Molecular markers of aortic dissection and their applications

By screening genes EDNRB, KIF19, METTL7B and PRR35 as molecular markers in peripheral blood, the problem of differentiation between ATAAD and AMI is solved, and the rapid and accurate ATAAD diagnosis is achieved, the risk of misdiagnosis is reduced, and an effective treatment basis is provided.

CN118726570BActive Publication Date: 2025-09-02NANJING FIRST HOSPITAL
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
CN202410987468.8
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-07-23
Publication Date
2025-09-02
Estimated Expiration
2044-07-23

AI Technical Summary

Technical Problem

The prior art is difficult to quickly and accurately diagnose acute Stanford A-type aortic dissection (ATAAD) in the blood, and it is difficult to distinguish from acute myocardial infarction (AMI), resulting in a high risk of misdiagnosis and limited application of RNA markers that are difficult to obtain by aortic tissue.

Method used

The genes EDNRB, KIF19, METTL7B and PRR35 were used as molecular markers, and their differential expression in peripheral blood was screened and verified by high-throughput sequencing, combined with real-time fluorescence quantitative PCR detection, were used to diagnose ATAAD and distinguish them from AMI.

Benefits of technology

It realizes the rapid and accurate diagnosis of ATAAD, reduces the risk of misdiagnosis, provides an effective treatment basis, and has good diagnostic and differentiation capabilities in the gene combination.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN118726570B_ABST
    Figure CN118726570B_ABST
Patent Text Reader

Abstract

The present invention discloses molecular markers for aortic dissection and applications thereof, and an application of a substance for detecting molecular markers for aortic dissection, characterized by comprising one or more of the following applications: 1) application in the preparation of products for diagnosing aortic dissection; 2) application in the preparation of products for screening aortic dissection; 3) application in the preparation of products for assessing the risk of aortic dissection; 4) application in the preparation of products for distinguishing aortic dissection from acute myocardial infarction; the molecular markers for aortic dissection include genes EDNRB and KIF19, etc., which can be used as diagnostic markers for AD and as one of the indicators for assessing the severity of the disease in AD patients. They have good diagnostic efficacy and can distinguish AD patients from AMI patients, so that patients can receive effective treatment.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of biological detection technology, and in particular relates to aortic dissection molecular markers and applications thereof. Background Art

[0002] Cardiovascular disease (CVD) is the leading cause of death in many countries, resulting in 16.7 million deaths annually. Aortic dissection (AD) is one of the most dangerous cardiovascular diseases. It occurs when the aortic intima ruptures due to various causes, allowing blood to enter the media and tear the aortic wall, creating true and false lumens. AD is classified by the Stanford classification as either Stanford A or Stanford B. Acute Stanford type A aortic dissection (ATAAD) is a critical emergency and carries a high mortality rate. The mortality rate increases by approximately 1% per hour within the first two days of onset, and for patients who do not undergo surgical treatment, the mortality rate can reach as high as 74% within two weeks.

[0003] Patients with ATAAD typically present with severe chest and back pain. Similarly, patients with acute myocardial infarction (AMI) may also present with chest pain. Differentiating ATAAD from AMI can be challenging and easily misdiagnosed. Although ATAAD can be definitively diagnosed and differentiated from AMI using contrast-enhanced aortic CT, many hospitals, due to its rarity, perform emergency percutaneous coronary stenting empirically to save time. If ATAAD is misdiagnosed as acute myocardial infarction, preoperative antiplatelet therapy can have disastrous consequences. Currently, no blood test is specific and sensitive for the diagnosis of ATAAD. Rapidly distinguishing these two conditions in the emergency room is a significant challenge for clinicians, as both are highly devastating conditions with distinct treatment regimens. Misdiagnosis and inappropriate treatment can have devastating consequences. Therefore, the development of biomarkers that can be sensitive and specific for the diagnosis of ATAAD or predict its development through simple, rapid blood tests is crucial.

[0004] With the completion of the human genome sequencing project and the development of high-throughput sequencing technology, medical researchers have gained a deeper understanding of the human genome, and a deeper understanding of disease-associated genetic variants, the functions of related genes, and regulatory networks. High-throughput sequencing has also been widely used. In recent years, an increasing number of studies have identified genes associated with ATAAD through high-throughput sequencing. However, most of these studies have been based on RNA expressed in aortic tissue. Because obtaining aortic tissue is invasive and difficult to apply clinically, using differentially expressed RNA in aortic tissue as a biomarker for AD may not be appropriate.

