.
[0023] In some embodiments of the present application, the integration site of the exogenous nucleic acid fragment corresponds to any site within the base interval of positions 231-240 of the nucleic acid fragment.
[0024] In some embodiments of the present application, the integration site of the exogenous nucleic acid fragment corresponds to the NW_003616785.1:83044 site within the nucleic acid fragment.
[0025] In some embodiments of the present application, the integration site of the exogenous nucleic acid fragment corresponds to the NW_003616785.1:83044 site within the nucleic acid fragment in CHO cells.
[0026] In some embodiments of the present application, the exogenous nucleic acid fragment comprises: a first recombination recognition sequence and a second recombination recognition sequence, a selection marker gene and / or a target gene located between the first recombination recognition sequence and the second recombination recognition sequence, and a promoter regulating the expression of the selection marker gene and / or the target gene.
[0027] In some embodiments of the present application, the exogenous nucleic acid fragment comprises a selection marker gene located between the first recombination recognition sequence and the second recombination recognition sequence, and a promoter regulating the expression of the selection marker gene.
[0028] In some embodiments of the present application, the exogenous nucleic acid fragment comprises a target gene located between the first recombination recognition sequence and the second recombination recognition sequence, and a promoter regulating the expression of the target gene.
[0029] In some embodiments of the present application, the exogenous nucleic acid fragment comprises a selection marker gene and a target gene located between the first recombination recognition sequence and the second recombination recognition sequence, and a promoter regulating the expression of the selection marker gene and the target gene.
[0030] In some embodiments of the present application, the first recombination recognition sequence and the second recombination recognition sequence are generated by a recombinase; optionally, the recombinase is Bxb1 integrase, ΦC31 integrase, Cre recombinase or FLP recombinase; optionally, the recombinase is Bxb1 integrase;
[0031] Or / and,
[0032] The first recombination recognition sequence and the second recombination recognition sequence are each independently selected from one or more of the following sequences: LoxP sequence, LoxPL3 sequence, LoxP 2L sequence, LoxFas sequence, Lox511 sequence, Lox2272 sequence, Lox2372 sequence, Lox5171 sequence, Loxm2 sequence, Lox71 sequence, Lox66 sequence, FRT sequence, Bxb1 attP sequence, Bxb1 attB sequence, attP sequence, attB, attL and attR sequences; optionally, the first recombination recognition sequence and the second recombination recognition sequence are each independently selected from attR and attL sequences; optionally, the first recombination recognition sequence is attR and the second recombination recognition sequence is attL. In some embodiments of the present application, the selection marker gene is selected from one or more of neomycin resistance gene, thymidine kinase gene, hygromycin phosphotransferase gene, dihydrofolate reductase gene, thymidine kinase gene, glutamine synthetase gene, asparagine synthetase gene, tryptophan synthetase gene, histidinol dehydrogenase gene, aminoglycoside phosphotransferase gene, tryptophan synthetase gene and fluorescent protein gene; optionally, the selection marker gene is a fluorescent protein gene.
[0033] In some embodiments of the present application, the promoter is CMV promoter, SV40 promoter, RSV promoter, β-globin promoter, UBC promoter, EF1a promoter, ubiquitin promoter, β-actin promoter, PGK1 promoter, Rosa26 promoter, HSP70 promoter, GAPDH promoter, Eif4A1 promoter, Egr1 promoter, FerH promoter, SM22α promoter or Endothelin-1 promoter.
[0034] In some embodiments of the present application, the target gene encodes one or more of an antibody, a recombinant protein, a polypeptide, an enzyme, a hormone, a growth factor and a receptor; optionally, the target gene encodes an antibody; optionally, the nucleotide sequence of the target gene is as shown in SEQ ID No.2.
[0035] In some embodiments of the present application, the nucleotide sequence of the nucleic acid contains the nucleotide sequence as shown in SEQ ID No.3.
[0036] In some embodiments of the present application, the nucleotide sequence of the nucleic acid contains the nucleotide sequence as shown in SEQ ID No.7.
[0037] In some embodiments of the present application, the nucleotide sequence of the nucleic acid contains the nucleotide sequence as shown in SEQ ID No.9.
[0038] In a second aspect of the present application, there is provided a recombinant vector, which comprises the nucleic acid described in the first aspect, and the nucleic acid further comprises the first recombination recognition sequence and the second recombination recognition sequence; the exogenous nucleic acid fragment comprises a target gene and / or a selectable marker gene.
[0039] In some embodiments of the present application, the exogenous nucleic acid fragment is a target gene; the first recombination recognition sequence is a 5' homologous arm homologous to the sequence fragment present in the nucleic acid fragment shown in SEQ ID No. 1; the second recombination recognition sequence is a 3' homologous arm homologous to the sequence fragment present in the nucleic acid fragment shown in SEQ ID No. 1; optionally, the 5' homologous arm is attR and the 3' homologous arm is attL.
[0040] In some embodiments of the present application, the exogenous nucleic acid fragment is a selectable marker gene; the first recombination recognition sequence is a 5' homologous arm homologous to the sequence fragment present in the nucleic acid fragment shown in SEQ IDNo. 1; the second recombination recognition sequence is a 3' homologous arm homologous to the sequence fragment present in the nucleic acid fragment shown in SEQ ID No. 1; optionally, the 5' homologous arm is attP and the 3' homologous arm is attP-GA.
[0041] In some embodiments of the present application, the recombinant vector is a lentiviral vector, an adenoviral vector, an adeno-associated viral vector, a herpes viral vector, a poxviral vector, a baculoviral vector, a papillomaviral vector, a polyomavirus vector, an integrative phage vector, a non-viral vector, a transposon and / or a transposase, an integrase substrate or a plasmid.
[0042] In a third aspect of the present application, there is provided a targeted integration cell, which comprises the nucleic acid described in the first aspect.
[0043] In some embodiments of the present application, the targeted integration cell is a eukaryotic cell;
[0044] In some embodiments of the present application, the eukaryotic cell is a mammalian cell;
[0045] In some embodiments of the present application, the mammalian cell includes Chinese hamster ovary CHO cells and human embryonic kidney HEK293 cells; optionally, the targeted integration cell is Chinese hamster ovary CHO cells.
[0046] In a fourth aspect of the present application, there is provided a method for preparing the targeted integration cell described in the third aspect, and the preparation method comprises the following steps:
[0047] Introduce the nucleic acid described in the first aspect into cells, or provide cells containing the nucleic acid fragment shown in SEQ ID No.1 and integrate the exogenous nucleic acid fragment into the nucleic acid fragment to prepare targeted integration cells.
