Use of a glycosyltransferase mutant in catalyzing synthesis of flavone glycoside compounds

By protein engineering the blueberry glycosyltransferase VcUGT1 to form the mutant AAVT, the problems of high cost and low efficiency in the preparation of flavonoid O-glycoside compounds were solved, and the efficient and specific biosynthesis of flavonoid 7-O-glucoside was achieved, making it suitable for industrial production.

CN118755685BActive Publication Date: 2025-10-24ZHEJIANG UNIV
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
CN202410880641.4
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-07-02
Publication Date
2025-10-24
Estimated Expiration
2044-07-02

AI Technical Summary

Technical Problem

In the existing technology, the preparation of flavonoid O-glycoside compounds has the problems of high cost and difficulty in achieving green and efficient synthesis. In addition, the traditional chemical synthesis method is cumbersome and highly polluting. The glycosyltransferases discovered in nature have low catalytic activity and poor regioselectivity.

Method used

By protein engineering the blueberry-derived glycosyltransferase VcUGT1, S367A, V274A, F82V and I132T mutations were introduced to form the mutant AAVT, which improved the catalytic activity and regioselectivity. This enzyme was then used to catalyze the reaction of flavonoids with UDP-glucose to produce flavonoid 7-O-glucoside.

Benefits of technology

The mutant AAVT significantly improved the production efficiency and regioselectivity of flavonoid 7-O-glucoside, realizing the efficient and specific biosynthesis of flavonoid O-glucoside compounds, which is suitable for industrial production.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN118755685B_ABST
    Figure CN118755685B_ABST
Patent Text Reader

Abstract

The application provides application of a glycosyltransferase mutant in catalyzing synthesis of flavone glycoside compounds, and belongs to the technical field of biological enzymes.The application provides a mutant AAVT of a glycosyltransferase VcUGT1 screened from blueberries, wherein, compared with the glycosyltransferase VcUGT1, the mutant AAVT has point mutations of S367A, V274A, F82V and I132T.The mutant can significantly improve the catalytic activity of a glycosyltransferase reaction, and can efficiently catalyze substrates to generate corresponding 7-O-glucoside compounds.The enzyme catalysis reaction of the mutant can produce flavone-7-O-glucoside compounds with medical value in a large amount in industrialization, and the catalysis reaction condition is mild and green and environmentally friendly, and the mutant has the prospect of industrialization development and application.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of biological enzymes, and particularly relates to application of a glycosyltransferase mutant in catalyzing synthesis of flavone glycoside compounds. BACKGROUND

[0002] Flavone glycosides are flavonoids widely distributed in nature, which have various structures and properties. Studies have shown that the glycosylation modification of flavone precursors is completed by specific glycosyltransferases in plants, which usually form O and C glycoside bonds to connect UDP-glucose, UDP-galactose and other donors to flavone acceptors. As the main modification type, O-glycosylation not only increases the species richness of flavone glycoside compounds, but also improves the physicochemical properties of precursor flavone aglycone and can endow it with new biological activity functions. Research has confirmed that flavone O-glycoside compounds have various biological activities, including anti-inflammatory, antioxidant, immune regulation, blood glucose regulation and cardiovascular health maintenance. In addition, due to their good water solubility and in vivo bioavailability, flavone O-glycoside compounds have high application potential and commercial value in the fields of medicine and health food. However, the preparation of flavone O-glycoside compounds mainly adopts traditional chemical methods to separate and purify from plant stems, leaves or fruits, but is limited by geographical location, climate and environment, and the low content of natural flavone glycosides in plants, resulting in high economic cost of preparing flavone O-glycoside compounds and failing to meet the needs of industrial production. In addition, the classical chemical synthesis method needs complicated protection and deprotection synthesis steps, and a large amount of organic waste is also produced in the intermediate process, so it is difficult to realize green and efficient preparation of flavone O-glycoside compounds.

[0003] At present, the method for biosynthesis of flavone glycosides has attracted widespread attention from researchers due to its environmental protection, sustainability and low cost. However, most of the glycosyltransferases mined from nature have the disadvantages of low catalytic activity and poor regioselectivity, thereby affecting the efficient and specific in vitro biosynthesis of flavone glycosides. By using protein engineering technology to perform site-directed modification on the active center of wild enzymes, the flavone O-glycoside compounds can be synthesized accurately and efficiently, the production cost is reduced, and finally the specific production needs of people are met. Therefore, improving the catalytic activity and regioselectivity of glycosyltransferases on flavone precursor aglycone through protein engineering is the key to the biosynthesis of flavone O-glycoside compounds. SUMMARY

[0004] The application provides application of a glycosyltransferase mutant in catalyzing synthesis of flavone glycoside compounds. The glycosyltransferase mutant can catalyze synthesis of various flavone 7-O-glucoside compounds in a green, efficient and specific manner.

