A chicken insulin signaling pathway reporter gene vector, construction method and application thereof

Abstract

The present invention proposes a chicken insulin signaling pathway reporter gene vector, a construction method and an application thereof, and belongs to the field of genetic engineering. FASN was screened and verified as a chicken insulin signaling pathway response gene by RNA‑seq and qRT‑PCR methods. Then, the insulin response region of the FASN core promoter region was determined by bioinformatics analysis, and an insulin signaling pathway reporter gene vector pGL3‑cFASN was constructed. The reporter gene vector includes the insulin response region of the FASN core promoter region, and is used to prepare a reagent for detecting the activity of the chicken insulin signaling pathway. The problem that the insulin signaling pathways of chickens are different from those of other mammals and the existing insulin signaling pathway reporter gene vectors cannot be universal is solved. Constructing a reporter gene vector for detecting the chicken insulin signaling pathway is of great significance for analyzing the role and mechanism of the chicken insulin signaling pathway in the growth and development of chickens and the formation of related traits.

Description

Technical Field

[0001] The invention belongs to the field of genetic engineering. Background Art

[0002] Chickens are not only important economic animals, but also important animal models for research in developmental biology and immunology. Glucose in the blood is called blood glucose. Glucose is one of the important sources of energy required for the life activities of chickens and mammals. Blood glucose levels are strictly regulated by signal pathways such as insulin. Insulin plays an important role in the growth, development and reproduction of livestock and poultry. For example, the individual weight gain of laying hens and male broilers is significantly positively correlated with serum insulin levels. Insulin can also regulate the proliferation and apoptosis of chicken primordial germ cells. Analysis of broiler serum biochemical indicators suggests that the insulin signaling pathway also plays an important role in broiler fat deposition. Unlike mammals such as humans and mice, chickens are insulin resistant. Studies have shown that although the blood concentrations of insulin in chickens and humans are similar, the blood glucose concentration of chickens is about twice that of mammals, which indicates that the insulin signaling pathways of chickens and mammals are not exactly the same.

[0003] Reporter gene technology has the characteristics of simplicity, rapidity, sensitivity and stability, and is widely used in gene function, gene expression regulation and signal pathway analysis. Commonly used reporter genes include luciferase, β-galactosidase and green fluorescent protein (GFP). According to the representative response genes or downstream important genes of the insulin signaling pathway that have been identified, people have used gene mutation and other technologies to determine the insulin response region of the promoter region of the insulin response gene or the DNA binding sequence of the downstream important transcription factor (such as STAT5), and then cloned or artificially synthesized the DNA binding sequence of the insulin response region or the downstream transcription factor to successfully construct a reporter gene vector for detecting the mammalian insulin signaling pathway. At present, people have constructed multiple reporter gene vectors for detecting the mammalian insulin signaling pathway, and these reporter gene vectors are widely used in basic research and applied research related to the insulin signaling pathway. Compared with mammals, human research on the chicken insulin signaling pathway is very weak. At present, no chicken insulin response genes or downstream genes of the insulin signaling pathway have been identified, and no reporter gene vector for detecting the chicken insulin signaling pathway has been established. The construction of a reporter gene vector for detecting the chicken insulin signaling pathway is of great significance for analyzing the role and mechanism of the chicken insulin signaling pathway in the growth and development of chickens and the formation of related traits. Summary of the invention

[0004] The insulin signaling pathway of chickens is different from that of other mammals. Existing mammalian insulin signaling pathway vectors are not universally applicable to chickens. The present invention solves the problem that there is currently no chicken insulin signaling pathway reporter gene vector. The reporter gene vector provides material support for the study of chicken insulin signaling pathway.

[0005] One of the purposes of the present invention is to provide a reporter gene vector pGL3-cFASN of chicken insulin signaling pathway.

[0006] Preferably, the reporter gene vector comprises the insulin response region of the chicken FASN core promoter region.

[0007] Preferably, the insulin response region sequence of the chicken FASN core promoter region is SEQ1.

[0008] The second object of the present invention is to construct a reporter gene vector of the chicken insulin signaling pathway by determining the insulin response gene FASN by RNA-seq and qRT-PCR, determining the insulin response region sequence of the FASN core promoter region by bioinformatics analysis and connecting it to the vector pGL3.

[0009] The third object of the present invention is to use the reporter gene vector of the chicken insulin signaling pathway in the preparation of a reagent for detecting the activity of the insulin signaling pathway.

[0010] Preferably, the insulin signaling pathway activity is chicken insulin signaling pathway activity.