[0005] ATAAD is associated with high rates of disability and mortality, making early detection challenging. Although enhanced aortic CT is the gold standard for diagnosing ATAAD, it is expensive, time-consuming, and often unavailable in many primary care hospitals. Furthermore, aortic tissue is difficult to obtain, making it challenging to identify differentially expressed RNA as a biomarker. Therefore, differentially expressed RNA screened from peripheral blood can more easily be used as a biomarker for ATAAD in clinical practice. Summary of the Invention

[0006] Technical problems solved: In response to the above technical problems, the present invention provides molecular markers for aortic dissection and their applications, which can effectively solve the shortcomings of existing methods in that the detection time for type A aortic dissection is long and it is difficult to distinguish it from acute myocardial infarction.

[0007] Technical solution: In a first aspect, the present invention provides an application of a substance for detecting molecular markers of aortic dissection, including one or more of the following applications:

[0008] 1) Application in the preparation of products for diagnosing aortic dissection;

[0009] 2) Application in the preparation of products for screening aortic dissection;

[0010] 3) Use in the preparation of products for assessing the risk of aortic dissection;

[0011] 4) Application in the preparation of products for differentiating aortic dissection from acute myocardial infarction;

[0012] The aortic dissection molecular markers include gene EDNRB (Gene ID: 1910) and gene KIF19 (Gene ID: 124602).

[0013] Preferably, the aortic dissection molecular marker further includes gene METTL7B (Gene ID: 196410).

[0014] Furthermore, the aortic dissection molecular marker also includes gene PRR35 (Gene ID: 146325).

[0015] Preferably, the substance is a reagent for detecting the expression of aortic dissection molecular markers, or a reagent for specifically identifying aortic dissection molecular markers, or a reagent for detecting the content of aortic dissection molecular markers.

[0016] Preferably, the substance is a substance for detecting aortic dissection molecular markers and is selected from the following a), b) or c):

[0017] a) Primers for detecting the expression of molecular markers for aortic dissection; or primers for specifically identifying molecular markers for aortic dissection;

[0018] b) a reagent set containing the reagent described in a);

[0019] c) A kit containing a) or b).

[0020] Furthermore, the primers include upstream primers and downstream primers for amplifying the EDNRB gene, whose nucleotide sequences are shown in SEQ ID No. 1-SEQ ID No. 2; upstream primers and downstream primers for amplifying the KIF19 gene, whose nucleotide sequences are shown in SEQ ID No. 3-SEQ ID No. 4; upstream primers and downstream primers for amplifying the METTL7B gene, whose nucleotide sequences are shown in SEQ ID No. 5-SEQ ID No. 6; upstream primers and downstream primers for amplifying the PRR35 gene, whose nucleotide sequences are shown in SEQ ID No. 7-SEQ ID No. 8:

[0021] SEQ ID No.1: TGCTGGGGATCATCGGGAA;

[0022] SEQ ID No.2: GCGATCAAGATATTGGGACCGT;

[0023] SEQ ID No.3: GGAGATGGTGTATCAGGCCAC;

[0024] SEQ ID No.4: CGTTGAGGGTCTGAACATAGATG;

[0025] SEQ ID No.5: TGGAGAGGACATGAGACAGC;

[0026] SEQ ID No.6: TGCTCCCAGAAAAAAGAGCACA;

[0027] SEQ ID No.7: CTGCCTGAGTCGTGGAAGC;

[0028] SEQ ID No. 8: GGCTGAGCGGGTAGTTGAC.