[0005] The present application provides a glycosyltransferase mutant, which comprises an amino acid sequence shown in (a) or (b) below:

[0006] (a) shown in SEQ ID No. 1;

[0007] (b) retaining the alanine at position 367, the alanine at position 274, the valine at position 82 and the threonine at position 132 of the sequence shown in SEQ ID No. 1, and having more than 50% homology with the sequence shown in SEQ ID No. 1.

[0008] The present application also provides a gene encoding the above-mentioned glycosyltransferase mutant.

[0009] Preferably, the nucleotide sequence of the gene comprises the gene shown in SEQ ID No. 2.

[0010] The present application also provides a recombinant expression vector comprising the above-mentioned gene.

[0011] The present application also provides a recombinant cell comprising the above-mentioned recombinant expression vector and expressing the above-mentioned glycosyltransferase mutant.

[0012] The present application also provides the use of the above-mentioned glycosyltransferase mutant or the glycosyltransferase mutant expressed by the above-mentioned recombinant cell in the preparation of a flavone 7-O-glucoside compound.

[0013] The present application also provides a method for preparing a flavone 7-O-glucoside compound, comprising the following steps: using the above-mentioned glycosyltransferase mutant or the glycosyltransferase mutant expressed by the above-mentioned recombinant cell as a biological catalyst, using a flavone having medicinal potential as a receptor, and using UDP-glucose as a donor substrate to synthesize a flavone 7-O-glucoside compound after catalytic reaction.

[0014] Preferably, the receptor comprises at least one of the following: genistein, glycyrrhizin, kaempferol, apigenin and baicalein.

[0015] Preferably, the system of the catalytic reaction comprises, in 200 μL: 50 mM Tris-HCl, 0.2-0.5 mM MgCl2, 0.5-1 mM donor substrate, 0.5-1 mM receptor, 100 μg biological catalyst, and pH value is 7.5.

[0016] Preferably, the temperature of the catalytic reaction is 30°C, and the time of the catalytic reaction is 12 h.

[0017] Beneficial effects: the application provides a mutant AAVT of glycosyltransferase VcUGT1 screened from blueberries, wherein the mutant AAVT has point mutations of S367A, V274A, F82V and I132T compared to glycosyltransferase VcUGT1 (amino acid sequence SEQ ID No. 11, nucleotide sequence SEQ ID No. 12). The mutant AAVT can significantly improve the catalytic activity of glycosyltransferase reaction, and can efficiently catalyze the substrate to generate corresponding 7-O-glucoside compounds. When baicalein is used as a receptor substrate, the conversion rate of the product is about 95 times that of the wild type, and the selectivity to the 7-OH region is 99%. When genistein, glycyrrhizin, kaempferol and apigenin are used as receptor substrates, the mutant AAVT also has high conversion rate and strict regional selectivity. The enzyme catalytic reaction of the mutant AAVT can produce a large number of flavonoid-7-O-glucoside compounds with medical value in a large-scale industrialized manner, and the catalytic reaction condition is mild and green, which has the prospect of industrial development and application. BRIEF DESCRIPTION OF DRAWINGS

[0018] Figure 1 FIG. 6 is a liquid chromatography result diagram of the reaction catalysis of the inactivating enzyme, wild type and mutant AAVT of glycosyltransferase VcUGT and genistein and genistein 4'-O-glucoside and genistein 7-O-glucoside standard products;

[0019] Figure 2 FIG. 7 is a mass spectrum result diagram of the reaction catalysis of genistein and the mutant AAVT or the wild type to generate products 1a and 1b;

[0020] Figure 3 FIG. 8 is a liquid chromatography result diagram of the reaction catalysis of the inactivating enzyme, wild type and mutant AAVT of glycosyltransferase VcUGT and glycyrrhizin and glycyrrhizin 4'-O-glucoside and glycyrrhizin 7-O-glucoside standard products;

[0021] Figure 4 FIG. 9 is a mass spectrum result diagram of the reaction catalysis of glycyrrhizin and the mutant AAVT or the wild type to generate products 2a and 2b;

[0022] Figure 5 FIG. 10 is a liquid chromatography result diagram of the reaction catalysis of the inactivating enzyme, wild type and mutant AAVT of glycosyltransferase VcUGT and kaempferol and kaempferol 7-O-glucoside standard product;