[0011] Beneficial Effects

[0012] 1. The chicken insulin signaling pathway reporter gene vector provided by the present invention will provide material support for the study of the activity, function and mechanism of the chicken insulin signaling pathway.

[0013] 2. The reporter gene vector of the chicken insulin signaling pathway provided by the present invention has the characteristics of simplicity, rapidity, and sensitivity.

[0014] 3. It provides ideas for analyzing the role and regulatory mechanism of the chicken insulin signaling pathway, as well as the research, drug development and treatment of obesity, diabetes and insulin resistance in humans. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] Figure 1 FASN gene expression analysis after ICP2 cells were treated with 100 nM insulin for different time periods;

[0016] Figure 2 For the analysis of reporter gene activity in chicken insulin signaling pathway response in ICP2 cells;

[0017] Figure 3 For chicken insulin signaling pathway response reporter gene activity analysis in DF1 cells;

[0018] Figure 4 Analysis of reporter gene activity for chicken insulin signaling responses in chicken preadipocytes. DETAILED DESCRIPTION

[0019] Example 1: Screening of chicken insulin signaling pathway response genes

[0020] 1. RNA-seq screening of chicken insulin signaling pathway response genes

[0021] (1) Cell culture: ICP2 cells were cultured using DMEM / F12 medium. When the density of ICP2 cells reached 80%, serum-free medium was used for starvation treatment for 12 hours to obtain starved ICP2 cells.

[0022] (2) Total RNA extraction: Starved ICP2 cells were stimulated with 100 nM insulin for 12 h to obtain stimulated cells. Total RNA was then extracted from the stimulated cells and the purity and quantification of total RNA were determined using a NanoDrop 2000 spectrophotometer, and the integrity of total RNA was assessed using an Agilent 2100.

[0023] (3) Construction of transcriptome library: The transcriptome library was constructed using the VAHTS Universal V5 RNA-seq Library Prep Kit according to the instructions.

[0024] (4) Transcriptome sequencing and analysis: Transcriptome sequencing and analysis were performed by Shanghai Ouyi Biotechnology Co., Ltd. (Shanghai, China).

[0025] The library was sequenced using the Illumina Novaseq 6000 sequencing platform and 150 bp double-end reads were generated. 6G reads were obtained for each sample. Fastp software was used to process the raw reads in fastq format, and clean reads were obtained after removing low-quality reads for subsequent data analysis.

[0026] HISAT2 software was used to align clean reads to the reference genome, and then the gene expression (FPKM) was calculated, and the read counts (counts) of each gene were obtained by HTSeq-count. Differentially expressed genes were analyzed using DESeq2 software, and genes that met the thresholds of q value < 0.05 and foldchange > 2 or foldchange < 0.5 were defined as differentially expressed genes (DEGs). The conclusion was that FASN was a differentially expressed gene, i.e., an insulin response gene.

[0027] 2. qRT-PCR verification of chicken insulin response gene (FASN)

[0028] 2.1cDNA synthesis

[0029] ICP2 cells were cultured in DMEM / F12 medium until the cell density reached 80%, and then starved for 12 hours using serum-free medium to obtain the treated ICP2 cells. ICP2 cells were stimulated with 100 nM insulin and total RNA was extracted from cells after 0, 4, 8, and 12 hours. TM The specific steps are as follows:

[0030] (1) Add the following reaction mixture to a 0.2 mL RNase free EP tube on ice, see Table 2:

[0031] Table 2

[0032] Reagents Addition amount 5×gDNA Eraser Buffer: 2.0μL gDNA Eraser: 1.0μL Total RNA: 1.0 μg RNase free dH2O: up to 10μL

[0033] Reaction conditions: 42°C, 2 min, short-term storage at 4°C.

[0034] (2) Prepare a reaction mixture on ice according to the following ingredients, see Table 3:

[0035] Table 3

[0036] Reagents Addition amount PrimeScript RT Enzyme Mix I: 1.0μL Rt Primer Mix: 4.0μL 5×PrimeScipt Buffer 2 (for Real Time): 4.0μL RNase Free dH2O: 1.0μL

[0037] (3) Add the mixture in (2) to the EP tube in (1) and mix gently. Reaction conditions: 37°C, 15 min; 85°C, 5 s; the obtained cDNA is temporarily stored at 4°C. If the synthesized cDNA needs to be stored for a long time, store it at -20°C or lower.

