A method for multiplex PCR amplification and genotype identification of Hericium erinaceus strain No. 1210 MNP marker

Through multiple PCR amplification and genotype identification methods of 9 pairs of MNP-labeled primers, the accuracy and efficiency of the detection of 9-paired MNP-labeled MNP strains were solved, and the efficient and specific identification of 'Shanghai Monkey No. 1210' strain was achieved.

CN118745456BActive Publication Date: 2025-08-12SHANGHAI ACAD OF AGRI SCI
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202410922961.1
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-07-10
Publication Date
2025-08-12
Estimated Expiration
2044-07-10

AI Technical Summary

Technical Problem

The prior art cannot efficiently and accurately perform genetic specific testing of monkey head strains, resulting in insufficient detection efficiency and accuracy.

Method used

Multiple PCR amplification and genotype identification were used for 9 MNP marker primers, and MNP genotype was determined by setting up 9 MNP marker primers.

Benefits of technology

The identification of the monkey head bacteria ‘Shanghou No. 1210’ strain was achieved, and the accuracy and efficiency of the detection were improved.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN118745456B_ABST
    Figure CN118745456B_ABST
Patent Text Reader

Abstract

The present invention discloses a method for multiplex PCR amplification and genotype identification of Hericium erinaceus Huhou No. 1210 strain using MNP markers, belonging to the technical field of Hericium erinaceus strain detection. Multiplex PCR amplification and genotype identification are performed by setting a mixed primer pair of 9 pairs of MNP marker primers and Hericium erinaceus strain DNA. Multiplex PCR amplification can be performed using the 9 pairs of MNP marker primer pairs and mycelial genomic DNA to determine the MNP genotype. Subsequently, the "Hangzhou Hou No. 1210" strain in each group of mushrooms can be quickly identified by comparing the 9 pairs of MNP marker genotypes. Compared with conventional morphological detection, antagonism test, and mushroom fruiting test, the method has the advantages of high accuracy, strong specificity, and good repeatability. The multiple steps in the method can accurately screen the "Hangzhou Hou No. 1210" strain in Hericium erinaceus.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of Hericium erinaceus strain detection technology, specifically, it relates to a method for multiplex PCR amplification of MNP markers in Hericium erinaceus strain No. 1210 and its genotype identification. Background Technology

[0002] Hericium erinaceus (monkey head mushroom) is tender, delicious, and rich in nutrients. Long ago, it was considered one of the "Four Famous Dishes," alongside bear's paw, sea cucumber, and shark fin, and was even praised as "mountain delicacy Hericium erinaceus, seafood delicacy bird's nest," becoming a tribute item in ancient times. Due to its strong resistance to contaminating bacteria and wide adaptability, Hericium erinaceus is well-suited for widespread cultivation. Furthermore, with the rapid development of my country's edible mushroom industry, coupled with its beneficial stomach-soothing effects, it has gained immense popularity among consumers. The Hu Hou 1210 variety is a hybrid of the widely cultivated cultivars Ci Chang and 0605, exhibiting significantly higher yields, better mushroom shape, and stronger resistance than its parents.

[0003] Currently, the identification of Hericium erinaceus strains is generally carried out through conventional morphological tests, antagonistic tests, and fruiting tests. However, when identifying Hericium erinaceus strains, it is not possible to clearly and definitively detect the genetic specificity of Hericium erinaceus species, which affects the overall detection efficiency and makes the detection accuracy unclear and undefined. Summary of the Invention

[0004] The purpose of this section is to outline some aspects of embodiments of the present invention and to briefly describe some preferred embodiments. Simplifications or omissions may be made in this section, as well as in the abstract and title of this application, to avoid obscuring the purpose of these documents; however, such simplifications or omissions should not be construed as limiting the scope of the invention.

[0005] To address the problems mentioned in the background section, the present invention adopts the following technical solution.

[0006] A method for multiplex PCR amplification of MNP markers in Hericium erinaceus strain 1210 (Shanghai strain) and its genotype identification, comprising the following steps:

[0007] Step 1, Mycelial Culture: Transfer the mycelium of Hericium erinaceus onto a PDA plate and incubate at 25°C in the dark. Collect the mycelium after 15 days.

