Application of SlRabGAP22 gene in regulating salt tolerance in tomatoes

Abstract

This invention relates to the field of natural science and technology, specifically to the application of the SlRabGAP22 gene in regulating salt tolerance in tomatoes. By understanding the expression regulation and salt tolerance mechanism of SlRabGAP22 and improving the salt tolerance of tomatoes, this invention provides a theoretical basis and practical foundation for future research in related fields. This invention not only provides more theoretical basis and reference for exploring uORF function, but also facilitates the systematic elucidation of the expression regulation and salt tolerance mechanism of the target gene, aiming to lay the foundation for the rapid creation and breeding of salt-tolerant varieties and serve production practices.

Description

Technical Field

[0001] This invention relates to the field of natural science and technology, and in particular to the application of the SlRabGAP22 gene in regulating the salt tolerance of tomatoes. Background Technology

[0002] 1.1 Molecular mechanism of tomato response to salt stress

[0003] Salt stress is typically caused by high concentrations of sodium ions (Na+) in the soil solution. + ) and chloride ions (Cl - The process is divided into primary and secondary stress. In order to more effectively tolerate salt stress, tomatoes have evolved a variety of physiological, biochemical and molecular mechanisms to respond to and resist salt stress. These mainly include the following aspects: (1) Sensing mechanism. Salt stress causes Na + Changes in concentration and osmotic pressure are rapidly sensed by unknown salt sensors or receptors located on the cell surface. Through the strong coupling between osmotic stress receptors and calcium channels, sodium chloride (NaCl) stimulation can also induce calcium ions in the cellular solute within seconds. 2+ (1) Rapid increase in sodium iodide levels. (2) Antioxidant defense mechanism. Tomato plants have formed an antioxidant defense system, which maintains intracellular redox homeostasis through the synergistic action of enzyme and non-enzyme scavenging systems to eliminate reactive oxygen species (ROS) bursts caused by salt stress. (3) Osmotic regulation and ion signaling mechanism. Osmotic regulation is carried out by increasing solute concentration and decreasing water potential to alleviate osmotic imbalance and maintain cell turgor pressure. At the same time, the ion signaling mechanism includes the selective absorption, accumulation or efflux of ions, and the concentration of Na+ in the cytoplasm. + (4) Epigenetic regulation. DNA methylation, histone modifications / variants, and some non-coding RNAs play an important role in regulating tomato's adaptation to salt stress by modulating stress response gene expression and plant development. (5) Plant hormone signaling pathways. Plant hormones are essential for tomato growth and development and mediate biochemical and physiological responses under salt stress. The perception and signal transduction of plant hormone pathways help improve tomato's tolerance to salt stress. In summary, understanding the molecular mechanisms of salt stress signal perception and transduction will help in the subsequent use of molecular and genetic markers / tools to create / breed salt-tolerant tomato varieties and improve agricultural development.

[0004] 1.2 Effects of Salt Stress on Tomatoes

[0005] Tomatoes are moderately salt-sensitive plants, and their growth and development are easily affected by high-salt environments, which can lead to reduced yields or even crop failure in severe cases. The response to salinity mainly depends on the tomato genotype, and it has been proven that salt tolerance is controlled by multiple gene families. The effects of salt stress on tomatoes mainly include: (1) changes in plant morphology. Delayed germination and reduced seed germination rate. Induction of Na absorption by roots. + This leads to a decrease in osmotic potential and water intake, thereby inhibiting root growth. Furthermore, it also inhibits the development of leaves, flowers, and fruits by suppressing cell division or elongation, interfering with sugar metabolism, and reducing water intake. (2) Changes in physiological and biochemical indicators. In vivo Na... + and Cl - Increased accumulation of potassium ions (K) + ) and Ca 2+ The level of ROS decreased, thereby disrupting the ion balance. The antioxidant defense system works in conjunction with the glyoxalase system to remove the excess ROS caused by ROS. At the same time, the decrease in stomatal conductance, transpiration and chlorophyll content inhibited photosynthesis. The content of various plant hormones changed, mitigating the negative effects of salt stress. (3) Changes in gene expression. Under salt stress (concentration range of 50-500 mM NaCl solution), the expression of genes related to cell wall construction, biosynthesis of volatiles and secondary metabolites, protein synthesis and transport activity changed in different tomato varieties. (4) Effects on yield and fruit quality. When the soil salinity reaches 7.6 dS m -1 At times, tomato germination rates and crop yields may decrease by 50%, but this impact is highly dependent on the variety. [9] Salt stress has a limited impact on fruit quality, and moderate salt stress can even improve fruit quality within a certain period of time.

[0006] 1.3 Research progress on plant gene uORF

[0007] Plant growth and development depend on complex and precise regulation of gene expression. The abundance of mRNA in plant cells does not always accurately reflect protein content, usually due to the regulation of mRNA at the translational level. uORFs are a class of elements in the 5' untranslated regions (5'UTR) of mRNA that participate in gene translational regulation. Most of them contain a canonical start codon and are translated into short peptides during mRNA translation, potentially causing ribosome arrest and dissociation. Sequence analysis shows that 49%, 44%, and 65% of the primary open reading frames (pORFs) in the total transcripts of Homo sapiens, mice, and zebrafish, respectively, are associated with predicted AUG-initiated uORFs. 20%–40% of the total transcripts of monocots and dicots also contain uORFs. With the development of emerging sequencing and bioinformatics technologies, the prediction, identification, and functions of uORFs in plant growth, development, and stress resistance are gradually being revealed.

[0008] uORFs typically exert their regulatory role by inhibiting translation initiation of downstream pORFs and modulating their translation rate. They can also affect mRNA stability through nonsense-mediated mRNA degradation. Plants can mitigate or circumvent the inhibitory effects of uORFs on pORFs through self-regulation or environmental responses. Recent sequencing technologies and bioinformatics methods have effectively advanced the prediction, identification, and functional studies of uORFs. Research on uORFs contributes to a deeper understanding of eukaryotic translation regulation mechanisms. The application of plant genetic engineering and CRISPR-Cas9 gene editing technology demonstrates the potential value of uORFs in crop molecular breeding.

[0009] 1.4 Types of plant uORFs, their molecular mechanisms of function, and regulatory roles

[0010] Plant uORFs can be classified into different types based on the location and function of their stop codons. In eukaryotes, protein translation begins with the 40S subunit binding to the cap structure of the mRNA, followed by scanning the mRNA from the 5' to 3' end to initiate the translation process. Physically, the uORF is located at the front of the pORF. Ribosomes typically encounter the uORF first when scanning the mRNA. Except in special cases such as leaky scanning, uORF translation may cause ribosome arrest, thereby inhibiting pORF translation. This process can be divided into three stages: initiation (recognition of the start codon in the uORF), elongation (binding to the complex, allowing the polypeptide chain to elongate), and termination (recognition of the stop codon, terminating translation in the uORF), ultimately affecting the translation level of the pORF to varying degrees. These include triggering nonsense-mediated mRNA degradation (the presence of a stop codon in the uORF and recognition as premature transcription), non-translation of the pORF (the translation mechanism dissociates from the mRNA after uORF translation), or reduced pORF translation (after uORF translation elongation, the 40S and 60S ribosomal subunits dissociate from the uORF, while the 40S ribosomal subunit remains associated with the mRNA, thus restarting pORF translation).

