A fluorescence detection kit for phenylalanine and application thereof

Abstract

The application discloses a fluorescence detection kit for phenylalanine and application thereof, and has a fluorescence chain, a quenching chain, a replacement chain and a single-stranded DNA isomerase. The application establishes a new method for detecting phenylalanine based on a phenylalanine single-stranded DNA isomerase and a chain replacement reaction, and adopts a method of phenylalanine single-stranded DNA isomerase, chain replacement reaction and fluorescence labeling for detection, so that radioactive safety protection is not needed, gel separation is not needed, and 96-well plates can be used for high-throughput detection.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of phenylalanine detection, and particularly relates to a fluorescence detection kit for phenylalanine and application thereof. BACKGROUND

[0002] SELEX (Systematic Evolution of Ligands by EXponential enrichment) is a technology for screening and evolving nucleic acid molecules with high specificity, which has important applications in biosensors and molecular recognition. Existing technologies have successfully screened isocatalytic nucleic acid enzymes that can sense phenylalanine using the SELEX method. Isocatalytic nucleic acid enzymes are a special type of nucleic acid molecule that not only catalyze chemical reactions like ordinary enzymes, but also have specificity for substrate recognition, thus having potential application value in detecting specific molecules.

[0003] However, when detecting the self-cleavage activity of these isocatalytic nucleic acid enzymes, existing technologies usually need to rely on radioactive labeling or staining after gel electrophoresis separation. These methods have some limitations: first, radioactive labeling has safety risks and requires special protective measures, which is not suitable for routine laboratory use; second, the gel electrophoresis staining method is time-consuming and requires multiple steps, including sample preparation, electrophoresis, staining, and result analysis, which not only increases the complexity of the operation, but also limits the high-throughput of the experiment. SUMMARY

[0004] The present application aims to overcome the defects of the prior art and provide a fluorescence detection kit for phenylalanine.

[0005] Another object of the present application is to provide a method for detecting phenylalanine in a liquid sample using the above-mentioned fluorescence detection kit.

[0006] The technical solution of the present application is as follows:

[0007] A fluorescence detection kit for phenylalanine, characterized in that it comprises a fluorescence chain, a quenching chain, a replacement chain, and a single-stranded DNA isocatalytic enzyme, wherein,

[0008] The fluorescence chain has a nucleotide sequence as shown in SEQ ID NO. 01, and is modified with a fluorescence group at the 5' end;

[0009] The quenching chain has a nucleotide sequence as shown in SEQ ID NO. 02, and is used to pair with the fluorescence chain, and is modified with a quenching group corresponding to the fluorescence group at the 3' end;

[0010] The replacement chain has a nucleotide sequence as shown in SEQ ID NO. 03, and is used to competitively replace the quenching chain;

[0011] The single-stranded DNA isomerase has a nucleotide sequence as shown in SEQ ID NO. 04, and has a nucleotide sequence of the above-mentioned replacement strand at the 5' end, and is capable of being cleaved by phenylalanine in the sample to release the above-mentioned replacement strand from the 5' end thereof to competitively replace the above-mentioned quencher strand.

[0012] In a preferred embodiment of the present application, the fluorescent group is FAM.

[0013] Further preferably, the quencher group is BHQ1.

[0014] The use of the above-mentioned fluorescent detection kit in the quantitative detection of the content of phenylalanine in a liquid sample.

[0015] In a preferred embodiment of the present application, the following steps are included:

[0016] (1) constructing the inter-relationship curve of the quencher strand, the fluorescent strand and the replacement strand, including finding the concentration increasing curve of the fluorescent strand, obtaining a suitable concentration of the quencher strand and establishing a standard curve of the replacement strand;

[0017] (2) according to the inter-relationship curve obtained in step (1), adding the inter-bound fluorescent strand and quencher strand and the single-stranded DNA isomerase into the liquid sample, using the phenylalanine in the liquid sample to induce the cleavage of the single-stranded DNA isomerase, releasing the nucleotide sequence identical to the above-mentioned replacement strand from the 5' end thereof to competitively replace the quencher strand inter-bound with the fluorescent strand, and observing the change of the fluorescence intensity after the competitive replacement, thereby calculating the concentration of the phenylalanine in the liquid sample.

[0018] A method for the quantitative detection of phenylalanine in a liquid sample, which is carried out by using the above-mentioned fluorescent detection kit.

[0019] In a preferred embodiment of the present application, the following steps are included:

[0020] (1) constructing the inter-relationship curve of the quencher strand, the fluorescent strand and the replacement strand, including finding the concentration increasing curve of the fluorescent strand, obtaining a suitable concentration of the quencher strand and establishing a standard curve of the replacement strand;

[0021] (2) according to the inter-relationship curve obtained in step (1), adding the inter-bound fluorescent strand and quencher strand and the single-stranded DNA isomerase into the liquid sample, using the phenylalanine in the liquid sample to induce the cleavage of the single-stranded DNA isomerase, releasing the nucleotide sequence identical to the above-mentioned replacement strand from the 5' end thereof to competitively replace the quencher strand inter-bound with the fluorescent strand, and observing the change of the fluorescence intensity after the competitive replacement, thereby calculating the concentration of the phenylalanine in the liquid sample.