[0008] Step 2: Genomic DNA Extraction: Genomic DNA was extracted from the mycelia using the CTAB method. The concentration and purity of total genomic DNA were determined by ultraviolet spectrophotometry. The sample DNA concentration was adjusted to 100–200 ng / µL.

[0009] Step 3, Multiplex PCR amplification: Mix equal amounts of the 9 pairs of primers in the MNP-labeled primer set and perform multiplex PCR amplification on the extracted DNA.

[0010] Step 4, Sequencing: Add Illumina sequencing adapters and barcodes to the products of the multiplex PCR above and sequence them using an Illumina sequencer.

[0011] Step 5: Use the sequencing results from the Illumina sequencer in Step 4 to identify MNP marker genotypes.

[0012] Preferably, the total volume of the multiplex PCR amplification system in step three is 20 μL, comprising: 10 μL of Premix Taq™ (1.25 U / 25 μL Taq DNAase, 0.4 mM / L dNTP, 0.3 mM / L PCR buffer), a 4 μmol / L MNP-labeled primer set mixture, 4 μL of ddH2O, and 2 μL of template DNA extracted at a concentration of 100–200 ng / μL.

[0013] Preferably, the PCR reaction conditions in step three are: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 45 s eternity, 60℃ annealing for 5 min, 72℃ extension for 5 min, 30 cycles; 72℃ further extension for 7 min; and storage at 4℃.

[0014] Preferably, the nine pairs of MNP marker genotype combinations are: GT001 / GT001 / GT001 / GT003 / GT001 / GT003 / GT001 / GT002 / GT001 strains, which are identified as Hericium erinaceus strain 'Shanghai Hericium erinaceus 1210', and the sequences of the nine pairs of MNP marker primer sets are SEQ ID NO.1 to SEQ ID NO.18.

[0015] Preferably, the use of MNP marker genotyping in step five includes the following steps:

[0016] Step 1: Use FASTP software to filter sequencing adapters;

[0017] Step 2: Use BWA software to align the GCA_016906435.1 genome, and use samtools to sort the sam file and convert it into a bam file;

[0018] Step 3: Use bcftools to perform mutation detection;

[0019] Step 4: Use the R package geneHapR to identify MNP marker genotypes.

[0020] Preferably, the MNP marker primer set of the Hericium erinaceus strain "Hu Hou 1210" is a mixture of 9 pairs of MNP marker primers developed using multiple nucleotide polymorphisms in the Hericium erinaceus genome to identify the MNP genotype of the Hericium erinaceus strain. The obtained genotype is compared with the genotype of the strain "Hu Hou 1210". If the genotype is consistent with the obtained genotype, it is the Hericium erinaceus strain "Hu Hou 1210".

[0021] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0022] By setting up a mixture of 9 pairs of MNP marker primers and performing multiplex PCR amplification and genotyping on Hericium erinaceus strain, the MNP genotype can be determined by PCR amplification of mycelial genomic DNA using the 9 pairs of MNP marker primers. Then, by comparing the genotypes of the 9 pairs of MNP markers, the "Hu Hou 1210" strain in each group of mushrooms can be quickly identified. Compared with conventional morphological detection, antagonism test, and fruiting test, this method has the advantages of high accuracy, strong specificity, and good reproducibility. Through the multiple steps in this method, the "Hu Hou 1210" strain in Hericium erinaceus can be accurately screened. Attached Figure Description

[0023] Figure 1 This is the MNP genotype diagram of the "Shanghai Monkey 1210" of this invention;

[0024] Figure 2 This is a diagram showing the MNP genotypes of primer MNP1 in 17 selected Hericium erinaceus materials used in this invention.

[0025] Figure 3 This is a diagram showing the MNP genotypes of primer MNP2 in 17 selected Hericium erinaceus materials used in this invention.

[0026] Figure 4 This is a diagram showing the MNP genotypes of primer MNP3 in 17 selected Hericium erinaceus materials used in this invention.

[0027] Figure 5 This is a diagram showing the MNP genotypes of primer MNP4 in 17 selected Hericium erinaceus materials used in this invention.