[0011] Previous reviews have reported that uORF plays a regulatory role in plant nutrition (efficient boron uptake by roots and phosphorus transport and distribution) and metabolic pathways (biosynthesis and catabolism of polyamines and phosphorylcholine). Simultaneously, uORF also plays an important role in regulating sugar and vitamin metabolism. In plant growth and development, uORF-mediated translational regulation is crucial for maintaining plant fertility and normal morphology, influencing photomorphogenesis, leaf morphology, and pollen fertility. uORF is also indispensable for maintaining the stable operation of the plant's biological clock. Furthermore, by optimizing the translation of plant immune genes, uORF can help achieve a balance between plant disease resistance and cell growth, and may lead to the development of broad-spectrum disease resistance genes, reducing pesticide use.

[0012] 1.5 Application Prospects of Plant uORF for Gene Editing

[0013] Gene editing technology based on the CRISPR-Cas9 system has become a revolutionary tool for precise and targeted modification of genes and has attracted widespread attention. Mutations in the translation initiation region of most uORFs will cause loss of function of uORFs or fine-tuning of the inhibition efficiency of uORFs on pORFs, thereby reducing their negative regulatory capacity. Gene editing of plant uORFs using the CRISPR-Cas9 system is a newly established and efficient method for regulating endogenous mRNA translation. By improving the translation efficiency of downstream pORFs, the expression of target genes can be increased at the translation level. The specific process includes: (1) predicting uORFs and using a dual-luciferase reporter system to verify the inhibitory effect of uORFs on pORF translation in protoplasts to confirm the functionality of uORFs; (2) using the CRISPR-Cas9 system and plant genetic transformation to generate plants with mutations around the start codon of functional uORFs; (3) identifying transgenic plants in the offspring, detecting the mRNA and protein levels of target genes in these mutants and performing functional verification to study the effect of variable expression of target genes on phenotype.

[0014] Recent studies have demonstrated the feasibility of manipulating gene translation by editing uORFs using the CRISPR-Cas9 system. For example, Zhang et al. found that genome editing of endogenous uORFs in plants could regulate the translation of mRNAs from four pORFs (AtBRI1, AtVTC2, LsGGP1, and LsGGP2) involved in development or antioxidant biosynthesis, thereby increasing protein synthesis. Editing the uORF of LsGGP2 not only improved the tolerance of lettuce (Lactuca sativa) to oxidative stress but also increased ascorbic acid content by 150%. Xing et al. edited the conserved uORF of the strawberry transcription factor (TF) FvebZIPs1.1 gene, generating seven new alleles with different phenotypic intensities; the sugar content of the homozygous T1 mutant was 33.99%–83.6% higher than that of the WT. Liu et al. obtained four homozygous mutant lines by editing the rice flowering suppressor gene Hd2uORF using the CRISPR-Cas9 system. Phenotypic analysis showed that the hd2 urf-edited line flowered 4.6-11.2 days later than the WT SJ2 line. These studies indicate that plant uORFs play a regulatory role in multiple plant traits. With further research into its regulatory mechanisms, the application of uORFs in agricultural crop breeding is particularly promising, as it allows for the design of breeding strategies that regulate different traits and resistance-related factors using gene editing techniques. Summary of the Invention

[0015] To address the aforementioned issues, this invention provides the application of the SlRabGAP22 gene in regulating the salt tolerance of tomatoes. By understanding the expression regulation and salt tolerance mechanism of SlRabGAP22 and improving the salt tolerance of tomatoes, this invention provides a theoretical basis and practical foundation for future research in related fields.

[0016] To achieve the above objectives, the present invention provides the following technical solution:

[0017] This invention provides the application of the SlRabGAP22 gene in regulating the salt tolerance of tomatoes.

[0018] Preferably, overexpression of the SlRabGAP22 gene positively regulates the salt tolerance of tomatoes.

[0019] This invention also provides the application of editing uORF in the SlRabGAP22 gene in regulating the salt tolerance of tomatoes.

[0020] Preferably, editing the uORF in the SlRabGAP22 gene positively regulates the salt tolerance of tomatoes.

[0021] Preferably, the uORF in the SlRabGAP22 gene is edited using sgRNA and the pCBSG012-slu61-DSG vector;

[0022] The nucleotide sequence of the sgRNA is shown in SEQ ID No. 1.

[0023] Preferably, it reduces the damage to tomato photosynthesis caused by salt stress.

[0024] Preferably, the damage to tomato photosynthesis caused by salt stress is reduced by increasing the Fv / Fm ratio.

[0025] Preferably, the salt tolerance of tomatoes is enhanced by reducing growth inhibition and improving photosynthetic efficiency.

[0026] Preferably, the salt tolerance of tomatoes is improved by ROS scavenging.

[0027] Preferably, by reducing Na + The toxicity and reduced salt stress osmotic effect enhance the salt tolerance of tomatoes.

[0028] This invention screened SlRabGAP22, a key gene in response to salt stress, based on combined transcriptomic and metabolomic analysis, as well as gene family and expression pattern analysis. uORF prediction and dual-luciferase reporter system identification revealed that SlRabGAP22 contains a negatively regulatory uORF. Based on this, this study further analyzed the expression regulation and salt tolerance mechanism of SlRabGAP22 from four aspects. First, the T0 generation edited line producing the negatively regulatory uORF was assessed for reduced repression, and changes in the transcription and protein expression levels of the target gene were evaluated. High-expression and Cas9-free T2 generation homozygous lines were then screened. Simultaneously, the T0 generation edited line producing the pORF was screened to obtain low-expression and Cas9-free T2 generation homozygous lines. Second, high-overexpression (OE) SlRabGAP22 homozygous lines were screened. Furthermore, under normal growth and salt stress conditions, the phenotypic traits and physiological and biochemical indicators of selected uORF, pORF homozygous lines, OE lines, and WT lines (the latter three serving as multiple comparisons and controls) were identified and tested to evaluate their growth, development, and salt tolerance characteristics. Through these studies, we aim to gain a deeper understanding of the expression regulation and salt tolerance mechanism of SlRabGAP22 and improve the salt tolerance of tomatoes, providing a theoretical basis and practical foundation for future research in related fields.

[0029] Currently, research on the biological functions and regulatory mechanisms of tomato salt stress response genes is insufficient. There are no reports of using the CRISPR-Cas9 system to edit the negatively regulating uORF in the 5'UTR of salt stress response genes to elucidate their expression regulation and salt tolerance mechanisms, and to enhance tomato salt tolerance without phenotypic defects and gene silencing. This study, based on multiple comparisons and controls using homozygous, OE, and WT lines of the tomato salt stress response gene SlRabGAP22 pORF, focuses on the uORF in its 5'UTR. Editing the uORF using the CRISPR-Cas9 system can increase the expression of downstream target genes at the translational level, precisely fine-tuning the expression of target genes and thus enhancing tomato salt tolerance. In summary, this invention not only provides more theoretical basis and reference for exploring uORF function but also facilitates the systematic elucidation of the expression regulation and salt tolerance mechanisms of target genes, laying the foundation for the rapid creation and breeding of salt-tolerant varieties and serving production practices. Attached Figure Description

[0030] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the accompanying drawings used in the embodiments will be briefly described below.