[0048] In the fifth aspect of the present application, a method for producing a target gene expression product is provided. The method includes the following steps: culturing the targeted integration cells described in the third aspect and collecting the expression product of the target gene in the exogenous nucleic acid fragment.
[0049] In the sixth aspect of the present application, an application of the nucleic acid described in the first aspect in the preparation of a protein or polypeptide is provided, and the protein or polypeptide is expressed by the exogenous nucleic acid fragment.
[0050] Compared with the traditional technology, the present application has the following beneficial effects:
[0051] In the early stage of this application, a large number of cell lines were screened and it was found that for the nucleic acid fragment shown in SEQ ID No.1 or a homologous fragment with at least 90% identity thereto, integrating an exogenous nucleotide sequence (such as a fusion protein and a monoclonal antibody) into the nucleic acid fragment or its homologous fragment, the corresponding targeted integration cells all have the characteristics of high consistency, stability and high yield. Based on these advantages, it has low requirements for subsequent culture processes (such as culture conditions and culture medium formulations).
[0052] At the same time, the present application provides targeted integration cells with a determined insertion site of the exogenous nucleotide fragment. Therefore, compared with the traditional method of constructing cells by random integration, the construction process of the targeted integration cells in the present application is simple, the time consumption is shortened, the efficiency is improved, the cost is reduced, and the uncertainty is reduced, with good repeatability and strong controllability. Description of the Drawings
[0053] In order to more clearly illustrate the technical solutions in the embodiments of the present application and more fully understand the present application and its beneficial effects, the following will briefly introduce the drawings required for the description of the embodiments. Obviously, the following drawings are only some embodiments of the present application, and those skilled in the art can obtain other drawings based on these drawings without creative efforts.
[0054] Figure 1 It is the process flow chart in the embodiment of the present application;
[0055] Figure 2 It is the plasmid map for screening integration sites in the embodiment of the present application;
[0056] Figure 3 It is the plasmid map of the product transfection in the embodiment of the present application;
[0057] Figure 4Statistical chart of the protein expression level of the integrated cells of target gene 1 in the embodiments of the present application;
[0058] Figure 5 Verification diagram of the continuous passage stability of the integrated cells of target gene 1 in the embodiments of the present application;
[0059] Figure 6 Electrophoresis diagram of the integrated cells of target gene 1 in the embodiments of the present application;
[0060] Figure 7 Electrophoresis diagram of the integrated cells of target genes 2 and 3 in the embodiments of the present application. Detailed implementation manners
[0061] The present application will be further described in detail below with reference to the drawings, implementation manners and examples. It should be understood that these implementation manners and examples are only used to illustrate the present application and not to limit the scope of the present application. The purpose of providing these implementation manners and examples is to make the disclosure content of the present application more thoroughly and comprehensively understood. It should also be understood that the present application can be implemented in many different forms and is not limited to the implementation manners and examples described herein. Those skilled in the art can make various changes or modifications without departing from the connotation of the present application, and the equivalent forms obtained also fall within the protection scope of the present application. In addition, in the following description, a large number of specific details are given to provide a more thorough understanding of the present application. It should be understood that the present application can be implemented without one or more of these details.
[0062] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the technical field to which the present application belongs. The terms used in the specification of the present application herein are only for the purpose of describing the implementation manners and examples and are not intended to limit the present application.
[0063] Term
[0064] Unless otherwise stated or there is a contradiction, the terms or phrases used herein have the following meanings:
[0065] As used herein, the selection range of the terms "and / or", "or / and", and "and / or" includes any one of two or more related listed items, and also includes any and all combinations of the related listed items. The said any and all combinations include combinations of any two related listed items, any more related listed items, or all related listed items. It should be noted that when at least three items are connected by at least two conjunctive combinations selected from "and / or", "or / and", and "and / or", it should be understood that in this application, this technical solution undoubtedly includes the technical solution connected by "logical AND", and undoubtedly also includes the technical solution connected by "logical OR". For example, "A and / or B" includes three parallel solutions: A, B, and A + B. Another example is the technical solution of "A, and / or, B, and / or, C, and / or, D", which includes any one of A, B, C, and D (that is, the technical solution connected by "logical OR"), and also includes any and all combinations of A, B, C, and D, that is, it includes combinations of any two or any three of A, B, C, and D, and also includes the four-item combination of A, B, C, and D (that is, the technical solution connected by "logical AND").
[0066] In this application, the terms "multiple", "multiple types", "multiple times", "multiple elements", etc., unless otherwise specified, mean greater than or equal to 2 in quantity. For example, "one or more" means one or greater than or equal to two.
[0067] As used herein, "its combination", "any combination thereof", "any combination mode thereof", etc. include all suitable combination modes of any two or any two or more of the listed items.
[0068] In this article, the "suitable" in "suitable combination mode", "suitable mode", "any suitable mode", etc. is subject to being able to implement the technical solution of this application, solve the technical problems of this application, and achieve the expected technical effects of this application.
[0069] In this article, "preferred", "better", "more preferable", "preferably" are only used to describe the implementation modes or examples with better effects, and it should be understood that they do not constitute a limitation on the protection scope of this application.
[0070] In this application, "further", "furthermore", "especially", etc. are used for descriptive purposes and represent differences in content, but should not be understood as a limitation on the protection scope of this application.
[0071] In this application, "optionally", "optional", "optional" mean that it can be either there or not, that is, it refers to any one of the two parallel solutions of "yes" or "no". If "optional" appears multiple times in a technical solution, unless otherwise specified and there is no contradiction or mutual restriction relationship, each "optional" is independent of each other.
[0072] In this application, in "the first aspect", "the second aspect", "the third aspect", "the fourth aspect", etc., the terms "first", "second", "third", "fourth", etc. are only for descriptive purposes and cannot be construed as indicating or implying relative importance or quantity, nor can they be construed as implicitly specifying the importance or quantity of the indicated technical features. Moreover, "first", "second", "third", "fourth", etc. only serve the purpose of non-exhaustive enumerative description and should be understood not to constitute a closed limitation on quantity.
[0073] In this application, among the technical features described in an open-ended manner, there are included closed technical solutions composed of the listed features, as well as open technical solutions containing the listed features.