[0038] 2.2 Real-time quantitative PCR

[0039] (1) Primers: Real-time quantitative PCR primers were designed based on the chicken FASN gene, with TBP gene as the internal reference and 2 -△△Ct The specific primer information is shown in Table 4.

[0040] Table 4 Real-time PCR analysis primer sequence information

[0041]

[0042]

[0043] (2) Follow the instructions for the SYBR Green Master reagent from Roche. Prepare the reaction mixture on ice according to the following ingredients, see Table 5:

[0044] Table 5

[0045] Reagents Addition amount SYBR Premix Ex Taq: 10.0μL Upstream primer (10 μM): 0.4μL Downstream primer (10 μM): 0.4μL cDNA Template: 2.0μL ddH2O: 7.8μL Total volume: 20.0μL

[0046] After the samples were mixed evenly, they were added to a 96-well plate. The reaction conditions were: 50°C, 10 min, 95°C, 2 min; 95°C, 5 s, 60°C, 1 min, 40 cycles in total; 95°C, 15 s; 60°C, 1 min; 95°C, 15 s.

[0047] Conclusion Figure 1 After ICP2 cells were treated with insulin for 8h and 12h, the expression of FASN gene was significantly increased.

[0048] Example 2: Insulin signaling pathway response reporter gene

[0049] 1. Construction of chicken insulin signaling pathway response reporter gene

[0050] (1) The core promoter region of chicken FASN was determined by consulting the literature (Le Fur N, el Khadir-Mounier C, Powell RS, Diot C, Mallard J, Douaire M. Characterization of the chicken fatty acid synthase gene 5'part and promoter region. Eur J Biochem. 1996 Sep 1; 240 (2): 323-30). The transcription factor binding sites in the core promoter region of chicken FASN were analyzed by bioinformatics, and the insulin response region was determined based on known insulin response transcription factors. According to the FASN genomic sequence (GenBank accession number NC_052549), primers were designed using Primer Premier 5.0 software to amplify the FASN core promoter containing the insulin response region. The FASN core promoter position was -347 to -129, with A in the start codon ATG as +1, and the sequence was SEQ1. According to the instructions of the single-fragment rapid cloning kit, KpnI and XhoI restriction sites were introduced into the upstream and downstream primers, respectively, and the linear vector homology arms were carried respectively. The primers were synthesized by Genewise Biotechnology Co., Ltd., see Table 6.

[0051] Table 6

[0052]

[0053] (3) Using chicken blood DNA as a template, PCR amplification was performed using the primers synthesized in Table 7. The specific reaction system is as follows:

[0054] Table 7

[0055] gDNA: 1μL Primer-F (10 μM): 1μL Primer-R (10 μM): 1μL <![CDATA[TaKaRa Taq TM :]]> 0.25μL 10×PCR Buffer: 5μL dNTP Mixture: 4μL <![CDATA[ddH2O:]]> up to 50μL

[0056] The PCR reaction conditions were:

[0057]

[0058] Store at 4℃.

[0059] (4) The pGL3-Basic vector was linearized by double restriction enzyme digestion with KpnI and XhoI at 37°C for 2 h. The restriction enzyme digestion system is as follows, Table 8:

[0060] Table 8

[0061]

[0062]

[0063] (5) The PCR product obtained in (2) and the vector double-enzyme digestion product obtained in (3) were subjected to agarose gel electrophoresis, and the target band was recovered using the Axygene DNA gel kit. According to the instructions of the single-fragment rapid cloning kit, the PCR purified product and the pGL3-Basic linearized vector were recombined and ligated at 37°C for 30 minutes and cooled at 4°C. The reaction system is as follows, see Table 9:

[0064] Table 9

[0065] pGL3-basic linearized vector: 2μL PCR purification product: 6μL 5×CEII Buffer: 4μL Exnase II: 2μL <![CDATA[ddH2O:]]> 6μL

[0066] (5) After the recombinant product is transformed, a single colony is picked and inoculated into LB liquid medium containing ampicillin and cultured overnight. The plasmid is extracted using a plasmid extraction kit, and the recombinant plasmid pGL3-cFASN is identified by sequencing and double enzyme digestion.