[0029] Beneficial effects: 1) The genes EDNRB, KIF19, METTL7B and PRR35 protected by the present invention can be used as biomarkers for AD;

[0030] 2) The genes EDNRB, KIF19, METTL7B, and PRR35 protected by the present invention can be used as one of the indicators for assessing the severity of AD patients;

[0031] 3) The marker panels of different combinations consisting of the genes EDNRB, KIF19, METTL7B and PRR35 protected by the present invention have good potential for diagnosing AD patients and have good diagnostic efficacy, which can distinguish AD patients from AMI patients and enable patients to receive effective treatment. BRIEF DESCRIPTION OF THE DRAWINGS

[0032] Figure 1 Volcano plot (A) and cluster heat map (B) of differentially expressed genes, where L represents the dissection case group and HC represents the normal control group;

[0033] Figure 2 The qPCR results are used to specifically verify the mRNA expression levels of each gene between the aortic dissection and acute myocardial infarction case groups and the normal control group in the present invention, where CON: normal control group (n=64); AMI: acute myocardial infarction case group; ATAAD: aortic dissection case group (n=64), *: P<0.05; **: P<0.01; ***: P<0.001; ns: no statistically significant difference;

[0034] Figure 3 is the restricted cubic spline regression analysis curve of the association between specific gene mRNA expression and ATAAD;

[0035] Figure 4 The ROC curves of the molecular markers of different gene combinations of the present invention for diagnosing aortic dissection are shown;

[0036] Figure 5 The figure is a ROC curve diagram of molecular markers of different gene combinations of the present invention for distinguishing aortic dissection from acute myocardial infarction. DETAILED DESCRIPTION

[0037] The present invention will be described in detail below with reference to the accompanying drawings and specific embodiments: Example 1

[0038] First, high-throughput transcriptome sequencing was performed on 8 ATAAD cases and 20 normal controls to identify differentially expressed mRNA genes in ATAAD cases. Twenty genes each with the most significant up-regulated and down-regulated differential expression in the sequencing results were selected for validation. Next, a three-group case-control study design was employed. In the first phase, 84 pairs of ATAAD case and control samples were used for validation. Gene mRNAs with statistically significant validation results consistent with the sequencing direction were included in the second phase of validation. In the second phase, 94 pairs of ATAAD case and control samples were used for validation. Gene mRNAs with statistically significant validation results consistent with the sequencing direction were included in the specificity validation. Specificity validation involved 64 AMI cases and 64 controls. Gene mRNAs differentially expressed between the ATAAD and AMI groups were designated as ATAAD-specific mRNAs. Real-time quantitative polymerase chain reaction (qRT-PCR) was used to determine mRNA expression levels of the validated genes. Finally, relative quantification (2-ΔΔCT) was used to calculate mRNA expression. The Mann-Whitney U test was used to compare gene expression differences between the case group and the control group. Restricted cubic spline regression (RCS) was used to explore the dose-response relationship between gene mRNA expression levels and ATAAD. Receiver operating characteristic (ROC) curves were used to evaluate the ability of specific gene mRNA to discriminate between ATAAD and normal subjects, and between ATAAD and AMI. The sensitivity, specificity, and area under the ROC curve (AUC) were analyzed. Different models were constructed to analyze their discriminatory value for ATAAD. Specific data are as follows:

[0039] Association between specific mRNA expression and acute Stanford type A aortic dissection: a case-control study.

[0040] 1. Clinical samples:

[0041] Peripheral blood was collected from 178 patients diagnosed with AD who were hospitalized in the Department of Cardiovascular Surgery at Nanjing First Hospital between 2019 and 2022. 1.5 mL of peripheral blood was collected using an EDTA anticoagulant tube, and 4.5 mL of whole blood RNA preservation solution (Nanjing Yi Ning Fu Sheng Biotechnology Co., Ltd.) was added and thoroughly mixed. The blood was then stored in a -20°C refrigerator for RNA extraction. Inclusion criteria:

[0042] Inclusion criteria for ATAAD patients included: ① Han Chinese aged 18-85 years; ② ATAAD diagnosed by full-length aortic contrast-enhanced scanning and confirmed intraoperatively. Exclusion criteria included: ① Cardiovascular disease caused by genetic disorders or inherited cardiovascular diseases such as Marfan syndrome, Ehlers-Danlos syndrome, familial thoracic aortic aneurysm, and dissection caused by trauma; ② Patients confirmed intraoperatively to have non-ATAAD; ③ Patients with malignant tumors; ④ Patients with other conditions deemed unsuitable for inclusion in the study by the investigator.