[0074] In this application, regarding numerical intervals (i.e., numerical ranges), unless otherwise specified, the selectable numerical values are considered continuous within the above numerical intervals and include the two numerical endpoints (i.e., the minimum value and the maximum value) of the numerical range, as well as each numerical value between these two numerical endpoints. Unless otherwise specified, when the numerical interval only refers to integers within the numerical interval, it includes the two endpoint integers of the numerical range, as well as each integer between the two endpoints. In this article, it is equivalent to directly listing each integer. For example, when t is an integer selected from 1 to 10, it means that t is any integer selected from the integer group composed of 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10. In addition, when multiple ranges are provided to describe features or characteristics, these ranges can be combined. In other words, unless otherwise specified, the ranges disclosed in this article should be understood to include any and all sub-ranges subsumed therein.
[0075] For the temperature parameters in this application, unless otherwise specified, both constant temperature treatment and fluctuations within a certain temperature range are allowed. It should be understood that the constant temperature treatment allows the temperature to fluctuate within the accuracy range controlled by the instrument. Fluctuations within ranges such as ±5°C, ±4°C, ±3°C, ±2°C, ±1°C are allowed.
[0076] In this application, %(w / w) and wt% both represent weight percentages, %(v / v) refers to volume percentages, and %(w / v) refers to mass-volume percentages.
[0077] As used in this application, "about" or "approximately" means within an acceptable error range of a particular value as determined by one of ordinary skill in the art, which depends in part on how the value is measured or determined, i.e., the limitations of the measurement system. For example, in accordance with the practice in the art, "about" can mean within three or more standard deviations. Alternatively, "about" can mean a range of up to 20%, preferably up to 10%, more preferably up to 5%, and even more preferably up to 1% of a given value. Alternatively, especially with respect to biological systems or processes, the term can mean within an order of magnitude of the value, preferably within five-fold, and more preferably within two-fold.
[0078] As used in this application, a "selectable marker gene" can be a gene that allows a targeted integration cell carrying the gene to be specifically selected for or against the gene in the presence of the corresponding selection agent. For example but not limited to, a selectable marker can allow a targeted integration cell transformed with the selectable marker gene to be positively selected in the presence of the gene; non-transformed targeted integration cells will not be able to grow or survive under selection conditions. A selectable marker can be positive, negative, or bifunctional. A positive selectable marker can allow selection of cells carrying the marker, while a negative selectable marker can allow cells carrying the marker to be selectively eliminated. A selectable marker can confer resistance to a drug or compensate for a metabolic or catabolic defect in a targeted integration cell.
[0079] As used in this application, the term "antibody" is used in its broadest sense and includes a variety of antibody structures, including but not limited to monoclonal antibodies, polyclonal antibodies, multispecific antibodies (e.g., bispecific antibodies), diabodies, and antibody fragments, provided that the fragments exhibit the desired antigen-binding activity. As used herein, the term "antibody fragment" refers to a molecule other than a full antibody that comprises a portion of a full antibody that binds the antigen to which the full antibody binds. Examples of antibody fragments include but are not limited to Fv, Fab, Fab', Fab'-SH, F(ab')2; diabodies; linear antibodies; single-chain antibody molecules (e.g., scFv); and multispecific antibodies formed from antibody fragments. For a review of certain antibody fragments, see Holliger and Hudson, Nature Biotechnology 23:1126-1136 (2005).
[0080] As used in this application, the term "targeted integration cell" refers to a cell into which exogenous nucleic acid has been introduced, including progeny of such cells. Targeted integration cells include "transformants" and "transformed cells", which include primary transformed cells and progeny derived therefrom, regardless of the number of passages. The nucleic acid content of the progeny may not be identical to that of the parental cell, but may contain mutations. Mutant progeny having the same function or biological activity as that screened or selected for in the initial transformed cell are included herein.
[0081] In the present application, the term "vector" refers to a nucleic acid molecule capable of propagating another nucleic acid to which it is linked. The term includes vectors that are self-replicating nucleic acid structures and vectors that are incorporated into the genome of a target integration cell into which they have been introduced. In certain embodiments, the vector directs the expression of a nucleic acid operably linked thereto. Such vectors are referred to herein as "expression vectors".
[0082] In the present application, the term "homologous fragment" refers to a sequence fragment that has significant sequence similarity as determined by sequence alignment. For example, two sequence fragments can be about 50%, 60%, 70%, 80%, 90%, 95%, 99% or 99.9% homologous. Alignment is performed by algorithms and computer programs (including but not limited to BLAST, FASTA and HMME), which compare sequence fragments and calculate the statistical significance of the match based on factors such as sequence length, sequence identity and similarity, and the presence and length of sequence mismatches and gaps; for example, it can be the ratio of the length of the similar sequence fragment to the length of the aligned region. Homologous sequence fragments can refer to both DNA and protein sequences.
[0083] The presently disclosed subject matter provides target integration cells suitable for exogenous nucleotide sequences. In certain embodiments, the target integration cell comprises an exogenous nucleotide sequence integrated at an integration site on the genome of a host cell. "Integration site" comprises a nucleic acid sequence within the genome of the target integration cell into which the exogenous nucleotide sequence is inserted. In certain embodiments, the integration site is between two adjacent nucleotides on the genome of the target integration cell. In certain embodiments, the integration site comprises a nucleotide extension into which the exogenous nucleotide sequence can be inserted between any of the said nucleotides.
[0084] Site-specific integration (SSI), wherein a transgene encoding a recombinant protein of interest is integrated at a predetermined genomic site, provides a means to generate more consistent clones and reduces cell line development time. Thus, SSI has become a promising strategy for development teams of host cells for exogenous expression (e.g., CHO cell lines) to repeatedly target their preferred genomic sites, which can have the characteristics of high activity and stable expression.
[0085] Currently, a variety of techniques have been used for site-specific integration in CHO cell lines, including the Cre / Lox recombinase system, the Flp / FRT recombinase system, zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), and CRISPR / Cas9. Using these techniques, the integration efficiency and precision have been improved compared to using random knock-in methods. To utilize precise recombination mediated by recombinases, the target site must be introduced into the cell genome. It can be achieved by simple random integration or targeted mutagenesis.
[0086] For site-specific integration methods, the procedures required to obtain the final single-cell clones are lengthy and laborious. In addition, during the integration process, the construct backbone may still be integrated into the genome, resulting in side effects such as gene silencing. At the same time, the need for two recombination sites in the recombinase system to construct RMCE also poses difficulties for the construction of vector cells and the subsequent development of product cells. Zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), and CRISPR / Cas9 all use the cell's natural DNA repair mechanism to integrate the payload DNA. However, the frequency of homologous recombination repair decreases as the size of the insertion cassette increases, limiting the amount of heterologous DNA that can be inserted in a single integration.