[0022] The application has the beneficial effect that the application establishes a new phenylalanine fluorescence detection method based on phenylalanine single-stranded DNA isomeric nucleic enzyme and strand displacement reaction, which uses phenylalanine single-stranded DNA isomeric nucleic enzyme, strand displacement reaction and fluorescence labeling method for detection, without the need for radioactive safety protection, without the need for gel separation, and can use 96-well plates for high-throughput detection. BRIEF DESCRIPTION OF DRAWINGS

[0023] Figure 1 The design scheme of the phenylalanine fluorescence detection technology based on phenylalanine single-stranded DNA isomeric nucleic enzyme and strand displacement reaction in Example 1 of the application.

[0024] Figure 2 The relationship between the concentration of the fluorescence strand and the fluorescence intensity in Example 1 of the application is shown.

[0025] Figure 3 The quenching effect of the quenching strand in Example 1 of the application is shown.

[0026] Figure 4 The effect of different concentrations of the replacement strand on the fluorescence-quenching system in Example 1 of the application is shown.

[0027] Figure 5 The concentration of phenylalanine detected by the phenylalanine single-stranded DNA isomeric nucleic enzyme in Example 1 of the application is shown. DETAILED DESCRIPTION

[0028] The technical solutions of the application are further described and explained in detail below through specific embodiments in conjunction with the drawings.

[0029] Example 1

[0030] The phenylalanine fluorescence detection kit of the present embodiment is characterized in that it has a fluorescence strand, a quenching strand, a replacement strand and a single-stranded DNA isomeric enzyme, wherein,

[0031] The fluorescence strand has a nucleotide sequence as shown in SEQ ID NO. 01, and is modified with a fluorescence group at the 5' end;

[0032] The quenching strand has a nucleotide sequence as shown in SEQ ID NO. 02, and is used to pair with the above-mentioned fluorescence strand, and is modified with a quenching group corresponding to the above-mentioned fluorescence group at the 3' end;

[0033] The replacement strand has a nucleotide sequence as shown in SEQ ID NO. 03, and is used to competitively replace the above-mentioned quenching strand;

[0034] The single-stranded DNA isomeric nucleic acid enzyme has a nucleotide sequence shown as SEQ ID NO. 04, and has a nucleotide sequence of the above-mentioned replacement strand at the 5' end, and can be induced to be cleaved by phenylalanine in a sample, so as to release the above-mentioned replacement strand from the 5' end to competitively replace the above-mentioned quencher strand.

[0035] As shown in the above-mentioned fluorescence detection kit, the content of phenylalanine in the liquid sample is quantitatively detected, which specifically includes the following steps: Figure 1

[0036] (1) Constructing the correlation curve of the quencher strand, the fluorescence strand and the replacement strand, including exploring the concentration increasing curve of the fluorescence strand, obtaining the appropriate quencher strand concentration and establishing the replacement strand standard curve; specifically as follows:

[0037] 1) Explore the concentration increasing curve of the fluorescence strand; the sequence of the fluorescence strand is SEQ ID NO. 01: FAM-cctagtggtcacgctgagcagctg.

[0038] ① In a 1.5 mL finger tube, add the following ingredients:

[0039]

[0040]

[0041] ② After mixing the above ingredients, use a multifunctional enzyme marker to detect the fluorescence, and the excitation wavelength is 492 nm and the emission wavelength is 512 nm. Based on the detection results, draw the concentration increasing curve of the fluorescence strand as shown in Figure 2 , and determine the appropriate concentration of the fluorescence strand (SEQ ID NO. 01).

[0042] 2) Explore the appropriate quencher strand concentration; the sequence of the quencher strand is SEQ ID NO. 02: agcgtgaccactagg-BHQ1.

[0043] ① In a 1.5 mL finger tube, add the following ingredients:

[0044]

[0045] ② After mixing, incubate at 80°C for 1 min, then incubate at 50°C for 15 min, and incubate at 25°C for 15 min.

[0046] ③ After the reaction is completed, detect the fluorescence value at the excitation wavelength of 492 nm and the emission wavelength of 512 nm. Based on the detection results, draw the correlation curve of the fluorescence strand and the quencher strand as shown in Figure 3 , and determine the appropriate concentration of the quencher strand (SEQ ID NO. 02). ​

[0047] 3) Establish a replacement chain standard curve; the replacement chain sequence is SEQ ID NO. 03: cagctgctcagcgtgaccactagg.

[0048] ① In a 1.5 mL pipette, add the following ingredients:

[0049]

[0050]

[0051] ② After mixing, incubate at 80°C for 1 min, then at 50°C for 15 min, and at 25°C for 15 min.

[0052] ③ Detect the fluorescence value at an excitation wavelength of 492 nm and an emission wavelength of 512 nm, and establish the replacement curve of the replacement chain as shown in Figure 4 .