[0043] Inclusion criteria for AMI cases: ① Han Chinese aged 18-85 years; ② Patients hospitalized with AMI at Nanjing First Hospital, with the diagnosis of acute myocardial infarction (type I myocardial infarction) using the fourth edition of the "Global Definition of Myocardial Infarction" criteria, namely acute myocardial injury [increase and / or decrease in serum cardiac troponin (cTn), with at least one level exceeding the upper limit of normal (99th percentile of the upper limit of the reference value)], and clinical evidence of acute myocardial ischemia, including: I. Symptoms of acute myocardial ischemia; II. New ischemic electrocardiographic changes; III. New pathological Q waves; IV. New imaging evidence of viable myocardial loss or ventricular wall segmental motion abnormalities; V. Coronary angiography or intravascular imaging. Exclusion criteria: ① Taking antiplatelet and lipid-lowering drugs within the past 2 weeks; ② Severe hepatic and renal insufficiency (ALT>5 times ULN, eGFR<30mL / min / 1.73mm 2 ); ③ Patients with malignant tumors; ④ Known bleeding disorders or active bleeding; ⑤ Patients participating in other interventional clinical trials.

[0044] This invention is in collaboration with the School of Public Health of Nanjing Medical University, and the control source is the prospective cohort study population conducted in Jurong City, Jiangsu Province from 2018 to 2019.

[0045] Inclusion criteria for controls: Individuals were matched 1:1 with ATAAD and AMI cases in terms of age (±2 years) and gender.

[0046] Control exclusion criteria: patients with severe heart, brain, lung, kidney diseases and tumors.

[0047] 2. Experimental methods:

[0048] 2.1 RNA extraction:

[0049] Total RNA from peripheral blood was extracted using the magnetic bead method (Cat# Yu-BR02-1, Yu'an Biotechnology Co., Ltd., Wuxi, China). The specific steps are as follows:

[0050] (1) Sample processing: Thaw the frozen sample in the preservation solution at room temperature, mix thoroughly by inverting, add 800 μL of the sample to a 1.5 mL centrifuge tube, then add 600 μL of isopropanol, and mix thoroughly by inverting. Centrifuge at 7230 rpm at 4°C for 10 min.

[0051] (2) Discard the supernatant and retain the precipitate. Add 400 μL of lysis adsorption buffer, 10 μL of RNA protectant, and 10 μL of mixed magnetic beads. Close the lid and place the centrifuge tube on a shaker for 10 minutes. Remove the centrifuge tube and centrifuge briefly.

[0052] (3) Place the centrifuge tube on a magnetic rack and let it stand for 2 minutes. Open the lid, aspirate the liquid with a pipette and discard it, retaining the magnetic beads.

[0053] (4) Add 600 μL of Buffer AW1, close the cap, and place the centrifuge tube on a shaker for 1 min.

[0054] (5) Place the centrifuge tube on a magnetic rack. After standing for 1 minute, quickly invert the magnetic rack upside down to fully recover the magnetic beads on the centrifuge tube cap. Let stand for another 1 minute. Open the cap and use a pipette to aspirate and discard the liquid, retaining the magnetic beads.

[0055] (6) Add 600 μL of 80% DEPC ethanol, close the cap, and place the centrifuge tube on a shaker for 1 min;

[0056] (7) Place the centrifuge tube on a magnetic rack. After standing for 1 minute, quickly invert the magnetic rack upside down to fully recover the magnetic beads on the centrifuge tube cap. Let stand for another 1 minute. Open the cap and use a pipette to aspirate and discard the liquid, retaining the magnetic beads.

[0057] (8) Repeat steps (6)-(7);

[0058] (9) Place the centrifuge tube on a foam board, place it in a 50°C constant temperature water bath, and dry it for 2 minutes;

[0059] (10) Take back the centrifuge tube, add 50 μL of eluent A, blow the magnetic beads thoroughly to disperse them into the eluent, close the lid, place the centrifuge tube on a foam board, and place it in a 52°C constant temperature water bath for 2 min;

[0060] (11) Place the centrifuge tube on a magnetic rack and let it stand for 2 minutes until the liquid becomes clear. Open the lid and use a pipette to transfer the liquid to another new centrifuge tube, discarding the magnetic beads.

[0061] (12) RNA concentration and purity were detected by ultraviolet spectrophotometry (Thermo Nano Drop 2000 nucleic acid protein analyzer). RNA purity was qualified when the OD value (260 / 280) was between 1.8 and 2.0.