[0087] For site-specific integration of target genes, whether they are fusion proteins, monoclonal antibodies, or bispecific antibodies, the resulting cell lines have predictable performance in terms of growth, production, and stability compared to those generated by random integration. This method can enhance the controllability and repeatability of the integration process, facilitate the stable and high-yield expression of target genes, and can also simplify subsequent screening and process development steps. Therefore, it is very necessary to develop cells that can efficiently and stably express the target protein.
[0088] The first aspect of the present application
[0089] The present application provides a nucleic acid, which comprises a nucleic acid fragment shown in SEQ ID No.1, and the nucleic acid fragment is used for integrating an exogenous nucleic acid fragment.
[0090] SEQ ID No.1:
[0091]
[0092] In an example of the present application, the sequence fragment into which the exogenous nucleic acid fragment is integrated has a consistency of not less than 90% with the nucleic acid fragment shown in SEQ ID No.1, such as 90%, 90.5%, 91%, 91.5%, 92%, 92.5%, 93%, 93.5%, 94%, 94.5%, 95%, 95.5%, 96%, 96.5%, 97%, 97.5%, 98%, 98.5%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9% consistency.
[0093] In the present application, the integration site of the exogenous nucleic acid fragment can correspond to the 1st, 2nd, 3rd, 4th, 5th, 6th, 7th, 8th, 9th, 10th,... 444th positions of the nucleic acid fragment.
[0094] In some embodiments of the present application, the integration site of the exogenous nucleic acid fragment corresponds to any site within the base interval of positions 11 - 430 of the nucleic acid fragment. Optionally, the integration site of the exogenous nucleic acid fragment corresponds to any site within the base interval of positions 21 - 414 of the nucleic acid fragment. Optionally, the integration site of the exogenous nucleic acid fragment corresponds to any site within the base interval of positions 38 - 402 of the nucleic acid fragment. Optionally, the integration site of the exogenous nucleic acid fragment corresponds to any site within the base interval of positions 53 - 389 of the nucleic acid fragment. Optionally, the integration site of the exogenous nucleic acid fragment corresponds to any site within the base interval of positions 73 - 373 of the nucleic acid fragment. Optionally, the integration site of the exogenous nucleic acid fragment corresponds to any site within the base interval of positions 91 - 360 of the nucleic acid fragment. Optionally, the integration site of the exogenous nucleic acid fragment corresponds to any site within the base interval of positions 108 - 342 of the nucleic acid fragment. Optionally, the integration site of the exogenous nucleic acid fragment corresponds to any site within the base interval of positions 126 - 326 of the nucleic acid fragment. Optionally, the integration site of the exogenous nucleic acid fragment corresponds to any site within the base interval of positions 143 - 310 of the nucleic acid fragment. Optionally, the integration site of the exogenous nucleic acid fragment corresponds to any site within the base interval of positions 160 - 295 of the nucleic acid fragment. Optionally, the integration site of the exogenous nucleic acid fragment corresponds to any site within the base interval of positions 178 - 274 of the nucleic acid fragment. Optionally, the integration site of the exogenous nucleic acid fragment corresponds to any site within the base interval of positions 194 - 263 of the nucleic acid fragment. Optionally, the integration site of the exogenous nucleic acid fragment corresponds to any site within the base interval of positions 209 - 253 of the nucleic acid fragment. Optionally, the integration site of the exogenous nucleic acid fragment corresponds to any site within the base interval of positions 221 - 242 of the nucleic acid fragment. Optionally, the integration site of the exogenous nucleic acid fragment corresponds to any site within the base interval of positions 231 - 240 of the nucleic acid fragment. Optionally, the integration site of the exogenous nucleic acid fragment corresponds to the NW_003616785.1:83044 site within the nucleic acid fragment. Optionally, the integration site of the exogenous nucleic acid fragment corresponds to the NW_003616785.1:83044 site within the nucleic acid fragment in CHO cells.
[0095] In an example of the present application, the exogenous nucleic acid fragment includes: a first recombination recognition sequence and a second recombination recognition sequence, a selection marker gene and / or a target gene located between the first recombination recognition sequence and the second recombination recognition sequence, and a promoter that regulates the expression of the selection marker gene and / or the target gene.
[0096] In one example of the present application, the exogenous nucleic acid fragment comprises a selection marker gene located between the first recombination recognition sequence and the second recombination recognition sequence, and a promoter for regulating the expression of the selection marker gene.
[0097] In one example of the present application, the exogenous nucleic acid fragment comprises a target gene located between the first recombination recognition sequence and the second recombination recognition sequence, and a promoter for regulating the expression of the target gene.
[0098] In one example of the present application, the exogenous nucleic acid fragment comprises a selection marker gene and a target gene located between the first recombination recognition sequence and the second recombination recognition sequence, and a promoter for regulating the expression of the selection marker gene and the target gene.
[0099] In one example of the present application, the first recombination recognition sequence and the second recombination recognition sequence are generated by a recombinase; the recombinase is Bxb1 integrase, ΦC31 integrase, Cre recombinase or FLP recombinase.
[0100] In one example of the present application, the recombinase is Bxb1 integrase.
[0101] In one example of the present application, the first recombination recognition sequence and the second recombination recognition sequence are each independently selected from one or more of the following sequences: LoxP sequence, LoxPL3 sequence, LoxP 2L sequence, LoxFas sequence, Lox511 sequence, Lox2272 sequence, Lox2372 sequence, Lox5171 sequence, Loxm2 sequence, Lox71 sequence, Lox66 sequence, FRT sequence, Bxb1 attP sequence, Bxb1 attB sequence, attP sequence, attB sequence, attL and attR sequences.
[0102] In one example of the present application, the first recombination recognition sequence and the second recombination recognition sequence are each independently selected from attR and attL sequences.
[0103] Optionally, the first recombination recognition sequence is attR and the second recombination recognition sequence is attL.
[0104] In one example of the present application, the selection marker gene is selected from one or more of the following: neomycin resistance gene, thymidine kinase gene, hygromycin phosphotransferase gene, dihydrofolate reductase gene, thymidine kinase gene, glutamine synthetase gene, asparagine synthetase gene, tryptophan synthetase gene, histidinol dehydrogenase gene, aminoglycoside phosphotransferase gene, tryptophan synthetase gene and fluorescent protein gene.
[0105] In an example of the present application, the selection marker gene is a fluorescent protein gene.
[0106] In an example of the present application, the promoter is CMV promoter, SV40 promoter, RSV promoter, β-globin promoter, UBC promoter, EF1a promoter, ubiquitin promoter, β-actin promoter, PGK1 promoter, Rosa26 promoter, HSP70 promoter, GAPDH promoter, Eif4A1 promoter, Egr1 promoter, FerH promoter, SM22α promoter or Endothelin-1 promoter.