[0023] Figure 6 FIG. 11 is a mass spectrum result diagram of the reaction catalysis of kaempferol and the mutant AAVT or the wild type to generate product 3a;

[0024] Figure 7Figure 1 is a liquid chromatography result diagram of the reaction catalyzed by the inactivating enzyme, wild type and mutant AAVT of glycosyltransferase VcUGT and apigenin and the standard product of apigenin 7-O-glucoside;

[0025] Figure 8 Figure 2 is a mass spectrum result diagram of the reaction catalyzed by the mutant AAVT or wild type and apigenin and the product 4a;

[0026] Figure 9 Figure 3 is a liquid chromatography result diagram of the reaction catalyzed by the inactivating enzyme, wild type and mutant AAVT of glycosyltransferase VcUGT and baicalein and the standard product of baicalein 7-O-glucoside;

[0027] Figure 10 Figure 4 is a mass spectrum result diagram of the reaction catalyzed by the mutant AAVT or wild type and baicalein and the product 5a. DETAILED DESCRIPTION

[0028] The present application provides a glycosyltransferase mutant, which comprises an amino acid sequence as shown in (a) or (b) below:

[0029] (a) shown in SEQ ID No. 1;

[0030] (b) retaining the alanine (Ala) at position 367, the alanine (Ala) at position 274, the valine (Val) at position 82, the threonine (Thr) at position 132 of the sequence shown in SEQ ID No. 1, and having more than 50% homology with the sequence shown in SEQ ID No. 1.

[0031] The glycosyltransferase in the present application is preferably a glycosyltransferase VcUGT1 from Vaccinium corymbosum, the amino acid sequence of which is shown in SEQ ID No. 11 and the nucleotide sequence of which is shown in SEQ ID No. 12.

[0032] The glycosyltransferase VcUGT1 is modified by enzyme engineering based on virtual screening and protein structure sequence in the present application, so that the following four mutation sites are present: S367A, V274A, F82V and I132T, so as to improve the glycosylation efficiency and regional selectivity of flavonoid aglycone, and to efficiently catalyze the synthesis of a variety of flavone 7-O-glucoside compounds.

[0033] The mutant AAVT shown in SEQ ID No. 1 is taken as an example for illustration in the embodiment of the present application, and the mutant AAVT is preferably taken as a template for plasmid containing the sequence shown in SEQ ID No. 12, and the primers shown in Table 1 are sequentially used for PCR amplification to introduce point mutations.

[0034] Table 1 Primers used for introducing point mutations

[0035] Primer name Primer sequence (5'-3') SEQ ID No. Ser-367-Ala-F CAGTTTGCGGATCAGATGACTAATG 3 Ser-367-Ala-R CTGATCCGCAAACTGCGGCAAACCC 4 Val-274-Ala-F AGCATGGCGGTGTTACAAAAGAAGC 5 Val-274-Ala-R TAACACCGCCATGCTTCCAAACGAG 6 Phe-82-Val-F TCCGAGGTGAAACGTGTAGGGTCCAG 7 Phe-82-Val-R ACGTTTCACCTCGGACATTACGACGG 8 Ile-132-Thr-F TATCAACCCAGTCAGCAACCTCATT 9 Ile-132-Thr-R CTGACTGGGTTGATAGAAAAGCAGA 10

[0036] The present application also provides a gene encoding the above-mentioned glycosyltransferase mutant.

[0037] The nucleotide sequence of the gene encoding the mutant AAVT according to the present application is preferably as shown in SEQ ID No. 2.

[0038] The present application also provides a recombinant expression vector comprising the above-mentioned gene.

[0039] The mutant according to the present application can be expressed by an expression system, preferably including a prokaryotic expression system or a eukaryotic expression system, and in the embodiments, a prokaryotic expression system is taken as an example for illustration, but it cannot be merely identified as the entire protection scope of the present application. The present application does not have special limitations on the backbone vector of the expression vector used for expression, and any vector that can meet the requirements of vector construction and expression after transformation of cells can be used, such as pET series vectors, and in the embodiments, pET32a is taken as an example for illustration, but it cannot be merely identified as the entire protection scope of the present application.

[0040] The present application also provides a recombinant cell comprising the above-mentioned recombinant expression vector and expressing the above-mentioned glycosyltransferase mutant.

[0041] In the embodiments of the present application, E. coli is preferably used as the expression cell.

[0042] The present application also provides the use of the above-mentioned glycosyltransferase mutant or the glycosyltransferase mutant expressed by the above-mentioned recombinant cell in the preparation of a flavone 7-O-glucoside compound.