[0062] 2.2 RNA reverse transcription to cDNA

[0063] cDNA was synthesized using the TAKARA reverse transcription kit (RR047A Takara PrimeScript™ RT reagent Kit with gDNA Eraser, Japan). The specific steps are as follows:

[0064] (1) Based on the measured concentrations, balance the RNA of samples with different concentrations to four fixed values: 10 ng / μL, 30 ng / μL, 50 ng / μL, and 100 ng / μL. Calculate the volume of eluent A required based on the concentrations;

[0065] (2) Add 2 μL of reverse transcription system 1 to a 200 μL centrifuge tube;

[0066] (3) Add RNA sample to the centrifuge tube (volume calculated based on concentration), centrifuge, and place in a 42°C water bath for 2 min;

[0067] (4) Add 10 μL of reverse transcription system 2 and centrifuge;

[0068] (5) PCR amplification, the program was set at 37°C for 15 min, 85°C for 5 s, and 15°C for ∞;

[0069] (6) After reverse transcription is completed, store in a -80°C refrigerator for subsequent experiments.

[0070] 2.3 qRT-PCR

[0071] Design the mRNA primer sequences according to the mRNA primer design principles;

[0072] Relative quantification of mRNA was performed by qPCR using the SYBR Green assay. A 384-well plate was used, with three replicate wells set up for each sample, and GAPDH was used as the reference gene. The first-stage assay was performed using the ABI QuantStudio 7 fluorescence quantitative PCR system, and the second-stage assay and specificity verification were performed using the Fusheng FS384 real-time fluorescence quantitative PCR instrument. The standard deviation of the CT value between replicate wells for each sample was less than 0.5, and the final reading was the average of the three replicate wells.

[0073] The system used 1.5 μL of cDNA sample, 1.3 μL of RNase-free H2O, 2.8 μL of SYBR Green Master Mix, and 0.2 μL each of forward and reverse primers, for a total of 6 μL system;

[0074] The qPCR program settings were: ① Pre-denaturation: 95°C, 5 min; ② Denaturation: 95°C, 10 s; ③ Annealing: 57°C, 20 s; ④ Extension: 72°C, 20 s; ⑤ Melting curve: instrument default settings. Steps ②-④ were cycled 40 times, and the remaining steps were performed only once.

[0075] 2.4 Calculation method of mRNA expression

[0076] The relative quantification method (2-ΔΔCT) was used to calculate the expression level of each mRNA. The specific method is as follows:

[0077] (1) ΔCT = CT value of target gene - CT value of reference gene;

[0078] (2) Batch coefficient fn = average ΔCT of the control group in each batch / average ΔCT of the total control group;

[0079] (3) ΔCT core = ΔCT / fn;

[0080] (4) ΔΔCT core = ΔCT core - average ΔCT of total control;

[0081] (5) mRNA expression level = 2(-ΔΔCT nuclei).

[0082] 2.5 Data collation and statistical analysis

[0083] All experimental data were independently collated and verified for consistency by two researchers. The mRNA expression of each gene was calculated using the relative quantification method. Before analysis, the ΔCT value was corrected for extreme values ​​within the mean ± three standard deviations. Differences in mRNA expression levels between the case and control groups were compared using the Mann-Whitney U test. Restricted cubic spline regression (RCS) was used to analyze the dose-response relationship between mRNA expression levels and ATAAD prevalence. Receiver-operating characteristic (ROC) curves were constructed to analyze the discriminative ability of specific mRNAs for ATAAD and healthy controls, and for ATAAD and AMI. Sensitivity, specificity, and area under the curve (AUC) were calculated. All analyses were performed using SPSS 24 or R 4.2.2 statistical software. Statistical significance was considered to be two-sided P < 0.05.

[0084] 3. Experimental results:

[0085] like Figure 1As shown: RNA-Seq detected a total of 19,548 mRNAs, of which 3,634 were significantly dysregulated (Padj < 0.05, |log2FC| > 1); compared with the normal control group, 1,923 mRNAs were significantly upregulated and 1,711 mRNAs were significantly downregulated in the ATAAD group. Volcano plot ( Figure 1 A) and heatmap ( Figure 1 B) shows the expression profiles of mRNAs between ATAAD and normal controls.