[0067] 2. Construction of reporter gene vector for mammalian insulin signaling pathway

[0068] Related literature (Storz P, et al. A cellular reporter assay to monitor insulin receptor kinase activity based on STAT 5-dependent luciferase gene expression. Anal Biochem. 1999 Dec 1; 276 (1): 97-104; Stoecklin E et al. Specific DNA binding of Stat5, but not of glucocorticoid receptor, is required for their functional cooperation in the regulation of gene transcription. Mol Cell Biol. 1997 Nov; 17 (11): 6708-16.) reported that the mouse STAT5 specific binding sequence (STAT5RE, hereinafter abbreviated as S5RE) is an insulin response element. Therefore, the present invention constructs a reporter gene vector pGL3-6×S5RE TKmini containing the STAT5 specific binding sequence as a mammalian cell insulin signaling pathway reporter gene. The specific construction process is as follows: artificially synthesize a sequence containing 5 copies of S5RE (TGTGGACTTCTTGGAATTAAGGGACTTTTG) and a mini-TK promoter sequence, so that the S5RE sequence is located upstream of the TK promoter sequence. The sequence was synthesized by Genewise Biotechnology Co., Ltd. and cloned into the pGL3-Basic vector to prepare the recombinant plasmid DNA pGL3-6×S5RE TKmini.

[0069] Example 3: Sensitivity detection of reporter genes

[0070] The experiment was divided into two groups. In group 1, PRL-SV40 (reference gene) and pGL3-cFASN were transfected into chicken immortalized preadipocytes (ICP2), DF1 and chicken primary preadipocytes; in group 2, PRL-SV40 (reference gene) and pGL3-6×S5RE TKmini were transfected into chicken immortalized preadipocytes (ICP2), DF1 and chicken primary preadipocytes. Chicken immortalized preadipocytes (ICP2) and chicken primary preadipocytes were cultured with DMEM / F12 complete medium, and DF1 cells were cultured with DMEM high glucose complete medium.

[0071] After 6 hours of transfection, the culture medium was replaced with serum-free medium for 4 hours of starvation treatment, and 10nM, 100nM and 500nM insulin were used for stimulation for 8 hours, respectively, to detect the activity of two groups of reporter genes in the three types of cells. Figure 2-Figure 4 As shown, in the three types of cells tested, the reporter gene activities of the two groups of insulin signals increased significantly with the increase of insulin concentration, among which the pGL3-cFASN vector had higher sensitivity.

[0072] like Figure 2 As shown, in chicken immortalized preadipocytes, the pGL3-cFASN reporter gene activity in the 10nM-500nM insulin treatment group was approximately 1.54-1.7 times that of the 0nM insulin treatment group, and was dose-dependent; the reporter gene activity of pGL3-6×S5RE TKmini in the 10nM-500nM insulin treatment group was approximately 1.19-1.24 times that of the 0nM insulin treatment group.

[0073] like Figure 3 As shown, in DF1 cells, the pGL3-cFASN reporter gene activity in the 10nM-500nM insulin treatment group was approximately 1.19-1.24 times that of the 0nM insulin treatment group, and was dose-dependent; while the pGL3-6×S5RE TKmini reporter gene activity in the 10nM-500nM insulin treatment group was approximately 1.05 times that of the 0nM insulin treatment group.

[0074] according to Figure 4 In primary chicken preadipocytes, the pGL3-cFASN reporter gene activity in the 10nM-500nM insulin treatment group was approximately 1.44-2.49 times that under 0nM insulin conditions, and the pGL3-cFASN reporter gene activity was extremely significantly increased when stimulated by 10nM insulin, and was dose-dependent; while the pGL3-6×S5RETKmini reporter gene activity in the 10nM-500nM insulin treatment group was approximately 1.52 times that under 0nM insulin conditions.

[0075] Conclusion: The chicken insulin signaling pathway reporter gene vector pGL3-cFASN was successfully constructed. This vector can be used to detect the insulin signaling pathway activity of chicken cells (ICP2, DF1 and chicken primary preadipocytes), and it is simple, rapid and sensitive. Compared with the mammalian insulin signaling pathway reporter gene pGL3-6×S5RE TKmini, pGL3-cFASN has higher insulin sensitivity. Therefore, the pGL3-cFASN reporter gene vector can be used to detect the insulin signaling pathway activity of chicken cells.

Claims

1. A reporter gene vector for chicken insulin signaling pathway, characterized in that: The reporter gene vector of the insulin signaling pathway is pGL3-cFASN; The pGL3-cFASN construction method is to connect the insulin response region sequence of the chicken FASN core promoter region with the vector pGL3. The insulin response region sequence of the chicken FASN core promoter region is SEQ ID NO.

1.

2. Use of the reporter gene vector of the chicken insulin signaling pathway according to claim 1 in the preparation of a reagent for detecting the activity of the chicken insulin signaling pathway.

Images