[0043] The present application also provides a method for preparing a flavone 7-O-glucoside compound, comprising the following steps: using the above-mentioned glycosyltransferase mutant or the glycosyltransferase mutant expressed by the above-mentioned recombinant cell as a biological catalyst, using flavones with potential for medicinal use as a receptor, and using UDP-glucose as a donor substrate to synthesize a flavone 7-O-glucoside compound after catalytic reaction.

[0044] The acceptor of the application preferably comprises at least one of genistein, glycyrrhizin, kaempferol, apigenin and baicalein. The system of the catalytic reaction of the application, taking 200 μL, preferably comprises 50 mM Tris-HCl, 0.2-0.5 mM MgCl2, 0.5-1 mM donor substrate, 0.5-1 mM acceptor, 100 μg biocatalyst, and the pH value is 7.5; more preferably comprises 50 mM Tris-HCl, 0.5 mM MgCl2, 1 mM donor substrate, 0.5 mM acceptor, 100 μg biocatalyst, and the pH value is 7.5. The rest of the system of the catalytic reaction of the application is supplemented with Tris-HCl. The temperature of the catalytic reaction of the application is preferably 30°C, and the time of the catalytic reaction of the application is preferably 12 h.

[0045] In order to further illustrate the application, the application of a glycosyltransferase mutant provided by the application in catalyzing synthesis of flavone glycoside compounds is described in detail below in combination with examples, but they should not be understood as limiting the protection scope of the application.

[0046] The materials and methods used in the examples of the application are all conventional commercially available materials and common methods in the art unless otherwise specified.

[0047] Example 1 Mining of glycosyltransferase gene VcUGT1

[0048] Firstly, immature and mature blueberry fruits were taken as two groups of experimental materials, and were sent to Huada Gene for transcriptome sequencing after sampling. According to the gene function annotation of the transcript data, a total of 6 glycosyltransferases related to blueberry anthocyanin synthesis were screened. Then, the expression difference analysis of the 6 candidate genes between the groups was performed, and it was found that the expression amount of VcUGT1 in mature blueberry was much higher than that in immature blueberry, suggesting that this gene played a key role in the metabolic regulation of blueberry anthocyanin biosynthesis, and the amino acid sequence of VcUGT1 was shown as SEQ ID No. 11, and the nucleotide sequence was shown as SEQ ID No. 12.

[0049] (1) Preparation of blueberry fruit cDNA template

[0050] The mature blueberry fruits were quickly frozen in liquid nitrogen, and then RNA extraction was performed. The Plant Total RNA Isolation Kit of Shengong Bioengineering was used to extract and purify the blueberry RNA according to the instruction steps. Then, the PrimeScript RT reagent Kit of TAKARA Company was used to reverse transcribe the RNA into cDNA, which was stored at -80°C for standby use. TM

[0051] (2) Cloning of VcUGT1 and construction of pET32a-VcUGT1 plasmid​

[0052] PCR forward primer (primer F, SEQ ID No. 13) and reverse primer (primer R, SEQ ID No. 14) were designed according to the nucleotide sequence of blueberry glycosyltransferase VcUGT1. The blueberry glycosyltransferase VcUGT1 gene fragment was obtained by PCR amplification using the blueberry fruit cDNA template and 2xT8 High-Fidelity MasterMix. The specific reaction conditions of PCR were as follows: forward primer (10 μM) 2 μL, reverse primer (10 μM) 2 μL, template DNA 1 μL, 2xT8 High-Fidelity MasterMix 25 μL, and double distilled water added to 50 μL. The amplification conditions were as follows: 98 °C pre-denaturation for 2 min, followed by 30 cycles (98 °C for 15 s, 55 °C for 10 s, and 72 °C for 30 s), 72 °C for 10 min, and 4 °C for storage. After PCR, a small amount of product was run on a gel to confirm successful amplification, and the remaining PCR product was cleaned using the Yikai Bio PCR Purification Kit. After cleaning, the concentration was determined using a Nanodrop, and finally stored in a -20 °C refrigerator for standby.

[0053] Forward primer (SEQ ID No. 13): CGGAATTCatgagcagccaccaccacttcctc (32 bp);

[0054] Reverse primer (SEQ ID No. 14): CCGCTCGAGttaccccaatctttccaaaaactgt (34 bp).