[0086] like Figure 2 As shown: Compared with the control group, the mRNA expression of EDNRB and KIF19 genes in the AMI case group was differentially up-regulated (P<0.05), while the mRNA expression of METTL7B gene had no statistically significant difference (P>0.05); compared with the AMI case group, the mRNA expression of METTL7B gene in the ATAAD case group was differentially up-regulated (P<0.05), while the mRNA expression of KIF19 gene was differentially down-regulated (P<0.05); compared with the control group, the mRNA expression of each gene in the ATAAD case group was differentially expressed.

[0087] like Figure 3 As shown: The upregulated gene mRNA generally showed that the risk of ATAAD increased with the increase of expression level, among which the risk of ATAAD increased with the increase of EDNRB expression level; with the increase of METTL7B expression level, the risk of ATAAD showed an increased disease risk, and when the expression level reached a certain level, the risk no longer increased; the initial risk of PRR35 increased with the increase of expression level, and then decreased slightly with the increase of expression level, but the risk was still much higher than the low expression level; the downregulated gene mRNA generally showed that the risk of ATAAD decreased with the increase of expression level, among which KIF19 first reduced the risk with the increase of expression level, then increased slightly with the increase of expression level, and finally showed a harmful effect (OR>1).

[0088] like Figure 4 As shown: the AUC value of gene EDNRB and gene KIF19 is greater than 0.81, the AUC value of gene EDNRB, gene KIF19 and gene METTL7B is greater than 0.95, and the AUC value of gene EDNRB, gene KIF19, gene METTL7B and gene PRR35 is greater than 0.95, indicating that the above gene combination has good potential for diagnosing AD and has good diagnostic efficacy, and the larger the ACU value, the greater the diagnostic efficiency of the corresponding gene combination.

[0089] like Figure 5As shown in the figure: the AUC value of gene EDNRB and gene KIF19 is greater than 0.93, the AUC value of gene EDNRB, gene KIF19 and gene METTL7B is greater than 0.96, and the AUC value of gene EDNRB, gene KIF19, gene METTL7B and gene PRR35 is greater than 0.97, indicating that the above gene combination has good potential for distinguishing aortic dissection from acute myocardial infarction, and the larger the AUC value, the greater the discrimination ability of the corresponding gene combination.

[0090] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions and improvements made within the spirit and principles of the present invention should be included in the scope of protection of the present invention.

Claims

1. An application of a substance for detecting molecular markers of aortic dissection, characterized in that: This includes one or more of the following applications: 1) Application in the preparation of products for diagnosing aortic dissection; 2) Application in the preparation of products for screening aortic dissection; 3) Use in the preparation of products for assessing the risk of aortic dissection; 4) Application in the preparation of products for differentiating aortic dissection from acute myocardial infarction; The aortic dissection is Stanford type A, the test sample is peripheral blood whole blood RNA, and the substance is the following a), b) or c): a) Primers for detecting the mRNA expression of molecular markers of aortic dissection; b) a reagent set comprising a); c) a kit comprising a) or b); The aortic dissection molecular marker is one of the following combinations: ① EDNRB and KIF19 genes; ②Genes EDNRB, KIF19, and METTL7B; ③Gene EDNRB, gene KIF19, gene METTL7B and gene PRR35.

2. The use according to claim 1, wherein: The nucleotide sequences of the upstream primer and downstream primer for amplifying the EDNRB gene are shown as SEQ ID No.1-SEQ ID No.2; the nucleotide sequences of the upstream primer and downstream primer for amplifying the KIF19 gene are shown as SEQ ID No.3-SEQ ID No.4; the nucleotide sequences of the upstream primer and downstream primer for amplifying the METTL7B gene are shown as SEQ ID No.5-SEQ ID No.6; and the nucleotide sequences of the upstream primer and downstream primer for amplifying the PRR35 gene are shown as SEQ ID No.7-SEQ ID No.8.

Citation Information

Patent Citations

  • Aortic dissection molecular marker and application thereof

    CN118726571A

  • Aortic dissection molecular marker and application thereof

    CN118755816A

  • Molecular marker for differential diagnosis of aortic dissection and acute myocardial infarction and application thereof

    CN118755817A