[0031] Figure 1Prediction, functional identification, and gene editing of SlRabGAP22 uORF; (A) Schematic diagram of CRISPR-Cas9-mediated editing of uORF-operated gene translation; (B) Information table of the original uORF sequence location, type, and length; (C) Verification of the presence of negatively regulatory functional uORFs in the original uORF sequence and their changes at the LUC / REN mRNA level using dual-luciferase reporter system and (D) qRT-PCR technology; (E) Schematic diagram of the original SlRabGAP22 gene structure, target design, and editing status; (F) Sanger sequencing peak diagram; (G) Information table of the location, type, and length of the edited uORF sequence; (H) Schematic diagram of the SlRabGAP22 gene structure after uORF editing; (I) Verification of the presence of negatively regulatory functional uORFs in the edited uORF sequence and their changes at the LUC / REN mRNA level using dual-luciferase reporter system and (J) qRT-PCR technology. Changes in mRNA levels; small and large green ellipses represent the 40S and 60S ribosomal subunits, respectively; zigzag lines associated with the 60S ribosomal subunit represent nascent polypeptides encoded by uORF or pORF; green dots represent proteins produced by pORF; information table predicted by the uORFlight website; ICCu: uORF sequences from -3 to +4 corresponding to the Kozak sequence, i.e., start codon context; ICCm: pORF sequences from -3 to +4 corresponding to the Kozak sequence, i.e., start codon context; left The left side shows a schematic diagram of different dual-luciferase vectors constructed, and the right side shows the corresponding LUC / REN activity bar chart; the horizontal axis represents different mutation types of uORF, and the vertical axis represents the LUC / REN mRNA level; different colored squares represent different uORFs, and red squares represent pORFs; PAM sites are marked with red text or boxes, sgRNA is marked with a thin blue or black line, and base deletions are marked with a short green line; ns, *, and ** indicate no significant difference compared to the control, significant difference at P<0.05, and significant difference at 0.01, respectively;

[0032] Figure 2Gene editing and strain selection for SlRabGAP22 pORF; (A) Generation of SlRabGAP22 pORF knockout mutants using the CRISPR / Cas9 system; (B) sgRNA2 peak diagrams of WT and porf lines; (C) Relative expression levels of SlRabGAP22 in different lines; (D) Western blot analysis of different lines; (E) Relative expression levels of SlRabGAP22 in different lines; PAM sites are marked with red text or boxes, sgRNA is marked with blue or black thin lines, and base insertions are marked with red text / green short lines; Actin was used as an internal control in the Western blot analysis; In the bar chart, the horizontal axis represents the names of different lines, and the vertical axis represents the relative protein expression level calculated in grayscale; ns, *, and ** indicate no significant difference compared to WT, significant differences at P<0.05, and significant differences at 0.01, respectively;

[0033] Figure 3 Phenotypic analysis, growth inhibition, and Fv / Fm ratio analysis of different strains under control and salt stress; (A) Plant phenotypic identification images; (B) Growth inhibition analysis of aboveground parts and roots; (C) Leaf chlorophyll fluorescence imaging images; (D) Violin plot of Fv / Fm ratio statistical analysis; The scale bar in the phenotypic plot is 5 cm; ns, *, and ** indicate no significant difference compared with WT, and significant differences at P<0.05 and 0.01, respectively;

[0034] Figure 4 Photographs and statistical analysis of stomatal aperture characteristics; (A) Photographs of leaf stomatal aperture characteristics; (B) Statistical analysis of stomatal aperture. Scale bar is 2 μm; the horizontal axis represents different treatment groups, and the vertical axis represents stomatal aperture values ​​expressed as width / length; circles, squares, and triangles of different colors represent different strains; ns indicates no significant difference compared to WT;

[0035] Figure 5 For leaf staining and determination of physiological and biochemical indicators; (A) DAB staining; (B) determination of H2O2 content; (C) NBT staining; (D) O2 - Content determination; (E) Determination of antioxidant enzymes, oxidative damage parameters and osmotic regulator content / activity; Scale bar in different stained leaf images is 1 cm; ns, * and ** indicate no significant difference compared with WT, and significant difference at P<0.05 and 0.01, respectively;

[0036] Figure 6Fluorescence detection of H2DCFDA, a ROS indicator in tomato roots under salt stress; (A) Fluorescence observation image under a confocal microscope; (B) Statistical analysis bar chart of fluorescence intensity; The scale bar in the photo is 50 μm; Different colored bars in the bar chart represent different strains; * and ** indicate that the results were statistically significant compared with WT at P<0.05 and 0.01, respectively.

[0037] Figure 7 To assess the endocytosis rate of tomato roots using FM4-64 tracer; (A) Fluorescence images of different varieties under control treatment; (B) Fluorescence images of different varieties under 200 mM NaCl treatment; (C) Statistical analysis bar chart of internalization ratio (intracellular / plasma membrane) under control treatment; (D) Statistical analysis bar chart of internalization ratio (variety / WT) under 200 mM NaCl treatment; The scale bar in the photos is 20 μm; Different colored bars in the bar chart represent different varieties; ns and * indicate no significant difference compared to WT and significant difference at P < 0.05, respectively;

[0038] Figure 8 Sodium Green in tomato roots under salt stress TM Indicator detection of Na + Horizontal; (A) Fluorescence observation image under a confocal microscope; (B) Vacuole Sodium Green under 200mM NaCl treatment. TM Strength ratio (strain / WT) statistical analysis bar chart; scale bar in the photo is 20μm; different colored bars in the bar chart represent different strains; ns and * indicate no significant difference compared with WT and significance at P<0.05, respectively;

[0039] Figure 9 Na from the aboveground parts and roots of different varieties + and K + The content and ratio of Na in the aboveground parts; (A) Na + Content; (B) K in aboveground parts + Content; (C) Na in the aboveground parts + / K + Ratio; (D) Root Na + Content; (E) K in roots + Content; (F) Na in the root + / K + Ratio; the horizontal axis of the bar chart represents different strains, the vertical axis represents different ion contents and their ratios, and different colored bars represent different treatments; ns, * and ** indicate no significant difference compared with WT, significant differences at P<0.05 and 0.01, respectively. Detailed Implementation

[0040] This invention provides the application of the SlRabGAP22 gene (accession number Solyc03g082590.4.1) in regulating salt tolerance in tomatoes. In this invention, overexpression of the SlRabGAP22 gene preferably positively regulates salt tolerance in tomatoes.

[0041] This invention also provides the application of editing the uORF in the SlRabGAP22 gene in regulating the salt tolerance of tomatoes. In this invention, editing the uORF in the SlRabGAP22 gene preferably positively regulates the salt tolerance of tomatoes. This invention preferably uses sgRNA and the pCBSG012-slu61-DSG vector to edit the uORF in the SlRabGAP22 gene; the nucleotide sequence of the sgRNA is shown in SEQ ID No. 1 and SEQ ID No. 2. This invention preferably uses conventional methods to ligate the sgRNA into the pCBSG012-slu61-DSG vector to construct a gene knockout system, and then performs knockout using conventional methods.

[0042] SEQ ID No. 1: GGTGGAAAATCTAATCGGCA.

[0043] SEQ ID No. 2: GTATTCGTCGGGCGTTAACGG.

[0044] In this invention, it is preferable to reduce the damage to tomato photosynthesis caused by salt stress. In this invention, it is preferable to reduce the damage to tomato photosynthesis caused by salt stress by increasing the Fv / Fm ratio. In this invention, it is preferable to enhance the salt tolerance of tomatoes by reducing growth inhibition and improving photosynthetic efficiency. In this invention, it is preferable to improve the salt tolerance of tomatoes by ROS scavenging. In this invention, it is preferable to reduce Na+. + The toxicity and reduced salt stress osmotic effect enhance the salt tolerance of tomatoes.

[0045] To further illustrate the present invention, the following detailed description is provided in conjunction with embodiments, but these should not be construed as limiting the scope of protection of the present invention.