[0055] The amplified VcUGT1 gene and pET32a expression vector were digested using restriction endonucleases BamHI and XhoI from TAKARA overnight at 4 °C. Subsequently, the enzyme digestion products were purified and recovered using the Yikai Bio Gel Extraction Kit. Then, according to the concentration of the inserted fragment and the vector after gel recovery, the target gene and the vector were connected according to the steps of the T4 ligase instructions, and the pET32a-VcUGT1 plasmid was obtained.

[0056] (3) Protein expression and purification

[0057] ​​Add 10 μL of recombinant expression pET32a-VcUGT1 plasmid to 100 μL of E.coli BL21 (DE3) competent cells and let it stand on ice for 30 minutes; heat shock in a 42°C water bath for 45 seconds and let it stand on ice for 2 minutes; add 1 mL of LB medium and incubate at 37°C, 220 rpm for 60 minutes; centrifuge at 4000 rpm for 2 minutes, remove 900 μL of supernatant, resuspend the bacteria in the remaining medium, and spread on an ampicillin-resistant LB plate.

[0058] After a small protein expression test, the protein induction conditions of blueberry glycosyltransferase VcUGT1 were determined to be: 20°C, 0.1mM IPTG, 200rpm, and induction for 20h. The recombinant expression strain was then shaken and the OD 600 When the RI is between 0.6 and 0.8, add IPTG to a final concentration of 0.1 mM. Mix well and incubate in a shaker at 200 rpm at 20°C for 20 hours. Then, harvest the cells by centrifugation at 8000 rpm at 4°C. Resuspend the cells thoroughly in Tris-HCl buffer (pH 7.5, 50 mM Tris, 200 mM NaCl) and disrupt them using a cell disruptor. Centrifuge the cells at high speed at 4°C, and retain the supernatant. Purify the supernatant using a HIS-tagged cobalt ion column, equilibrated with 10 mL of Equilibration Buffer. Then, pass 20 mL of the membrane-cleaved supernatant through the column, followed by washing with 8 mL of Equilibration Buffer and then 15 mL of Wash Buffer containing 15 mM imidazole to remove contaminants. The target protein was then eluted with 8 mL of Elution Buffer (containing 150 mM imidazole) and aliquoted into 1.5 mL centrifuge tubes (numbered 1-8). Finally, after purification, the enzyme was concentrated and desalted using Millipore ultrafiltration tubes. An equal amount of 50% glycerol was added to each tube of pure enzyme, mixed, and stored at -80°C.

[0059] Example 2 Plasmid Construction of Glycosyltransferase VcUGT1 Mutant AAVT

[0060] (1) Primers were designed using the pET32a-VcUGT1 plasmid constructed in Example 1 as a template (Table 1). Mutations were made at the S367, V274, F82, and I132 sites to obtain the gene encoding the mutant AAVT (S367A-V274A-F82V-I132T).

[0061] (2) Point mutation PCR reaction system and procedure: Using the wild-type pET32a-VcUGT1 plasmid as a template, the Ser at position 367 was first mutated to Ala using the Novagen Mut Express II Fast Mutagenesis Kit V2. The PCR reaction system was as follows: 1 ng wild-type pET32a-VcUGT1 plasmid, 1 μL dNTPMix (10 mM), 25 μL 2×Max Buffer, 2 μL primer F (10 μM), 2 μL primer R (10 μM), 1 μL Phanta Max Super-Fidelity DNA Polymerase, and filled to 50 μL with ddH2O. The PCR amplification conditions were: pre-denaturation at 95°C for 30 s; denaturation at 95°C for 15 s, annealing at 65°C for 15 s, and extension at 72°C for 2.5 min, for a total of 30 cycles; complete extension at 72°C for 5 min; and storage at 4°C. After the PCR reaction, a small amount of the amplified product was taken for agarose gel electrophoresis. If the target plasmid is amplified correctly, the next digestion experiment can be performed.

[0062] (3) Dpn I digestion, gel recovery, and transformation of point mutation PCR products

[0063] 1 μL DpnI enzyme was added to the PCR amplification product to digest the original template plasmid. The reaction conditions were 37°C for 1 h. Use the Gel Extraction Kit to purify the digestion product according to the manufacturer's instructions. After checking the concentration using a nanodrop assay, store the digestion product at -20°C. Thaw 100 μL of Qingke Biotechnology Top10 competent cells (TSC-C12) on ice, add 10 μL of the purified digestion product, mix gently, and let it rest on ice for 30 minutes. Incubate in a 42°C water bath for 50 seconds. Quickly transfer the cells to an ice-water bath and let it rest for 2 minutes. Add 500 μL of antibiotic-free LB medium and incubate at 37°C, 200 rpm, for 1 hour. Spread approximately 100 μL of the bacterial solution onto solid LB medium containing 50 μg / mL ampicillin and incubate at 37°C for 12-15 hours. Pick three single colonies from the plate and transfer them to LB medium (50 μg / mL ampicillin) for 12 hours at 37°C, 200 rpm, and then aspirate 1 mL of the bacterial solution from each plate for sequencing at Qingke Biotechnology. Using the successfully mutated pET32a-VcUGT1 (S367A) plasmid as a template, PCR amplified the V274A mutant, and so on, finally obtained the pET32a-VcUGT1-AAVT (S367A-V274A-F82V-I132T) mutant plasmid.