[0107] In an example of the present application, the target gene encodes one or more of an antibody, a recombinant protein, a polypeptide, an enzyme, a hormone, a growth factor and a receptor.
[0108] In an example of the present application, the target gene encodes an antibody.
[0109] In an example of the present application, the nucleotide sequence of the target gene is as shown in SEQ ID No.2.
[0110] In an example of the present application, the nucleotide sequence of the nucleic acid contains the nucleotide sequence as shown in SEQ ID No.3.
[0111] In an example of the present application, the nucleotide sequence of the nucleic acid contains the nucleotide sequence as shown in SEQ ID No.7.
[0112] In an example of the present application, the nucleotide sequence of the nucleic acid contains the nucleotide sequence as shown in SEQ ID No.9.
[0113] The second aspect of the present application
[0114] The present application provides a recombinant vector, the recombinant vector includes the nucleic acid as described in the first aspect, the nucleic acid further contains the first recombination recognition sequence and the second recombination recognition sequence; the exogenous nucleic acid fragment includes a target gene and / or a selection marker gene.
[0115] In an example of the present application, the exogenous nucleic acid fragment is a target gene; the first recombination recognition sequence is a 5' homologous arm homologous to the sequence fragment existing in the nucleic acid fragment shown in SEQ ID No.1; the second recombination recognition sequence is a 3' homologous arm homologous to the sequence fragment existing in the nucleic acid fragment shown in SEQ ID No.1.
[0116] In an example of the present application, the 5' homologous arm is attR, and the 3' homologous arm is attL.
[0117] In one example of the present application, the exogenous nucleic acid fragment is a selectable marker gene; the first recombination recognition sequence is a 5' homologous arm homologous to the sequence fragment present in the nucleic acid fragment shown in SEQ ID No.1; the second recombination recognition sequence is a 3' homologous arm homologous to the sequence fragment present in the nucleic acid fragment shown in SEQ ID No.1.
[0118] In one example of the present application, the 5' homologous arm is AttP, and the 3' homologous arm is AttP-GA.
[0119] In one example of the present application, the recombinant vector is a lentiviral vector, an adenoviral vector, an adeno-associated viral vector, a herpes viral vector, a poxviral vector, a baculoviral vector, a papillomaviral vector, a polyomaviral vector, an integrative phage vector, a non-viral vector, a transposon and / or transposase, an integrase substrate, or a plasmid.
[0120] In one example of the present application, the recombinant vector is a lentiviral vector, an adenoviral vector, an adeno-associated viral vector, a herpes viral vector, a poxviral vector, a baculoviral vector, a papillomaviral vector, a polyomaviral vector, an integrative phage vector, or a non-viral vector.
[0121] The third aspect of the present application
[0122] The present application provides a targeted integration cell, and the targeted integration cell contains the nucleic acid described in the first aspect.
[0123] In one example of the present application, the targeted integration cell is a eukaryotic cell;
[0124] Optionally, the eukaryotic cell is a mammalian cell;
[0125] Optionally, the mammalian cell includes Chinese hamster ovary CHO cells and human embryonic kidney HEK293 cells.
[0126] In one example of the present application, the targeted integration cell is Chinese hamster ovary CHO cells.
[0127] Optionally, the CHO cells include CHO host cells, CHO K1 host cells, CHO K1SV host cells, DG44 host cells, DUKXB-11 host cells, CHOK1S host cells, or CHO K1M host cells.
[0128] The fourth aspect of the present application
[0129] The present application provides a method for preparing the targeted integration cell described in the third aspect, and the preparation method includes the following steps:
[0130] Introduce the nucleic acid described in the first aspect into cells, or provide cells containing the nucleic acid fragment shown in SEQ ID No.1 and integrate the exogenous nucleic acid fragment into the nucleic acid fragment to prepare targeted integration cells.
[0131] Optionally, the integration methods include, but are not limited to, site-specific recombination techniques derived from homologous recombination technology, relying on integrases that specifically recognize specific recognition sites to achieve genetic engineering operations such as gene replacement, gene knockout, and gene knock-in between the genome and exogenous DNA. For example, it can be recombinase-mediated cassette exchange, or it can be CRISPR / Cas9-mediated gene targeting integration.
[0132] The fifth aspect of the present application
[0133] This application provides a method for producing a target gene expression product, and the method includes the following steps: culturing the targeted integration cells described in the third aspect and collecting the expression product of the target gene in the exogenous nucleic acid fragment.
[0134] The sixth aspect of the present application
[0135] This application provides the use of the nucleic acid described in the first aspect in the preparation of a protein or polypeptide, and the protein or polypeptide is expressed by the exogenous nucleic acid fragment.
[0136] The targeted integration cells in this application have the characteristics of stability and high yield.
[0137] In this application, the integration site and / or the nucleotide sequence flanking the integration site can be identified through experiments: in some embodiments of this application, the integration site and / or the nucleotide sequence flanking the integration site can be identified by a whole-genome screening method to isolate host cells; in some embodiments of this application, the integration site and / or the nucleotide sequence flanking the integration site can be identified by a whole-genome screening method after a transposase-based cassette integration event; in some embodiments of this application, the integration site and / or the nucleotide sequence flanking the integration site can be identified by brute force random integration screening; in some embodiments of this application, the integration site and / or the nucleotide sequence flanking the integration site can be determined by conventional sequencing methods (such as target locus amplification), followed by next-generation sequencing and whole-genome sequencing; in some embodiments of this application, the position of the integration site on the chromosome can be determined by conventional cell biology methods (such as fluorescence in situ hybridization analysis).
[0138] The implementation scheme of the present application will be described in detail below in conjunction with embodiments. It should be understood that these embodiments are only used to illustrate the present application and not to limit the scope of the present application. For the experimental methods without specific conditions noted in the following embodiments, the guidance given in the present application is preferentially referred to. It can also be carried out according to the experimental manuals or conventional conditions in the art, according to the conditions recommended by the manufacturer, or referring to the experimental methods known in the art.
[0139] In the following specific embodiments, for the measurement parameters of raw material components, if not otherwise specified, there may be slight deviations within the weighing accuracy range. For temperature and time parameters, acceptable deviations caused by instrument test accuracy or operation accuracy are allowed.