[0028] Figure 6 This is a diagram showing the MNP genotypes of primer MNP5 in 17 selected Hericium erinaceus materials used in this invention.

[0029] Figure 7 This is a diagram showing the MNP genotypes of primer MNP6 in 17 selected Hericium erinaceus materials used in this invention.

[0030] Figure 8This is a diagram showing the MNP genotypes of primer MNP7 in 17 selected Hericium erinaceus materials used in this invention.

[0031] Figure 9 This is a diagram showing the MNP genotypes of primer MNP8 in 17 selected Hericium erinaceus materials used in this invention.

[0032] Figure 10 This is a diagram showing the MNP genotypes of primer MNP9 in 17 selected Hericium erinaceus materials. Detailed Implementation

[0033] To make the above-mentioned objects, features and advantages of the present invention more apparent and understandable, the specific embodiments of the present invention will be described in detail below with reference to the accompanying drawings.

[0034] Many specific details are set forth in the following description in order to provide a full understanding of the invention. However, the invention may also be practiced in other ways different from those described herein, and those skilled in the art can make similar extensions without departing from the spirit of the invention. Therefore, the invention is not limited to the specific embodiments disclosed below.

[0035] Secondly, the term "one embodiment" or "embodiment" as used herein refers to a specific feature, structure, or characteristic that may be included in at least one implementation of the present invention. The phrase "in one embodiment" appearing in different places throughout this specification does not necessarily refer to the same embodiment, nor is it a single or selective embodiment that mutually excludes other embodiments. The present invention provides the following embodiments.

[0036] This invention discloses an MNP marker primer set for Hericium erinaceus strain 1210 from Shanghai. The primer set consists of 9 pairs of MNP marker primers mixed in equal amounts. It is an MNP marker primer set developed based on the continuous nucleotide polymorphism of the Hericium erinaceus genome. It has high identification accuracy, strong specificity and good reproducibility. Detailed marker information is shown in Table 1.

[0037] Table 1 List of MNP-labeled primers

[0038]

[0039]

[0040] This invention also provides a multiplex PCR amplification method for Hericium erinaceus strain "Hu Hou 1210". Nine pairs of MNP marker primers developed using continuous nucleotide variations in the Hericium erinaceus genome are used to identify the MNP genotype of Hericium erinaceus strain. The obtained genotype is compared with the genotype of strain "Hu Hou 1210". If the genotype is consistent with the obtained genotype, it is Hericium erinaceus strain "Hu Hou 1210".

[0041] By identifying the MNP marker genotypes of 17 Hericium erinaceus varieties collected, the present invention determined the number of allelic genotypes and the number of consecutive variable nucleotide sites identified by 9 pairs of MNP marker primer sets in 17 Hericium erinaceus varieties and numbered them (Table 2). By combining the numbers of different MNP allelic sites, Hericium erinaceus variety Huhou No. 1210 can be effectively identified ( Figure 2-10 ).

[0042] Table 2 MNP allelic genotypes

[0043]

[0044] Table 3 MNP genotypes of Huhou No. 1210

[0045]

[0046]

[0047] Marker and Premix TaqTM were both purchased from: Takala Bio Biotechnology Co., Ltd.; the remaining materials and reagents were all ordinary commercially available products.

[0048] Table 4 Strain sources

[0049]

[0050] Among them, the genotype combination of the Hericium erinaceus variety Huhou No. 1210 strain is shown in Table 3.

[0051] Among them, the sequences (5′-3′) of 9 pairs of MNP marker primers are as follows:

[0052] MNP1 forward primer: CGCTCTTCCGATCTAATACAATGTGGATGCTGGATGA

[0053] Reverse primer: TGCTCTTCCGATCTCGACTGCCGGGGACTG

[0054] MNP2 forward primer: CGCTCTTCCGATCTAGACAGCAAGCCTCACTGC

[0055] Reverse primer: TGCTCTTCCGATCTAGAGTAACTTGGCGAGCA

[0056] MNP3 forward primer: CGCTCTTCCGATCTCATCCTTATCTGCGGTCGGG

[0057] Reverse primer: TGCTCTTCCGATCTTGCGATATGTGAGAGACAGAAA

[0058] MNP4 forward primer: CGCTCTTCCGATCTCATCCACCATCAAGAATCTTCTG

[0059] Reverse primer: TGCTCTTCCGATCTACAATGTGTCCTATCTTTGTCAG

[0060] MNP5 forward primer: CGCTCTTCCGATCTTATCCTGTTTTCGCAGCACTGAG

[0061] Reverse primer: TGCTCTTCCGATCTGTCATTTGCCACGCGC

[0062] MNP6 forward primer: CGCTCTTCCGATCTCGTTGTCAACACCCGATTG

[0063] Reverse primer: TGCTCTTCCGATCTGCGAAAGACTACCCAGAACAG

[0064] MNP7 forward primer: CGCTCTTCCGATCTAGCCCTCTTTCATGCCCTTC

[0065] Reverse primer: TGCTCTTCCGATCTGACCCTAAGACGGCTTTCAG

[0066] MNP8 forward primer: CGCTCTTCCGATCTTGCCTCGAACTCCGCAG

[0067] Reverse primer: TGCTCTTCCGATCTTTTGAAGGGAGTCGACAAGATGT

[0068] MNP9 forward primer: CGCTCTTCCGATCTAAGATGTCCGCGGCTCTT

[0069] Reverse primer: TGCTCTTCCGATCTGGTGTCTCCTGCGGGTG

[0070] Primers were synthesized by Shanghai Sangon Biotech Co., Ltd.

[0071] like Figure 1-10 As shown, a method for multiplex PCR amplification of MNP markers in Hericium erinaceus strain 1210 (Shanghai strain) and its genotype identification is described. The method includes the following steps:

[0072] Step 1, Mycelial Culture: Transfer the mycelium of Hericium erinaceus onto a PDA plate and incubate at 25°C in the dark. Collect the mycelium after 15 days.

[0073] Step 2: Genomic DNA Extraction: Genomic DNA was extracted from the mycelia using the CTAB method. The concentration and purity of total genomic DNA were determined by ultraviolet spectrophotometry. The sample DNA concentration was adjusted to 100–200 ng / µL.

[0074] Step 3, Multiplex PCR amplification: Mix equal amounts of the 9 pairs of primers in the MNP-labeled primer set and perform multiplex PCR amplification on the extracted DNA.

[0075] Step 4, Sequencing: Add Illumina sequencing adapters and barcodes to the products of the multiplex PCR above and sequence them using an Illumina sequencer.

[0076] Step 5: Use the sequencing results from the Illumina sequencer in Step 4 to identify MNP marker genotypes.

[0077] In this embodiment, the total volume of the multiplex PCR amplification system in step three is 20 μL, including: 10 μL of Pre mix Taq™ (1.25 U / 25 μL Taq DNAase, 0.4 mM / L dNTP, 0.3 mM / L PCR buffer), 4 μmol / L MNP-labeled primer set mixed primers, 4 μL of ddH2O, and 2 μL of template DNA extracted at a concentration of 100–200 ng / μL.

[0078] In this embodiment, the PCR reaction conditions in step three are: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 45 seconds, 60℃ annealing for 5 min, 72℃ extension for 5 min, 30 cycles; 72℃ further extension for 7 min; and storage at 4℃.

[0079] like Figure 1 As shown, the nine pairs of MNP marker genotype combinations are: GT001 / GT001 / GT001 / GT003 / GT001 / GT003 / GT001 / GT002 / GT001, and the bacterial species is identified as Hericium erinaceus 'Shanghai Hericium erinaceus 1210'. The sequences of the nine pairs of MNP marker primer sets are SEQ ID NO.1 to SEQ ID NO.18.

[0080] In this embodiment, the use of MNP marker genotype identification in step five includes the following steps:

[0081] Step 1: Use FASTP software to filter sequencing adapters;

[0082] Step 2: Use BWA software to align the GCA_016906435.1 genome, and use samtools to sort the sam file and convert it into a bam file;

[0083] Step 3: Use bcftools to perform mutation detection;

[0084] Step 4: Use the R package geneHapR to identify MNP marker genotypes.