[0064] Example 3 Expression and purification of mutant AAVT of glycosyltransferase VcUGTl

[0065] (1) The recombinant vector pET32a-VcUGTl-AAVT(S367A-V274A-F82V-I132T) constructed in Example 2 was transformed into E. coli BL21 competent cells by chemical transformation. About 100 μL of the bacterial solution was spread on LB solid medium containing 50 μg / mL ampicillin and incubated at 37°C for 12-15 h. A single colony on the plate was picked into 5 mL of LB medium (50 μg / mL ampicillin) and incubated at 37°C, 200 rpm for 12 h. Then, it was transferred into 100 mL of LB medium (50 μg / mL ampicillin) and incubated at 37°C, 200 rpm for 3-4 h. When the OD 600 = 0.6, 10 μL of 1 M inducer IPTG was added and the culture was induced at 20°C, 200 rpm for 20 h.

[0066] (2) After the induction, the bacteria were collected by centrifugation at 4°C, 8000 rpm for 10 min. The bacteria were resuspended in PBS buffer and sonicated in an ice-water bath. The supernatant was collected by centrifugation at 4°C, 12000 rpm for 20 min, and then filtered through a 0.45 μm water filter. The protein was purified by His-cobalt ion column affinity. The purification steps were as follows: the cobalt ion column stored at 4°C was used, the storage solution in the column was drained, and the column was washed with 20 mL of ddH2O. The column was first equilibrated with 10 mL of Equilibration Buffer, and then 20 mL of the filtered supernatant was passed through the column. The column was then washed with 8 mL of Equilibration Buffer and 15 mL of Wash buffer containing 15 mM imidazole. Then, the target protein was eluted with 8 mL of Elution Buffer (containing 150 mM imidazole), and collected in 1.5 mL centrifuge tubes in small portions (numbered) 1-8. The molecular weight of the purified protein was verified by SDS-PAGE gel electrophoresis, and its concentration was determined using a BCA protein concentration detection kit. Finally, the protein was concentrated and desalted using a Millipore ultrafiltration tube, and an equal amount of 50% glycerol was added to each tube of the purified protein and mixed well, and stored at -80°C.

[0067] Example 4 Glycosyltransferase VcUGTl and mutant AAVT catalyze the formation of genistein 7-O-glucoside from genistein

[0068] (1) The activity of blueberry glycosyltransferase VcUGT1 (Example 1) and its mutant AAVT (Example 3) was detected in a 1.5 mL EP tube, and the reaction system was: 50 mM Tris-HCl (pH 7.5), 0.5 mM MgCl2, 1 mM UDP-glucose, 0.5 mM genistein, finally 100 μg of pure enzyme was added, and the total volume was 200 μL. The reaction condition was 30°C, 12h. At the same time, the parallel reaction of inactivated enzyme was used as the experimental control. After the reaction was completed, an equal volume of methanol was added to terminate the reaction, and centrifuged at 12000 rpm for 30 min. The supernatant was collected as the final product after reaction, and used for HPLC, LC / MS analysis.

[0069] (2) HPLC detection method: the liquid chromatography column was Welch Ultimate LP-C18 column (250mm x 4.6mm, 5.0μm). The mobile phase was methanol (A) containing 0.1% formic acid and 0.1% formic acid water (B), and the gradient elution program was as follows: 0-1.5min, 35% A; 1.5-7min, 35-80% A; 7-12min, 80% A, 12-13min, 80-35% A; 13-17min, 35% A. The detection wavelength was 290nm, the flow rate was 1.0mL / min, the column temperature was 30°C, and the sample injection amount was 10μL.