[0046] Example 1

[0047] Salt stress is an extreme abiotic factor that severely restricts plant germination rate, growth, development, and biomass accumulation. Soil salinization has become a major obstacle to improving crop productivity, and the resulting crop losses pose an increasing threat to modern agriculture. Typically, salt stress is caused by high concentrations of sodium (Na₂O) in the soil solution. +Salt stress, caused by Cl-, is categorized into primary stress (early osmotic stress and later ion imbalance, etc.) and secondary stress (oxidative stress and metabolic abnormalities, etc.). To more effectively tolerate salt stress, plants have evolved various physiological, biochemical, and molecular regulatory mechanisms to respond to and resist it. Designing and breeding salt-tolerant crop varieties is an effective strategy for increasing crop yields in saline-alkali farmland. Research on how plants respond to salt stress by altering gene expression and / or protein yield / activity / stability will greatly promote the breeding of salt-tolerant crop varieties.

[0048] The RabGAP family is widely distributed in various eukaryotes and is one of the key regulators of the interchange between two Rab forms. Twenty-four, 25, and 24 RabGAP family members have been found in Arabidopsis, rice, and tomato, respectively. Typically, RabGAPs possess a conserved TBC domain containing six highly conserved motifs A–F, which are important for catalytic activity and structural stability. Furthermore, exposed arginine residues are a key determinant of GAP catalytic activity in vitro and in vivo. Additionally, they exhibit hydrolytic activity controlled by arginine and glutamine, representing the two-finger mechanism of GTP-binding Rab GTPases.

[0049] In plant resistance to salt stress, rabs play an active regulatory role by increasing ion endocytosis, vesicle transport, and vacuolar septation. For example, overexpression of AtRabG3e (AtRab7) in Arabidopsis thaliana and heterologous overexpression of PjRab7 and PgRab7 in tobacco, respectively, enhanced salt stress tolerance in transgenic plants compared to WT. Similarly, when plants encounter salt stress, rabGAPs are not only regulators of rabs but also play a crucial role as effector or scaffold proteins in membrane transport and the coordination of different signaling pathways. For example, in rice, OsGAP1 (a rab-specific rabGAP) promotes vesicle transport from the Golgi network to the PM or central vacuoles by stimulating the GTPase activity of OsRab11 and increasing the circulation of inactivated OsRab11. Salt stress induces an increase in the transcriptional levels of OsGAP1, OsVHA-a1, and OsRab11. An interaction exists between OsGAP1 and OsVHA-a1. Both OsGAP1 and OsRab11 are essential for the vesicle transport of OsVHA-a1 to vacuolar precursors and / or central vacuoles under high salinity. OsGAP1 can bind to OsYchF1 (a negative regulator of plant defense and abiotic stress responses), playing a positive role by downregulating the biological function of OsYchF1. Under salt stress, ectopic expression of OsGAP1 leads to enhanced salt stress tolerance in transgenic Arabidopsis, manifested by less leaf chlorosis, less ROS production and ion leakage, and induction of higher expression of salt stress response genes (RD22 and RD29A) compared to WT. Similar results were obtained by bidirectionally overexpressing or knocking out the Arabidopsis homolog AtGAP1. OsGAP1 also exhibits a very significant role in salt stress-induced oxidative stress tolerance. Compared to WT, heterologous expression of OsGAP1 in transgenic Arabidopsis thaliana enhanced antioxidant enzyme activity and reduced lipid peroxidation and ROS accumulation in cells.

[0050] uORFs are a class of mRNA elements in the 5'UTR that precisely control protein translation. Most contain a canonical start codon (AUG) and are translated into short peptides during mRNA translation, potentially leading to ribosome arrest and dissociation. Typically, uORFs regulate pORFs by inhibiting translation initiation and modulating translation rate. Most stress-responsive transcripts carrying uORFs are induced by specific environmental conditions, and mutations in the uORF sequence reduce their negative regulatory capacity. Gene editing of plant uORFs using the CRISPR-Cas9 system is a newly established and highly efficient method for regulating endogenous mRNA translation. By improving translation efficiency, it can increase the level of proteins encoded by downstream pORFs of target genes at the translational level. This method offers numerous advantages, including avoiding gene silencing, minimal impact on transcriptional patterns, and ease of prediction and validation. In recent years, the feasibility of using the CRISPR-Cas9 system to edit uORF in Arabidopsis thaliana, lettuce, rice, and strawberry to manipulate the translation of downstream pORF has been successfully verified, and some pioneering results have been achieved. However, there is still a lack of reports on the relationship between uORF editing and abiotic stress tolerance.

[0051] Tomato is one of the most widely cultivated vegetable crops and a model plant for studies on genetics, fruit development, and stress tolerance. Throughout its growth and development, tomato is moderately sensitive to salt. Salt tolerance is a complex trait; therefore, developing salt-tolerant varieties requires in-depth research into physiological responses, metabolic changes, and gene expression patterns under salt stress. In this invention, a homozygous line with negatively regulated functional uORF gene editing, identified through screening for salt stress response SlRabGAP22, was obtained. Using this homozygous line with pORF gene editing, the OE line, and WT as multiple controls, the expression regulation of SlRabGAP22 was systematically studied, and its salt tolerance function was comprehensively evaluated. This aims to provide a theoretical basis and practical foundation for research on the molecular mechanisms of salt tolerance regulation and the breeding of salt-tolerant varieties.

[0052] 1. Materials and Methods

[0053] 1.3 Prediction of uORF and functional identification based on dual-luciferase reporter system

[0054] The uORF types of the SlRabGAP22 5'UTR were predicted and distinguished using the uORFlight (http: / / www.rnairport.com:443 / ) database. The functionality of multiple uORFs in SlRabGAP22 was identified using a dual-luciferase reporter system. In short, using whole-genome synthesis and seamless cloning, the start codon (ATG-AAA) mutant sequences of uORF1 to uORF4 in the normal / knockout 5'UTR and normal / knockout 5'UTR of the WT / uORF gene-edited lines were constructed into the pGreenII 0800-LUC plant expression vector. After Arabidopsis protoplast preparation (enzymatic digestion, static incubation, filtration, centrifugation, washing, centrifugation, and suspension microscopy of several 28-day-old seedlings) and transformation (adding more than 500 ng of purified plasmid to 100 μL of protoplast suspension, mixing with an equal volume of polyethylene glycol solution, incubating, diluting to terminate the reaction, centrifuging to remove supernatant, washing, and dark incubation), the protoplasts were used in a dual-luciferase reporter system kit (DL101-01, Vazyme, Nanjing, China) for further processing. Cell lysis products were detected using a 20 / 20 Luminometer fluorescence detector (Promega, Wisconsin, USA) via firefly luciferase (LUC) and Renilla luciferase (REN) reactions. The results were expressed as the ratio of LUC to REN fluorescence, with each assay performed in triplicate. Simultaneously, specific primers were designed, and qRT-PCR was used to measure changes in dual-luciferase mRNA levels, with three biological replicates (Table 1).

[0055] 1.4 Transformation and generation of tomato gene knockout and overexpression plants

[0056] The knockout line of tomato variety (AC) SlRabGAP22 was generated using CRISPR-Cas9 technology. Using the CRISPR-P website (http: / / cbi.hzau.edu.cn / crispr / ), two high-scoring target sgRNAs were designed for the uORF and pORF sequences, named sgRNA1 (SEQ ID No. 1: GGTGGAAAATCTAATCGGCA) and sgRNA2 (SEQ ID No. 2: GTATTCGTCGGCGTTAACGG), respectively. Following the system manual's instructions, these sgRNAs were ligated into the pCBSG012-slu61-DSG vector to construct the gene knockout system. The constructed recombinant expression vector was introduced into Agrobacterium tumefaciens competent cells (strain GV3101) using a freeze-thaw method. T0 generation lines with the uORF and pORF sequences of SlRabGAP22 knocked out were obtained through tomato genetic transformation. Mutation types were detected using Sanger sequencing and the Hi-TOM platform, ultimately obtaining T2 generation (Cas9-free) homozygous lines. Similarly, the recombinant plasmid mentioned in the subcellular localization analysis was used to obtain T0 generation lines of SlRabGAP22 OE via tomato genetic transformation. Two generations of self-pollination were performed, and both were identified by PCR positivity (hygromycin eukaryotic resistance gene) to produce T2 generation lines. Specific primers were designed, and qRT-PCR was used to screen and identify the expression levels of SlRabGAP22 in knockout and overexpression lines, selecting lines with very low and high expression levels for further analysis. All primers used are listed in Table 1, with the following sequences described sequentially as SEQ ID No. 3–26.