[0053] (2) According to the correlation curve obtained in step (1), add the mutually combined fluorescence chain and quenching chain and single-stranded DNA isomerase to the liquid sample, induce the single-stranded DNA isomerase to be cut by phenylalanine in the liquid sample, release the same nucleotide sequence as the above replacement chain from the 5' end, competitively replace the quenching chain combined with the fluorescence chain, and observe the change of fluorescence intensity after competitive replacement, so as to calculate the concentration of phenylalanine in the liquid sample; specifically as follows:

[0054] 1) In order to cooperate with the chain replacement reaction, the sequence of phenylalanine single-stranded DNA isomerase is designed as follows:

[0055] SEQ ID NO. 04:

[0056] cagctgctcagcgtgaccactaggagcatctttggcgagaagactctggattcggggaccagttgctgctaggggaataaatctttgggc

[0057] acctagtggtc

[0058] 2) Induce the isomerase to be cut by phenylalanine; in a 1.5 mL pipette, add the following ingredients:

[0059]

[0060] Add different ingredients in the above table, heat at 80°C for 1 min, mix well. Incubate at 37°C for 1 h to induce nuclease cleavage.

[0061] 3) The DNA fragments cut by the single-stranded DNA isomerases are used for strand displacement reaction, and the change of fluorescence after strand displacement is observed to calculate the concentration of phenylalanine in the sample:

[0062] a. 0.5 μM fluorescent chain (SEQ ID NO. 01) and 0.3 μM quencher chain (SEQ ID NO. 02) are added to the above tubes containing the nuclease cleavage reaction, mixed, and then heated at 80°C for 1 min and incubated at 50°C for 2 min.

[0063] b. Then the fluorescence value is detected at an excitation wavelength of 492 nm and an emission wavelength of 512 nm. The change of fluorescence after strand displacement is observed (as shown in FIG. 2), and thus the concentration of phenylalanine in the liquid sample is calculated. Figure 5

[0064] The above description is only the preferred embodiment of the present application, and thus cannot limit the scope of the present application. Any equivalent changes and modifications made according to the scope and content of the present patent should still be within the scope of the present application.​

Claims

1. A fluorescent detection kit for phenylalanine, characterized by: A fluorescent detection reagent kit comprising a fluorescent strand, a quencher strand, a displacement strand and a single-stranded DNA isomerase, wherein, the fluorescent strand has a nucleotide sequence as shown in SEQ ID NO. 01 and is modified with a fluorescent group at its 5' end; the quencher strand has a nucleotide sequence as shown in SEQ ID NO. 02 and is modified with a quencher group corresponding to the fluorescent group at its 3' end, so as to be complementary to the fluorescent strand; the displacement strand has a nucleotide sequence as shown in SEQ ID NO. 03, so as to competitively displace the quencher strand; the single-stranded DNA isomerase has a nucleotide sequence as shown in SEQ ID NO. 04, and is modified with the nucleotide sequence of the displacement strand at its 5' end, and is capable of being induced by phenylalanine in a sample to be cleaved, so as to release the displacement strand from its 5' end to competitively displace the quencher strand.

2. The fluorescent detection kit according to claim 1, wherein: The fluorescent group is FAM.

3. The fluorescent detection kit of claim 2, wherein: The quencher group is BHQ1.

4. Use of the fluorescent detection reagent kit according to any one of claims 1 to 3 for quantitatively detecting the content of phenylalanine in a liquid sample.

5. Use according to claim 4, characterized in that: The method comprises the following steps: (1) constructing the interrelationship curve of the quencher strand, the fluorescent strand and the displacement strand, including finding the concentration increasing curve of the fluorescent strand, obtaining a suitable concentration of the quencher strand and establishing a standard curve of the displacement strand; (2) according to the interrelationship curve obtained in step (1), adding the interbound fluorescent strand and quencher strand and the single-stranded DNA isomerase into the liquid sample, using the phenylalanine in the liquid sample to induce the single-stranded DNA isomerase to be cleaved, so as to release the nucleotide sequence identical to the displacement strand from its 5' end to competitively displace the quencher strand interbound with the fluorescent strand, and observing the change of the fluorescence intensity after the competitive displacement, so as to calculate the concentration of the phenylalanine in the liquid sample.

6. A method for the quantitative determination of phenylalanine in a liquid sample, characterized in that: The method is performed by using the fluorescent detection reagent kit according to any one of claims 1 to 3.

7. The quantitative detection method according to claim 6, wherein: The method comprises the following steps: (1) constructing the interrelationship curve of the quencher strand, the fluorescent strand and the displacement strand, including finding the concentration increasing curve of the fluorescent strand, obtaining a suitable concentration of the quencher strand and establishing a standard curve of the displacement strand; (2) according to the interrelationship curve obtained in step (1), adding the interbound fluorescent strand and quencher strand and the single-stranded DNA isomerase into the liquid sample, using the phenylalanine in the liquid sample to induce the single-stranded DNA isomerase to be cleaved, so as to release the nucleotide sequence identical to the displacement strand from its 5' end to competitively displace the quencher strand interbound with the fluorescent strand, and observing the change of the fluorescence intensity after the competitive displacement, so as to calculate the concentration of the phenylalanine in the liquid sample.

Images