[0070] (3) LC / MS detection method: In order to further confirm the obtained product, Agilent Q-TOF 6540 liquid chromatography mass spectrometry (LC / MS) was used for detection. The mass spectrometry condition: the ion source was in the ion mode, the voltage was 3500V; the fragmentation voltage was 175V; the cone hole voltage was 65V; the radio frequency voltage was 750V, and the range was negative ion mode (m / z 150-1200). The chromatography condition: the column used was Welch Ultimate LP-C18 column (250mm x 4.6mm, 5.0μm), and the flow rate was 1.0ml / min. The mobile phase was methanol (A) containing 0.1% formic acid and 0.1% formic acid water (B), and the gradient was 0-1.5min, 35% A; 1.5-7min, 35-80% A; 7-12min, 80% A, 12-13min, 80-35% A; 13-17min, 35% A.

[0071] (4) from Figure 1 and Figure 2It can be seen that mutant AAVT catalyzes genistein to generate genistein 7-O-glucoside (product 1a) with high efficiency, and the conversion rate reaches 90%. Wild-type enzyme catalyzes genistein to generate product 1a and product 1b, wherein the conversion rate of product 1a is 10%, and the conversion rate of product 1b is less than 1%. Compared with the wild type, mutant AAVT has higher catalytic efficiency and regioselectivity.

[0072] Example 5 Glycosyltransferase VcUGT1 and mutant AAVT catalyze glycyrrhizin to generate glycyrrhizin 7-O-glucoside

[0073] (1) The catalytic activity of blueberry glycosyltransferase VcUGT1 (Example 1) and its mutant AAVT (Example 3) was detected in a 1.5 mL EP tube, and the reaction system was: 50 mM Tris-HCl (pH 7.5), 0.5 mM MgCl2, 1 mM UDP-glucose, 0.5 mM glycyrrhizin, finally 100 μg of pure enzyme was added, and the total volume was 200 μL. The reaction condition was 30℃, 12h. At the same time, the parallel reaction of inactivated enzyme was used as the experimental control. After the reaction was completed, an equal volume of methanol was added to terminate the reaction, and centrifuged at 12000 rpm for 30 min. The supernatant was collected as the final product after reaction, and was used for HPLC and LC / MS analysis.

[0074] (2) The HPLC detection method and (3) the LC / MS detection method are as described in Example 4.

[0075] (4) From Figure 3 and Figure 4 It can be seen that mutant AAVT catalyzes glycyrrhizin to generate glycyrrhizin 7-O-glucoside (product 2a) with high efficiency, and the conversion rate reaches 85%, and can also catalyze a small amount of glycyrrhizin 4'-O-glucoside (product 2b) to generate, and the conversion rate is only 5%. Wild-type can generate products 2a and 2b, and the conversion rates are both less than 5%. Mutant AAVT realizes the high conversion rate of 85% for glycyrrhizin 7-O-glucoside, and the 7-OH region specificity of glycyrrhizin is improved to 95%.

[0076] Example 6 Glycosyltransferase VcUGT1 and mutant AAVT catalyze kaempferol to generate kaempferol 7-O-glucoside

[0077] (1) The activity of blueberry glycosyltransferase VcUGT1 (Example 1) and its mutant AAVT (Example 3) was detected in 1.5 mL EP tubes, with a reaction system of 50 mM Tris-HCl (pH 7.5), 0.5 mM MgCl2, 1 mM UDP-glucose, 0.5 mM kaempferol, and finally 100 μg of pure enzyme, with a total volume of 200 μL. The reaction conditions were 30°C, 12 h. At the same time, a parallel reaction with inactivated enzyme was used as an experimental control. After the reaction was completed, an equal volume of methanol was added to terminate the reaction, and centrifugation was performed at 12000 rpm for 30 min. The supernatant was collected as the final product after the reaction and used for HPLC and LC / MS analysis.

[0078] (2) The HPLC detection method and (3) the LC / MS detection method are as described in Example 4.

[0079] (4) As can be seen from Figure 5 and Figure 6 , the mutant AAVT catalyzes the efficient production of kaempferol 7-O-glucoside (product 3a) from kaempferol, with a conversion rate of 75%. The conversion rate of product 3a by the wild-type enzyme is less than 1%. The mutant AAVT has higher catalytic efficiency than the wild-type.

[0080] Example 7 Glycosyltransferase VcUGT1 and mutant AAVT catalyze the production of apigenin 7-O-glucoside from apigenin

[0081] (1) The activity of blueberry glycosyltransferase VcUGT1 and its mutant AAVT was detected in 1.5 mL EP tubes, with a reaction system of 50 mM Tris-HCl (pH 7.5), 0.5 mM MgCl2, 1 mM UDP-glucose, 0.5 mM apigenin, and finally 100 μg of pure enzyme, with a total volume of 200 μL. The reaction conditions were 30°C, 12 h. At the same time, a parallel reaction with inactivated enzyme was used as an experimental control. After the reaction was completed, an equal volume of methanol was added to terminate the reaction, and centrifugation was performed at 12000 rpm for 30 min. The supernatant was collected as the final product after the reaction and used for HPLC and LC / MS analysis.