[0140] The consumables in the following specific embodiments include: Neon Resuspension Buffer R (ThermoFisher), a special resuspension buffer for cell electroporators; E1 Buffer (ThermoFisher), an electroporation solution; the recovery medium is 80% (v / v) EX-CELL CHO Cloning Medium (Sigma-Aldrich) and 20% (v / v) EX-CELL Advanced CHO Fed-batch Medium (Sigma-Aldrich) supplemented with 1% GlutaMAX (ThermoFisher); the amplification medium and the subculture medium are both EX-CELL Advanced CHO Fed-batch Medium supplemented with 1% GlutaMAX (ThermoFisher); the selection medium 1 is the subculture medium supplemented with G418 at a final concentration of 200 μg / ml; the selection medium 2 is the subculture medium supplemented with Hygromycin at a final concentration of 200 μg / ml; the conditioned medium is the supernatant obtained by aseptically filtering the subculture medium inoculated with CHO-K1 after 1 day of culture; the cloning medium is 75% (v / v) EX-CELL CHO Cloning Medium, 20% (v / v) conditioned medium and 5% (v / v) ClonaCell-CHOACF Supplement supplemented with 1% GlutaMAX; the basal medium in the feeding medium is EX-CELL Advanced CHO Fed-batch Medium supplemented with 1% GlutaMAX (ThermoFisher), and the feeding medium is Cell Boost 7a / 7b (HyClone).
[0141] Example 1
[0142] The operation process of this embodiment is shown in Figure 1 , and mainly includes the following steps:
[0143] (1) Using the enhanced green fluorescent protein gene (EGFP) as a selection marker gene and the attp sequence as a homologous arm, a recombinant plasmid containing RMCE was constructed, as shown in Figure 2 ;
[0144] (2) After linearizing the constructed plasmid, the linear DNA was purified and recovered;
[0145] (3) Take 3×10 6 CHO cells into a 50 mL centrifuge tube, centrifuge at 1000 rpm at room temperature for 5 min, and discard the supernatant;
[0146] (4) Resuspend the cells with 100 μL of the special resuspension buffer R Buffer for the cell electroporator;
[0147] (5) Take 15 μg of the plasmid linearized in step (2) into the cells resuspended in step (4), gently mix, pipette 50 times, and avoid generating bubbles;
[0148] (6) Turn on the cell electroporator, adjust the parameters, load the electroporation chamber into the electroporator, and add 3 mL of the electroporation buffer E1 Buffer to the chamber;
[0149] (7) Aspirate the cell-plasmid suspension in step (5) into the electroporation pipette tip, load it into the electroporation chamber, and perform electroporation;
[0150] (8) Immediately transfer the electroporated cells into a 6-well plate containing 2 mL of recovery medium, and transfer them to a 37°C, 5% CO2 incubator for static overnight culture;
[0151] (9) After 24 h of electroporation, apply pressure with the pressure medium 1, dilute and plate into 480 wells;
[0152] (10) After culturing for about 2 weeks, a stable fluorescence pool was obtained. Expand the pool with relatively high overall fluorescence, and then continue culturing until the cell doubling time is less than 24 h and the viability is greater than 95%;
[0153] (11) Limit-dilute the recovered cells and culture them with the cloning medium to complete monoclonalization;
[0154] (12) After 14 days, amplify and culture the fluorescent monoclonal cells in the amplification medium to form cell lines, and monitor the growth curve and fluorescence detection with the fed-batch and feeding medium at the shake flask stage. Retain the cell lines with good growth curves and high fluorescence, denoted as GBB003 cells;
[0155] (13) The above-mentioned high-fluorescence cell lines were subjected to a 90-day passage stability study with the passage medium, and the GBB003 cells with relatively small changes in fluorescence values and stable cell line growth were confirmed as stable high-fluorescence cells;
[0156] (14) Referring to step (1), the target gene 1 fragment, target gene 2 fragment, and target gene 3 fragment are respectively cloned into different plasmids to construct three recombinant plasmids containing RMCE, as shown in Figure 3 ;
[0157] The target gene fragment 1 has the sequence shown in SEQ ID No.2, SEQ ID No.2:
[0158]
[0159]
[0160] (15) Select the stable high-fluorescence cell GBB003 in step (13) for transfection and integration verification. After amplifying and linearizing the recombinant plasmid in step (14) above, it is co-transfected with Bxb-1 integrase into the stable high-fluorescence cell GBB003. The transfection procedure is as described above;
[0161] (16) One day after transfection, construct a minipool for the cell pool and perform pressure screening with pressurized medium 2;
[0162] (17) After 7 - 10 days, expand the culture of the non-fluorescent cells in the minipool and perform limited dilution for monoclonalization;
[0163] (18) The non-fluorescent cells in the monoclonal cells are placed in a constant temperature incubator (37°C, 80% humidity) for culture, and continue to be amplified until it reaches the shake flask stage. After about 1 month, the cell line can enter fed-batch culture. Through fed-batch culture (Advance + 1% Glutamax for the first three days, i.e., the fed-batch medium), add 3% (v / v) Cell Boost 7a and 0.3% (v / v) Cell Boost 7b (cytiva) simultaneously on the 3rd and 5th days, and add 5% (v / v) Cell Boost 7a and 0.5% (v / v) Cell Boost 7b (cytiva) simultaneously every day on the 7th, 9th, 11th, and 13th days. On the 3rd, 5th, 7th, 9th, 11th, and 13th days, supplement the sugar according to the cell glucose consumption and evaluate the expression level. The comparison results of the expression levels of the site-specific integration product minipool cell pool (GBB003 - minipool), single-copy cell line (GBB003 - 2D8), and the randomly integrated minipool cell pool (random minipool), single-copy cell line (random monoclonal) cultured under the same conditions are shown in Figure 4 ;
[0164] To investigate the stability of cell clones targeting the integration of target gene 1, the cloned cells were continuously passaged for about 90 days for stability evaluation. P1, P13, and P26 were cultured in batches for 7 days, and glucose was replenished according to the glucose consumption of the cells on the 3rd, 5th, and 7th days. From the expression level ( Figure 5 ) it was shown that the monoclonal cells were stable and highly productive; the cell line GBB003, which could highly express both the fluorescent gene and the target gene, was subjected to second-generation whole-genome sequencing to obtain the following annotation information of the integration site on CHO: NW_003616785.1:83044. When the fluorescent gene was inserted at the position of NW_003616785.1:83044 of the cell line GBB003, the cell line GBB003 highly expressed the fluorescent gene. When the target gene was inserted at the position of NW_003616785.1:83044 of the cell line GBB003, the cell line GBB003 highly expressed the target gene.