[0057] Table 1 Primer sequences used

[0058]

[0059] Determination of the maximum quantum efficiency (Fv / Fm) of 1.5PSII and leaf staining

[0060] Fv / Fm of tomato leaves were determined using the CF Imager chlorophyll fluorescence imaging system (Technologica, Colchester, UK). Leaf materials were dark-adapted for 30 min before Fv / Fm analysis using FluorImager V2.305 software, followed by analysis and imaging using a non-invasive chlorophyll a fluorescence assay. Fresh leaves were washed with distilled water and then immersed in brown containers containing 1 mg / mL 3,3-diaminobenzidine (DAB) solution (pH 3.8) (SL1805, Coolaber, Beijing, China) and 0.1% nitroblue tetrazolium chloride (NBT) solution (pH 7.8) (SL18061, Coolaber, Beijing, China) for staining. Then, after incubating in the dark at room temperature for 24 hours and 12 hours respectively, they were transferred to containers containing 95% ethanol and heated in a water bath until the chlorophyll was completely removed.

[0061] 1.6 Identification of salt tolerance phenotype and calculation of growth inhibition

[0062] WT, OE, and gene-edited lines were seeded in 100.0 ± 1.0 g substrate (V) 营养土 V 蛭石 =3:1) pots, and grown in a controlled laboratory environment with a temperature of 24±2℃, a relative humidity of 60±10%, and a light intensity of 100~150μmol·m -2 ·s -1 The photoperiod was 16 / 8h. After 4 weeks of growth and with similar soil moisture inhibition levels (to prevent dilution), the soil was irrigated to full saturation with 200mM NaCl solution. One day later, any remaining overflow solution in the tray was discarded. Salt solution was then applied every 3 days for a total of 4 times. After 21 days of treatment, salt tolerance phenotypes were assessed and photographed for each line, with well-watered plants serving as controls. The aboveground and root parts of 5 different lines were isolated and collected. The collected plant parts were washed with running water and then rinsed three times with deionized water to remove any potential contaminants. Fresh weight samples were dried at 105℃ for 20 min, then dried at 75℃ to constant weight to obtain the dry weight of the aboveground and root parts for each line. The growth inhibition rate (%) was calculated as: (Control dry weight - Salt-treated dry weight) / Control dry weight × 100. Each experiment was performed in triplicate.

[0063] 1.7 Physiological and biochemical indicators and Na + and K + Content determination

[0064] WT, OE, and gene-edited lines were seeded in 100.0 ± 1.0 g substrate (V) 营养土 V 蛭石 =3:1) pots, and grown in a controlled laboratory environment with a temperature of 24±2℃, a relative humidity of 60±10%, and a light intensity of 100~150μmol·m -2 ·s -1 The photoperiod was 16 / 8h. After 3 weeks, the seedling roots were rinsed with running water and transferred to pots containing 1 / 4 strength Hoagland nutrient solution (NSP1020-50L, Coolaber, Beijing, China) for hydroponics. After initial recovery for 4 days, the seedlings were transferred to pots containing 1 / 2 strength Hoagland nutrient solution for another 3 days of recovery. Finally, the healthy seedlings were transferred to pots containing 1 / 2 strength Hoagland nutrient solution (containing 200mM NaCl) for salt stress treatment. Samples were collected 72 hours after treatment, and various physiological and biochemical indicators were measured, with the 0h before stress serving as a control. According to the manufacturer's instructions, nine detection kits (H2O2-1-Y, SA-1-G, POD-1-Y, SOD-1-Y, CAT-1-Y, APX-1-W, GR-1-W, PRO-1-Y, and MDA-1-Y, Comin, Suzhou, China) were used sequentially to detect hydrogen peroxide (H2O2) and superoxide anion (O2). - The contents / activities of peroxidase (POD), superoxide dismutase (SOD), catalase (CAT), ascorbate peroxidase (APX), glutathione reductase (GR), and MDA were measured, with three replicates. Simultaneously, the above-obtained above-treated and control strains' aerial and root samples were ground and digested in liquid nitrogen, then diluted with water to a final volume. The sample solutions were injected into a flame spectrophotometer (FP6410, INESA, Shanghai, China), and the Na+ content was determined after flame atomization. + and K + The emission intensity. Na + and K + The emission wavelengths are 589.0 nm and 766.5 nm, respectively. Within a certain concentration range, its emission values ​​are similar to those of Na. + and K + The content was directly proportional. Subsequently, quantification was performed by comparing with a standard series, and Na was determined separately. + and K + The content of.

[0065] 1.8 Pore Opening Measurement

[0066] WT, OE, and gene-edited lines were seeded in 100.0 ± 1.0 g substrate (V) 营养土 V 蛭石 =3:1) pots, and grown in a controlled laboratory environment with a temperature of 24±2℃, a relative humidity of 60±10%, and a light intensity of 100~150μmol·m -2 ·s -1 The photoperiod was 16 / 8h. Four-week-old leaves from different plant types were used to observe and evaluate the promoting effect on stomatal closure. Leaves of similar size from the same part of different plant types were placed in stomatal buffer solutions containing 30mM KCl and 10mM MES / Tris (pH 6.15), respectively. -2 s -1 Leaves were incubated in petri dishes under light intensity for 2 hours until the stomata were fully open. Then, leaves from each group were transferred to stomatal buffer solutions containing 50 μM ABA or 100 mM NaCl and treated for 2 hours. Afterward, the leaves were transferred to a fixative and vacuum-preserved. Following lyophilization, stomatal images were acquired using a scanning electron microscope (Sigma 500, Zeiss, Germany). The width and length of the stomata were measured using ImageJ software (https: / / imagej.net / ij / ), and the pore diameter (width-to-length ratio) was calculated. The stomatal diameter was represented by the average of 50 stomata measured for each sample, with three replicates.

[0067] 1.9 ROS accumulation, plasma membrane internalization rate and Na+ + Cumulative analysis

[0068] Following previous methods with slight modifications, the procedure was as follows: Seven-day-old seedlings of the WT, OE, and gene-edited lines, planted in 1 / 2 MS solid medium, were gently removed with tweezers. After washing the roots with deionized water, ten seedlings from each line were transferred to MS liquid medium containing 200 mM NaCl for 40 min of stress, followed by incubation for 20 min in MS liquid medium containing 10 μM 2',7'-dichlorodihydrofluorescein diacetate (H2DCFDA) (CD4562, Coolaber, Beijing, China). To define the plasma membrane of each cell, the seedling roots were stained with MS liquid medium containing 5 μM MFM4-64 (CD4673, Coolaber, Beijing, China) at 4°C in the dark for 15 min. Then, after rinsing with MS liquid medium, cells in the root apical region (root length 0.5 cm) were observed and photographed to assess ROS accumulation.

[0069] Twenty cells from each line were transferred to MS liquid medium and stained with 5 μM FM4-64 for 20 min in the dark at 4°C. After rinsing with MS liquid medium at 5, 15, and 30 min at room temperature, cells from the root apical region (0.5 cm in length) of different lines were imaged to determine the rate of plasma membrane internalization. Simultaneously, roots from five seedlings of different lines pre-stained with 5 μM FM4-64 were incubated with MS liquid medium (containing 200 mM NaCl) at room temperature for 30 min to determine the effect of salt stress on the endocytosis rate.