[0082] (2) The HPLC detection method and (3) the LC / MS detection method are as described in Example 4.

[0083] (4) As can be seen from Figure 7 and Figure 8 , the mutant AAVT catalyzes the efficient production of apigenin 7-O-glucoside (product 4a) from apigenin, with a conversion rate of 70%. The conversion rate of product 4a by the wild-type enzyme is less than 5%. The mutant AAVT has higher catalytic efficiency than the wild-type.

[0084] Example 8 The sugar transferase VcUGT1 and mutant AAVT catalyze the formation of baicalein 7-O-glucoside from baicalein

[0085] 1) The activity of blueberry sugar transferase VcUGT1 (Example 1) and its mutant AAVT (Example 3) was detected in 1.5 mL EP tubes, and the reaction system was: 50 mM Tris-HCl (pH 7.5), 0.5 mM MgCl2, 1 mM UDP-glucose, 0.5 mM baicalein, and finally 100 μg of pure enzyme, with a total volume of 200 μL. The reaction conditions were 30°C, 12 h. At the same time, the parallel reaction of inactivated enzyme was used as the experimental control. After the reaction was completed, an equal volume of methanol was added to terminate the reaction, and centrifuged at 12000 rpm for 30 min. The supernatant was collected as the final product after the reaction, and used for HPLC and LC / MS analysis.

[0086] (2) The HPLC detection method and (3) the LC / MS detection method are as described in Example 4.

[0087] (4) From Figure 9 and Figure 10 it can be seen that the mutant AAVT catalyzes the efficient formation of baicalein 7-O-glucoside (product 5a) from baicalein, with a conversion rate of 100%. The conversion rate of product 5a by the wild-type enzyme is less than 1%. The catalytic ability of mutant AAVT is greatly improved compared to the wild type.

[0088] Although the above examples have made a detailed description of the present application, it is only a part of the embodiments of the present application, not all the embodiments, and people can also obtain other embodiments according to the present embodiments without creativity, which are all within the protection scope of the present application.

Claims

1. A glycosyltransferase mutant, characterized in that, The amino acid sequence of the glycosyltransferase mutant is shown as SEQ ID No.

1.

2. A gene encoding the glycosyltransferase mutant of claim 1.

3. The gene of claim 2, wherein, The nucleotide sequence of the gene is shown as SEQ ID No.

2.

4. A recombinant expression vector comprising the gene of claim 2 or 3.

5. A recombinant cell comprising the recombinant expression vector of claim 4 and expressing the glycosyltransferase mutant of claim 1.

6. Use of the glycosyltransferase mutant of claim 1 or the glycosyltransferase mutant expressed by the recombinant cell of claim 5 in the preparation of a flavone 7-O-glucoside compound, characterized in that, to obtain the flavone 7-O-glucoside compound by catalyzing the acceptor with the glycosyltransferase mutant; the acceptor includes at least one of genistein, glycyrrhizin, kaempferol, apigenin and baicalein.

7. A method of preparing a flavone 7-O-glucoside compound, characterized by, comprising the following steps: using the glycosyltransferase mutant of claim 1 or the glycosyltransferase mutant expressed by the recombinant cell of claim 5 as a biological catalyst, using flavones with medicinal potential as acceptors, and using UDP-glucose as a donor substrate to synthesize flavone 7-O-glucoside compounds after catalytic reaction; the acceptor includes at least one of genistein, glycyrrhizin, kaempferol, apigenin and baicalein.

8. The method of claim 7, wherein, The system of the catalytic reaction includes 50 mM Tris-HCl, 0.2-0.5 mM MgCl2, 0.5-1 mM donor substrate, 0.5-1 mM acceptor, 100 μg biological catalyst, and the pH value is 7.5, all in 200 μL.

9. The method of claim 7 or 8, wherein, The temperature of the catalytic reaction is 30℃, and the time of the catalytic reaction is 12 h.

Citation Information

Patent Citations

  • Citrus flavonoid 7-O-glucosyltransferase as well as coding gene and application thereof

    CN118516326A

  • Glycosyl transferase, mutant and application

    CN118667788A

  • Application of directionally mutated glycosyl transferase in synthesis of galactoside anthocyanin

    CN118813574A