[0165] The sequence fragment after integrating target gene 1 is shown in SEQ ID No.3, SEQ ID No.3:
[0166]
[0167]
[0168] Using the upstream primer F1 (SEQ ID No.4): AGACCAGCCTCAGATGTCACAC of the above breakpoint and the downstream primer R1 (SEQ ID No.5) of the target gene on the plasmid used for integration: AGGCACACAACGGAGGCGGT; the genome of this monoclonal cell line was amplified to obtain a fragment of 3403bp that conforms to the theoretical size, as Figure 6 (shown in the corresponding band of lane GBB003-2D8).
[0169] Among them, the sequence fragment after integrating target gene 1 contains attL, and the nucleotide sequence of the attL is shown in SEQ ID No.6, SEQ ID No.6: ATGATCCTGACGACGGAGACCGCGGTGGTTGACCAGACAAACC. In the sequence fragment after integrating target gene 1, the part before attL is the foreign sequence, and the part after is the endogenous sequence. The foreign sequence contains target gene 1. Target gene 1 can encode a monoclonal antibody.
[0170] The amplified band was cut and recovered, purified, and multiple pairs of primers were designed for DNA sequencing. The sequenced results were spliced and the sequence was as shown in SEQ ID No.3, which was consistent with the theoretical sequence (sequence SEQ ID No.3), thus confirming that the target gene was correctly integrated into the target site.
[0171] Similarly, for the cell line with high expression of the target gene, the sequence fragment after integrating target gene 2 is as shown in SEQ ID No.7, SEQ ID No.7:
[0172]
[0173]
[0174] Using the upstream primer F1 (SEQ ID No.4) of the breakpoint above: AGACCAGCCTCAGATGTCACAC and the downstream primer R2 (SEQ ID No.8) of the product gene on the plasmid used for the product: CCTTAGAATCCTGCTCGGTGA; amplify the genome of the product cell line to obtain a fragment with a size consistent with the theoretical size (3486bp), as Figure 7 (the corresponding band in the GBB003-1G2 lane) shown.
[0175] Cut the amplified band from the gel, recover and purify it, and design multiple pairs of primers for DNA sequencing. The sequence after splicing the sequencing results is as shown in SEQ ID No.7, which is consistent with the theoretical sequence (sequence SEQ ID No.7), thus confirming that the target gene is correctly integrated into the target site. Among them, the sequence fragment after integrating target gene 2 contains attL. In the sequence fragment after integrating target gene 2, the part before attL is the foreign sequence, and the part after is the endogenous sequence. The foreign sequence contains the target gene 2. After integrating target gene 2 into the cell line with high expression of the target gene, the marker gene EGFP is replaced by the fragment where target gene 2 is located.
[0176] Similarly, for the cell line with high expression of the target gene, the sequence fragment after integrating target gene 3 is as shown in SEQ ID No.9, SEQ ID No.9:
[0177]
[0178]
[0179] Using the upstream primer F1 (SEQ ID No.4) of the breakpoint above: AGACCAGCCTCAGATGTCACAC and the downstream primer R2 (SEQ ID No.10) of the product gene on the plasmid used for the product: TACAAATGTGGTATGGCTGATTAGC; amplify the genome of the product cell line to obtain a fragment with a size consistent with the theoretical size (3665bp), as Figure 7 (the corresponding band in the GBB003-1D1 lane) shown.
[0180] The amplified bands were excised from the gel, recovered, purified, and multiple pairs of primers were designed for DNA sequencing. After splicing the sequencing results, the sequence was as shown in SEQ ID No.9, which was consistent with the theoretical sequence (sequence SEQ ID No.9), thus confirming that the target gene was correctly integrated into the target site. Among them, the sequence fragment after integrating target gene 3 contained attL. After integrating target gene 3 into the cell line with high expression of the target gene, the marker gene EGFP was replaced by the fragment where target gene 3 was located.
[0181] References:
[0182] [1]Takeshi Omasa et al,.Cell engineering and cultivation ofchinesehamster ovary(CHO)cells.Curr Pharm Biotechnol.2010Apr;11(3):233-40.
[0183] The technical features of the above-described embodiments and examples can be combined in any suitable manner. For the sake of brevity of description, not all possible combinations of the technical features in the above-described embodiments and examples are described. However, as long as there is no contradiction in the combination of these technical features, it should be considered to be within the scope described in this specification.
[0184] The above-described embodiments merely represent several implementation manners of the present application, facilitating the specific and detailed understanding of the technical solution of the present application, but should not be construed as limiting the protection scope of the invention patent. It should be noted that for those of ordinary skill in the art, without departing from the concept of the present application, several modifications and improvements can still be made, and these all belong to the protection scope of the present application. In addition, it should be understood that after reading the above teachings of the present application, those skilled in the art can make various changes or modifications to the present application, and the equivalent forms obtained also fall within the protection scope of the present application. It should also be understood that the technical solutions obtained by those skilled in the art through logical analysis, reasoning, or limited experiments based on the technical solutions provided in the present application are all within the protection scope of the appended claims of the present application. Therefore, the protection scope of the patent of the present application shall be subject to the content of the appended claims, and the specification and drawings can be used to explain the content of the claims.
Claims
1. Recombinant vector, characterized in that, The recombinant vector includes a nucleic acid, which contains a nucleic acid fragment shown in SEQ ID No.1, and the nucleic acid fragment is integrated with an exogenous nucleic acid fragment; The exogenous nucleic acid fragment includes a target gene and / or a selection marker gene, and the target gene and / or the selection marker gene are integrated at the NW_003616785.1:83044 locus of the nucleic acid shown in SEQ ID No.1; The exogenous nucleic acid fragment further contains a first recombination recognition sequence and a second recombination recognition sequence; the first recombination recognition sequence is a 5' homologous arm homologous to the sequence fragment existing in the nucleic acid fragment shown in SEQ ID No.1; the second recombination recognition sequence is a 3' homologous arm homologous to the sequence fragment existing in the nucleic acid fragment shown in SEQ ID No.1; The recombinant vector targets Chinese hamster ovary (CHO) cells.
2. The recombinant vector according to claim 1, characterized in that, The exogenous nucleic acid fragment is a target gene; the first recombination recognition sequence is a 5' homologous arm homologous to the sequence fragment existing in the nucleic acid fragment shown in SEQ ID No.1; the second recombination recognition sequence is a 3' homologous arm homologous to the sequence fragment existing in the nucleic acid fragment shown in SEQ ID No.1; or, The exogenous nucleic acid fragment is a selection marker gene; the first recombination recognition sequence is a 5' homologous arm homologous to the sequence fragment existing in the nucleic acid fragment shown in SEQ ID No.1; the second recombination recognition sequence is a 3' homologous arm homologous to the sequence fragment existing in the nucleic acid fragment shown in SEQ ID No.