[0070] Ten strains from each line were selected and subjected to room temperature stress for 16 hours in MS liquid medium containing 200 mM NaCl. After treatment, they were transferred to a medium containing NaCl. + Indicator 5μM Sodium Green TM (S6901, Thermo Fisher Scientific, MA, USA) and nonionic surfactant Pluronic TM In a mixed solution of F-127 (dissolved in 20% dimethyl sulfoxide) (P3000MP, Thermo Fisher Scientific, MA, USA), the cells were incubated at room temperature for 2 hours to enhance dye uptake. Seedling roots were stained with MS liquid medium containing 5 μM FM4-64 fluorescent dye in the dark at 4°C for 20 minutes to delineate the plasma membrane. After rinsing with MS liquid medium, cells in the root apical region were observed and photographed to determine Na+. + Accumulation in vacuoles.

[0071] 1.10 Quantization of Fluorescent Labeling

[0072] The signal of FM4-64 fluorescent labeling (excitation wavelength 515 nm) was manually quantified in intracellular and plasma membrane compartments using ImageJ software. Following previous descriptions, the internalization rate of FM4-64 was determined as the ratio of the two signals in each cell. The software was used to quantify H2DCFDA and Sodium Green, respectively. TM The fluorescently labeled signals were quantified (emission wavelength 517-561 nm). Each image underwent color-coded intensity processing, and the average fluorescence value per 100 pixels was scored for manually defined regions of interest. To quantify fluorescence intensity, the laser, gain, and pinhole settings of the confocal microscope were kept identical and constant across different processing methods. All confocal experiments were performed in triplicate, with each experiment counting at least 25 cells (relative units) from the roots of five different plants from each line.

[0073] 2 Results and Analysis

[0074] 2.4 Prediction and Functional Identification Analysis of uORF

[0075] like Figure 1 As shown, if uORF is translated, it usually inhibits the translation of pORF. Disrupting the uORF region using the CRISPR-Cas9 system can prevent / reduce the inhibitory effect of uORF and enhance the translation of pORF. Figure 1 (A). Predicting the uORFs of SlRabGAP22 5'UTR revealed that it possesses four uORFs of three different types. The positions, lengths, and GC contents of uORF1 through uORF4 vary. Figure 1 (B). Functional identification of multiple uORFs in SlRabGAP22, individually or simultaneously, using a dual-luciferase reporter system showed that mutation of the start codon (ATG-AAA) of uORF1 and uORF3 significantly increased LUC / REN activity, indicating a reduction in their inhibitory effect. These two uORFs are negative regulators of functional uORFs. Figure 1 (C). The lack of significant difference in LUC / REN mRNA levels indirectly indicates that the inhibitory effect of uORF occurs at the translational level. Figure 1 (D). Two high-resolution sgRNA targets were designed using the CRISPR / Cas9 gene editing system at the beginning of the uORF2 sequence near uORF1 (the uORF1 sequence itself is too short and there are no suitable PAM sites nearby) and in the uORF2-4 overlapping sequence region to generate uORF knockout mutant lines. Figure 1(EF). Ultimately, a homozygous line was selected, with deletions of 8bp and 1bp at the two target sites, resulting in a change in uORF type to two different types. In summary, uORF2 changed from type 2 to type 1, uORF3 changed from type 3 to type 2, and the location, length, and GC content of uORF2-4 were also altered. Figure 1 Similarly, functional identification of multiple mutated uORFs individually or simultaneously showed that mutated uORF1 and uORF2 are negatively regulatory uORFs (GH). Figure 1 (I). The final selected uORF knockout homozygous line showed significantly increased LUC / REN activity, while there was no significant difference in LUC / REN mRNA levels. Figure 1 The results suggest that it reduces the inhibitory effect on SlRabGAP22 at the translational level, which can be used for further research.

[0076] 2.5 Phenotypic analysis, growth inhibition degree, Fv / Fm ratio, and stomatal movement characteristics.

[0077] To explore the potential function of SlRabGAP22, an OE line of SlRabGAP22 was generated. Furthermore, a pORF gene-editing line was created using the CRISPR / Cas9 system. The resulting homozygous line produced a 1 bp insertion at the sgRNA2 target site, leading to premature termination of the protein sequence and complete disruption of the conserved TBC domain of SlRabGAP22 (from amino acids 311 to 449). Figure 2 (A, B). Combined qRT-PCR and Western blot analysis showed that the relative expression levels of genes or proteins in the pORF homozygous line (porf), uORF homozygous line (uorf), OE line 14 (OE 14), and OE line 15 (OE 15) were significantly different from those in the WT line, and were therefore selected for subsequent research. Figure 2 (CE).

[0078] To further investigate the role of SlRabGAP22 in salt stress, different lines were treated with NaCl, and phenotypic identification and photography were performed. Before NaCl treatment, there were no significant differences in growth characteristics among the different lines. After 21 days of NaCl treatment, compared with the uorf, OE 14, and OE 15 lines, porf and WT showed significantly more severe damage to leaves (wilt, yellowing, and abscission) and stems (softening, bending, and lodging). Under the control treatment, all lines grew healthily with no significant differences. Figure 3(A). Calculations of growth inhibition levels in the aboveground parts and roots of different strains also showed that the growth inhibition levels of the porf, WT, uorf, OE 14, and OE 15 lines decreased sequentially. Compared to WT, the porf line showed a significantly higher growth inhibition level, while the other strains showed a significantly lower growth inhibition level. Figure 3 (Medium B). The Fv / Fm ratio can reflect the impact of the environment on plant photosynthesis to some extent. Observations using imaging by measuring the fluorescence radiation of chlorophyll in leaves revealed that, under control conditions, the Fv / Fm ratio of different varieties was typically around 0.8, indicating that chlorophyll molecules were highly efficient at converting light energy into chemical energy during photosynthesis. After salt stress, the Fv / Fm ratio of all varieties fell below 0.8, indicating problems in their photosynthetic processes and suggesting that salt stress impaired their photosynthetic health. Figure 3 (C). Statistical calculations showed that, under control conditions, the Fv / Fm ratio did not differ significantly among different lines. However, after salt stress, compared with WT, this ratio was significantly lower in the porf line and significantly higher in the other lines, suggesting that the uorf, OE 14, and OE 15 lines reduced the damage to the tomato photosynthetic system caused by salt stress to some extent. Figure 3 (D).

[0079] In addition, the stomatal diameter characteristics of leaves from different varieties under control (stomatal opening buffer), ABA and NaCl treatments were observed. Figure 4 (A). Under the three treatments, there were no significant differences in the degree of stomatal opening or closing of the leaves among the different varieties. Figure 4 (B) Based on these results, it is inferred that the uORF, OE 14, and OE 15 lines did not enhance sensitivity to ABA and could not promote rapid stomatal closure in an ABA-dependent manner under salt stress. Their increased salt stress tolerance was unrelated to differences in stomatal movement. In conclusion, editing uORF and / or SlRabGAP22 OE enhances tomato salt tolerance by at least partially increasing their protein and / or gene expression levels without affecting normal growth, thereby reducing growth inhibition and improving photosynthetic efficiency.

[0080] 2.6SlRabGAP22 positively regulates ROS scavenging and osmotic regulation accumulation under salt stress.

[0081] Salt stress leads to excessive accumulation of ROS in plant cells. DAB and NBT staining was performed on leaves of different varieties, and the enzyme activities and physiological parameters of their ROS scavenging systems were measured to systematically determine the effect of SlRabGAP22 on ROS scavenging in tomato under salt stress.