[0085] like Figure 2-10 As shown, the MNP marker primer set of the Hericium erinaceus strain "Hu Hou 1210" was developed by mixing 9 pairs of MNP marker primers developed using multiple nucleotide polymorphisms in the Hericium erinaceus genome. The MNP genotype of the Hericium erinaceus strain was identified by mixing the obtained genotype with the genotype of strain "Hu Hou 1210". If the genotype is consistent with the obtained genotype, it is Hericium erinaceus strain "Hu Hou 1210".

[0086] The above description, in conjunction with specific embodiments, provides a further detailed explanation of the present invention. It should not be construed that the specific implementation of the present invention is limited to these descriptions. For those skilled in the art, several simple deductions or substitutions can be made without departing from the concept of the present invention, and all such deductions or substitutions should be considered to fall within the scope of protection defined by the claims submitted herein.

Claims

1. A multiplex PCR amplification and genotype identification method of Hericium erinaceus strain 1210 MNP marker, characterized in that: The method comprises the following steps: Step 1: Mycelial culture: transfer the mycelium of Hericium erinaceus to a PDA plate, culture in the dark at 25°C, and collect the mycelium after 15 days; Step 2: Extraction of genomic DNA: Extract the genomic DNA from the mycelium using the CTAB method. Detect the total genomic DNA concentration and purity using UV spectrophotometry. Adjust the sample DNA concentration to 100-200 ng / uL. Step 3: Multiplex PCR amplification: 9 pairs of primers in the MNP-labeled primer set were mixed in equal amounts and then subjected to multiplex PCR amplification on the above-extracted DNA; Step 4: Sequencing: Add Illumina sequencing adapters and barcodes to the multiplex PCR products and sequence them using an Illumina sequencer. Step 5: Perform MNP marker genotyping on the sequencing results of the Illumina sequencer in step 4; The MNP-labeled primer set for the Hericium erinaceus "Shanghai Hou No. 1210" strain is a mixture of 9 pairs of MNP-labeled primers developed using multiple nucleotide polymorphisms in the Hericium erinaceus genome, and the Hericium erinaceus strain is subjected to MNP genotype identification. The obtained genotype is compared with the genotype of the "Shanghai Hou No. 1210" strain, and the strain with the same genotype is the Hericium erinaceus "Shanghai Hou No. 1210" strain; The sequences of the 9 pairs of MNP labeling primer sets are SEQ ID NO.1 to SEQ ID NO.

18.

2. The method for multiplex PCR amplification and genotype identification of Hericium erinaceus strain MNP markers according to claim 1, characterized in that: The total volume of the multiplex PCR amplification system in step 3 is 20 μL, including: Premix Taq™ 1.25 U / 25 μL Taq DNA enzyme, 0.4 mM / L dNTP, 0.3 mM / L PCR buffer 10 μL, 4 μmol / L MNP-labeled primer set mixed primers, 4 μL ddH2O, and 2 μL of template DNA extracted at a concentration of 100-200 ng / μL.

3. The method for multiplex PCR amplification and genotype identification of Hericium erinaceus strain MNP markers according to claim 2, characterized in that: The PCR reaction conditions in step 3 are as follows: pre-denaturation at 94° C. for 5 min; denaturation at 94° C. for 45 seconds, annealing at 60° C. for 5 min, extension at 72° C. for 5 min, 30 cycles; extension at 72° C. for 7 min; and storage at 4° C.

4. The method for multiplex PCR amplification and genotype identification of Hericium erinaceus strain MNP markers according to claim 1, characterized in that: The use of MNP marker genotype identification in step 5 includes the following steps: Step 1: Use fastp software to filter sequencing adapters; Step 2: Use BWA software to align the GCA_016906435.1 genome, and use samtools to sort the sam file and convert it into a bam file; Step 3: Use bcftools to perform mutation detection; Step 4: Use the R package geneHapR to identify the MNP marker genotype.

Citation Information

Patent Citations

  • Primer pair and method for identifying hericium erinaceus houjie No.2

    CN105567842A

  • New hericium erinaceus strain HE015 as well as molecular marker and application thereof

    CN117965323A