1.
3. The recombinant vector according to claim 2, characterized in that, The recombinant vector is a lentiviral vector, an adenoviral vector, an adeno-associated viral vector, a herpes viral vector, a poxviral vector, a baculoviral vector, a papillomaviral vector, a polyomavirus vector, an integrative phage vector, a non-viral vector, a transposon and / or a transposase, an integrase substrate or a plasmid.
4. The recombinant vector according to any one of claims 1 to 3, characterized in that The selection marker gene is selected from one or more of a neomycin resistance gene, a thymidine kinase gene, a hygromycin phosphotransferase gene, a dihydrofolate reductase gene, a thymidine kinase gene, a glutamine synthetase gene, an asparagine synthetase gene, a tryptophan synthetase gene, a histidinol dehydrogenase gene, an aminoglycoside phosphotransferase gene, a tryptophan synthetase gene and a fluorescent protein gene.
5. The recombinant vector according to claim 4, characterized in that, The selection marker gene is a fluorescent protein gene.
6. The recombinant vector according to any one of claims 1 to 3, characterized in that, The target gene encodes one or more of an antibody, a recombinant protein, a polypeptide, an enzyme, a hormone, a growth factor and a receptor.
7. The recombinant vector according to claim 1, wherein The nucleotide sequence of the nucleic acid contains the nucleotide sequence shown in SEQ ID No.3, SEQ ID No.7 or SEQ ID No.
9.
8. A targeted integration cell, characterized in that, The targeted integration cell contains the nucleic acid fragment shown in SEQ ID No.1, and the exogenous nucleic acid fragment is integrated therein; The exogenous nucleic acid fragment is integrated at the NW_003616785.1:83044 locus of the nucleic acid shown in SEQ ID No.1; The targeted integration cell is a Chinese hamster ovary (CHO) cell.
9. The targeted integration cell according to claim 8, wherein The exogenous nucleic acid fragment includes: A first recombination recognition sequence and a second recombination recognition sequence, a selection marker gene and / or a target gene located between the first recombination recognition sequence and the second recombination recognition sequence, and a promoter regulating the expression of the selection marker gene and / or the target gene.
10. The targeted integration cell according to claim 8, wherein The exogenous nucleic acid fragment comprises: A first recombination recognition sequence and a second recombination recognition sequence, a selection marker gene located between the first recombination recognition sequence and the second recombination recognition sequence, and a promoter regulating the expression of the selection marker gene.
11. The targeted integration cell according to claim 8, wherein The exogenous nucleic acid fragment comprises: A first recombination recognition sequence and a second recombination recognition sequence, a target gene located between the first recombination recognition sequence and the second recombination recognition sequence, and a promoter regulating the expression of the target gene.
12. The targeted integration cell according to claim 8, characterized in that, The exogenous nucleic acid fragment comprises: A first recombination recognition sequence and a second recombination recognition sequence, a selection marker gene and a target gene located between the first recombination recognition sequence and the second recombination recognition sequence, and a promoter regulating the expression of the selection marker gene and the target gene.
13. The targeted integration cell according to any one of claims 9 to 12, characterized in that, The first recombination recognition sequence and the second recombination recognition sequence are generated by a recombinase; the recombinase is Bxb1 integrase, ΦC31 integrase, Cre recombinase or FLP recombinase; Or / and, The first recombination recognition sequence and the second recombination recognition sequence are each independently selected from one or more of the following sequences: LoxP sequence, LoxPL3 sequence, LoxP 2L sequence, LoxFas sequence, Lox511 sequence, Lox2272 sequence, Lox2372 sequence, Lox5171 sequence, Loxm2 sequence, Lox71 sequence, Lox66 sequence, FRT sequence, Bxb1 attP sequence, Bxb1 attB sequence, attP sequence, attB, attL and attR sequences.
14. The targeted integration cell according to any one of claims 9, 10 or 12, characterized in that, The selection marker gene is selected from one or more of a neomycin resistance gene, a thymidine kinase gene, a hygromycin phosphotransferase gene, a dihydrofolate reductase gene, a thymidine kinase gene, a glutamine synthetase gene, an asparagine synthetase gene, a tryptophan synthetase gene, a histidinol dehydrogenase gene, an aminoglycoside phosphotransferase gene, a tryptophan synthetase gene and a fluorescent protein gene.
15. The targeted integration cell according to claim 14, wherein The selection marker gene is a fluorescent protein gene.
16. The targeted integration cell according to any one of claims 9 to 12, characterized in that, The promoter is a CMV promoter, an SV40 promoter, an RSV promoter, a β-globin promoter, a UBC promoter, an EF1a promoter, a ubiquitin promoter, a β-actin promoter, a PGK1 promoter, a Rosa26 promoter, a HSP70 promoter, a GAPDH promoter, an Eif4A1 promoter, an Egr1 promoter, a FerH promoter, a SM22α promoter or an Endothelin-1 promoter.
17. The targeted integration cell according to any one of claims 9, 11 or 12, characterized in that, The target gene encodes one or more of an antibody, a recombinant protein, a polypeptide, an enzyme, a hormone, a growth factor and a receptor.
18. The targeted integration cell according to claim 8, wherein The targeted integration cell comprises a nucleotide sequence as shown in SEQ ID No.3, SEQ ID No.7 or SEQ ID No.
9.
19. The method for preparing a targeted integration cell according to any one of claims 8 to 18, characterized in that, The preparation method comprises the following steps: Providing Chinese hamster ovary (CHO) cells, and integrating the exogenous nucleic acid fragment into the nucleic acid fragment to prepare a targeted integration cell.
20. A method for producing a target gene expression product, characterized in that, The method comprises the following steps: culturing the targeted integration cell according to any one of claims 8 to 18, and collecting the expression product of the target gene in the exogenous nucleic acid fragment.
21. Use of a nucleic acid in the preparation of a protein or polypeptide, the nucleic acid comprising the nucleic acid fragment shown in SEQ ID No. 1, the nucleic acid fragment being used for integrating an exogenous nucleic acid fragment, and the protein or polypeptide being expressed by the exogenous nucleic acid fragment.
22. Use of the recombinant vector according to any one of claims 1 to 7 or the targeted integration cell according to any one of claims 8 to 18 in the preparation of a protein or polypeptide, the protein or polypeptide being expressed by the exogenous nucleic acid fragment.