[0082] First, H2O2 and O2 in the leaves were detected separately.- The accumulation of H2O2 and O2 was observed. Results showed that, under control conditions, compared to WT, the accumulation of H2O2 and O2 among different strains was significantly lower. - There was no significant difference in content. However, under salt stress, compared to WT, the content of both was significantly increased in the porf strain and significantly decreased in the other strains. This is consistent with the images presented by DAB and NBT staining patterns. Figure 5 (AD). Subsequently, the activities of four important antioxidant enzymes in the antioxidant or ROS scavenging system—SOD, POD, CAT, and APX—were evaluated. The results showed that, under control conditions, their activity levels did not differ significantly among different strains compared to WT. Although salt stress led to an increase in their activity levels in all strains, compared to WT, their activity levels were significantly lower in the porf strain and significantly higher in the other strains. Furthermore, the determination of MDA content, an indicator of oxidative damage, in different strains showed that, under control conditions, there was no significant difference in MDA content among different strains compared to WT. However, under salt stress, MDA content increased in all strains, indicating that high salt levels led to excessive oxidation and oxidative damage to the cell membrane. Compared to WT, MDA content was significantly higher in the porf strain and significantly lower in the other strains, suggesting that the urf, OE 14, and OE 15 strains exhibited better redox homeostasis. Finally, the results of the determination of the osmotic regulator Pro content in all strains under salt stress showed that, under control conditions, there was no significant difference in Pro content among different strains compared with WT. However, under salt stress, the Pro content of all strains increased, but compared with WT, the content in the porf strain was not significantly different, while it was significantly increased in the other strains, indicating that the uorf, OE 14, and OE 15 strains received stronger protection against osmotic stress. Figure 5 (E).

[0083] In addition, the ROS fluorescent probe H2DCFDA, a chemiluminescent fluorescein, was used as an indicator of ROS in cells (reflecting the production and dynamic changes of intracellular ROS). Figure 6 (A). Fluorescence detection results in tomato roots showed that under salt stress, ROS levels were significantly higher in the porf line compared to WT, while significantly lower in the other lines, indicating that the overall oxidative stress level in the uorf, OE 14, and OE 15 lines was lower. Figure 6 (B) In summary, under salt stress, compared to WT, UORF, OE 14, and OE 15 series H2O2 and O2 -The accumulation rate of ROS is reduced, ROS levels are maintained at a low level, the activity of antioxidant enzymes is increased, oxidative damage parameters decrease, and the content of osmotic regulators increases. SlRabGAP22 participates in the regulation of the ROS pathway, mitigating the damage caused by oxidative stress through ROS scavenging and improving the tolerance of tomatoes to salt stress.

[0084] 2.7SlRabGAP22 enhances endocytosis and induces Na+. + Entering vacuoles and reducing Na in the aboveground parts + / K + ratio

[0085] Increased endocytosis rates during vesicle transport contribute to improved plant tolerance to salt stress. Since SlRabGAP22 may be involved in processes related to vesicle transport, it is hypothesized to play an active role in endocytosis. The sensitive vacuolar kinetics probe FM4-64, a lipophilic styrene dye widely used for endocytosis and exocytosis of membrane structures, was used as a live-cell probe to trace the processes of membrane internalization and transport to vacuoles. Figure 7 (A). Fluorescence detection results in tomato roots showed that, under control conditions, compared to WT, the uorf, OE 14, and OE 15 lines had higher internalization rates that increased over time, but all showed significant differences only after 30 min of treatment. Figure 7 (C). Under NaCl treatment, endocytosis in root cells was rapidly induced ( Figure 7 Compared to WT, the FM4-64 internalization rates of the uorf, OE 14, and OE 15 series were significantly increased (Figure D). These results suggest that SlRabGAP22 may regulate vesicle transport processes and play an important role in tomato salt tolerance by increasing the endocytosis rate. Meanwhile, the internalization rate of Na+ was also investigated. + Selective Sodium Green TM (composed of two 2',7'-dichlorofluorescein dyes), used as a fluorescent indicator to detect Na+. + Fluorescence detection in tomato roots showed that under salt stress, compared to WT, the fluorescence signal intensity of the uorf, OE 14, and OE 15 series increased, and Na levels were also significantly observed. + The accumulation of these substances mostly occurs inside vacuoles, rather than in the epidermis and cortex. Figure 8 (A). Statistical analysis results also show that under salt stress, compared with WT, the vacuolar, OE 14, and OE 15 series of Sodium Green vacuolars... TM The strength ratio increased significantly ( Figure 8 (B)

[0086] Additionally, to verify whether SlRabGAP22 can affect Na+ / K + To regulate salt tolerance in tomatoes, steady-state conditions were used, and the Na+ levels in the aboveground parts and roots of different varieties were measured and calculated. + and K + The content and ratio of ( Figure 9 The results showed that, under control conditions, compared to WT, the Na content in the aboveground parts and roots of different varieties was lower. + and K + There was no significant difference in the content and ratio of [the substance]. Figure 9 (AF). Under salt stress, the Na content in the aboveground parts and roots of different varieties... + Content and Na + / K + The ratios all showed an upward trend. Figure 9 (A, C, D, F), K + The content of all showed a downward trend. Figure 9 Compared to WT, the aboveground Na content of the UORF, OE 14, and OE 15 series (B, E) was higher. + The content was significantly reduced ( Figure 9 A), and K + The content increased significantly ( Figure 9 (B) By reducing Na + Accumulate and reduce K + Efflux significantly reduces Na + / K + ratio( Figure 9 (C). In summary, SlRabGAP22 can optimize endocytosis kinetics, allowing most Na+ to be transported to the neutrophils. + Isolated within the root vacuoles, reducing the amount of Na that migrates to the aboveground parts. + Content and reduction of Na in aboveground parts + / K + The ratio, by reducing Na + To enhance the salt tolerance of tomatoes by reducing toxicity and the osmotic effect of salt stress.

[0087] 3 Discussion

[0088] Since uORF (the main regulatory element of gene expression at the translational or posttranscriptional level) is located upstream of pORF in physical location, it encounters ribosomes earlier in translation. Therefore, in the process of mRNA translation, except for special cases such as leak scanning, uORF translation may cause ribosome arrest, thereby inhibiting pORF translation

[30] . At present, bioinformatics and translatomics sequencing technology have been effectively used for the prediction and identification of plant uORF, which has strongly promoted the research and development of the theory of eukaryotic translation control mechanism. The use of uORF through plant genetic engineering and CRISPR-Cas9 system-mediated gene editing technology has further demonstrated the application prospects of uORF in crop molecular breeding. Editing the translation initiation region of uORF to achieve trait improvement genetic engineering based on uORF generally results in two situations: (1) loss of function of uORF (the translation initiation ability of uORF is completely destroyed); (2) the inhibition efficiency of uORF on pORF is fine-tuned (the translation initiation codon of uORF and its surrounding sequences are changed).

[0089] Currently, the important roles of plant Rab and / or RabGAP proteins in salt stress have been gradually revealed in Arabidopsis thaliana, tobacco, and rice. The important role of uORF-based gene regulation in plant development, disease resistance, and nutrient absorption has also been confirmed. In this invention, the aim is to use reverse genetics to reveal the regulatory role of SlRabGAP22, a member of a plant-specific subfamily II containing multiple types of uORFs, in the salt stress response. The results show that the inhibitory efficiency of negatively regulated functional uORFs on pORFs is fine-tuned, and the expression regulation of SlRabGAP22 is closely related to salt stress tolerance, making it a positive regulator of salt tolerance in tomato.

[0090] The function and biological relevance of uORFs can be demonstrated using mutagenesis analysis, dual-luciferase-based reporter gene analysis, and CRISPR-Cas9-based editing experiments. Previous studies have reported different numbers and types of uORFs in target genes of Arabidopsis thaliana, lettuce, strawberry, and rice. Based on validating uORF function and gene editing, traits such as development, tolerance to oxidative stress, ascorbic acid content, sugar content, and heading date have been successfully improved. The results show that the 5'UTR of SlRabGAP22 contains four uORFs, classified into three types (non-overlapping type 1, out-of-frame overlapping type 2, and in-frame overlapping type 3 uORFs). Typically, type 1 uORFs are the most prevalent, type 2 uORFs exert the greatest inhibitory effect on pORF translation, while type 3 uORFs lead to N-terminal elongation of the pORF-encoded protein. uORF1 and uORF3 of SlRabGAP22 were found to belong to types 1 and 3, respectively, and were identified as negatively regulatory uORFs. uORF2 and uORF4 belong to type 2, and after identification, they were found to lack negative regulatory function. This may be related to the mechanism by which type 1 uORF acts as an insulator for mRNAs containing multiple uORFs, especially under stress conditions, promoting the 40S small ribosomal subunit to bypass the more inhibitory downstream type 2 uORF. This mechanism can also explain the phenomenon that more than half of the type 2 uORFs in plants are accompanied by type 1 uORFs.

[0091] Alterations in uORF characteristics and environment can affect its regulatory activities. In principle, any mutation altering key uORF features can potentially impact pORF translation and contribute to phenotypic diversity. Enhanced uORF repressive activity is influenced by a favorable Kozak background, rare triplet codons, strong stop codons, unstable RNA structures around start codons, and a shorter distance from the pORF. uORF knockout mutants obtained using the CRISPR-Cas9 gene editing system altered the uORF type, location, distance, length, and GC content of SlRabGAP22, resulting in type I uORF1 and uORF2 being negatively regulatory uORFs, while type II uORF3 and uORF4 are non-negatively regulatory uORFs. The final selected uORF knockout homozygous line showed significantly increased LUC / REN activity without significant difference in LUC / REN mRNA levels, indicating reduced repressive activity against SlRabGAP22 at the translational level. Further exploration is warranted regarding the limitations of this method, including its applicability only to mRNAs with functional uORFs and the limited inhibitory strength of functional uORFs, which typically only lead to a modest increase in gene expression levels. Extending to this study, the uORF1 sequence was too short and lacked suitable PAM sites for restriction, making editing impossible. The inherent limitations of the CRISPR-Cas9 system should also be considered; future research using single-base editing systems might significantly reduce the inhibitory effect of uORFs on the target gene. This is strongly supported by recent research that employs a reverse approach, using base editing and leader editing to generate new, extended, and / or additional uORFs in the 5'UTR of coding genes to quantitatively downregulate endogenous gene expression, achieving the opposite effect.

[0092] In this invention, the negative regulatory function of uORF was edited, resulting in transgenic tomato material with enhanced expression of endogenous target genes and improved performance. Based on the obtained WT, its pORF gene-edited, and OE lines as multiple controls, the expression regulation of SlRabGAP22 was systematically studied, and its salt tolerance function was comprehensively evaluated, thereby accelerating the analysis of gene function and the improvement of crop traits. Through plant phenotypic identification, it was observed that under the control treatment conditions, all different lines grew healthily, with no significant differences in morphology and growth characteristics, indicating that the editing of uORF and pORF genes and OE of SlRabGAP22 did not have a negative impact on tomato growth and development. Under salt stress, the uorf, OE 14, and OE 15 lines, compared to the WT and / or porf lines, showed reduced impairment in morphological and growth characteristics. This was primarily manifested in a significantly decreased growth inhibition rate (used to assess plant tolerance to salt stress and reflect salt tolerance) and a significantly increased Fv / Fm ratio (used to reveal the optimal / maximum PSII efficiency of PSII reaction centers and to study the relationship between plant photosynthesis and the environment), rather than differences in ABA-mediated stomatal movement. Further analysis of the physiological and biochemical characteristics of different lines revealed that SlRabGAP22 participates in the regulation of the ROS pathway, enhances the endocytosis rate under salt stress, and removes most of the Na+. + Isolated within the root vacuoles, reducing the amount of Na that migrates to the aboveground parts. + Content and reduction of Na in aboveground parts + / K + Ratio. In summary, SlRabGAP22 possesses a more rational and improved gene expression regulation mechanism (referring to plants adapting to the environment by altering gene expression to achieve optimal growth), mitigating damage caused by oxidative stress through ROS scavenging, reducing damage to the photosynthetic system, and alleviating Na+ damage. + The tolerance of tomatoes to salt stress can be improved through toxicity and by reducing the osmotic effect of salt stress.

[0093] 4. Summary

[0094] The 5'UTR of SlRabGAP22 contains four uORFs, classified into three types. uORF1 and uORF3 belong to types 1 and 3, respectively, and have been identified as negatively regulatory uORFs. Editing uORFs, as an alternative method for enhancing endogenous gene expression, offers several unique advantages. Compared to traditional methods of enhancing gene expression, which are prone to transgene silencing in offspring and the potential for random insertion of transfer DNA that alters the normal sequence surrounding the insertion site, editing uORFs avoids gene silencing (because uORFs are part of a stably inherited genome), has minimal negative impact on plant growth and development or the development of abnormal phenotypes (due to minimal influence on transcription patterns), is easy to predict and verify (because the 5'UTR is typically much shorter than the promoter region), and poses virtually no biosafety concerns (because the enhancement of endogenous gene expression does not require the integration of exogenous DNA).

[39] .

[0095] This method was used to generate transgenic tomato materials with enhanced expression and improved performance of the endogenous target gene. Based on the obtained WT line, its pORF gene-edited line, and the OE line as multiple controls, the expression regulation of SlRabGAP22 was systematically studied, and its salt tolerance function was comprehensively evaluated. Reverse genetics revealed the regulatory role of SlRabGAP22 in the salt stress response. The negatively regulating functional uORF fine-tuned the inhibition efficiency of pORF, and the expression regulation of SlRabGAP22 was closely related to salt stress tolerance, making it a positive regulator of tomato salt tolerance. Editing uORF can give SlRabGAP22 a more rational and improved gene expression regulation mechanism, improving tomato's tolerance to salt stress. Editing uORF provides a simple, reliable, and scalable method for enhancing gene translation in plants without introducing exogenous DNA. It can be used to analyze key biological pathways and advance crop breeding.

[0096] Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, and not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.

Claims

1. Application of the SlRabGAP22 gene in regulating salt tolerance in tomatoes; The accession number for the SlRabGAP22 gene is Solyc03g082590.4.1; The regulation is as follows: overexpression of the SlRabGAP22 gene positively regulates the salt tolerance of tomatoes.

2. Application of editing uORF in the SlRabGAP22 gene in regulating salt tolerance in tomatoes; The accession number for the SlRabGAP22 gene is Solyc03g082590.4.1; The regulation is as follows: editing the uORF in the SlRabGAP22 gene positively regulates the salt tolerance of tomatoes; The uORF in the SlRabGAP22 gene was edited by ligating sgRNA1 and sgRNA2 into the pCBSG012-slu61-DSG vector; The nucleotide sequence of the sgRNA1 is shown in SEQ ID No. 1; The nucleotide sequence of the sgRNA2 is shown in SEQ ID No.

2.

3. The application according to claim 1 or 2, characterized in that, Reduce the damage to tomato photosynthesis caused by salt stress.

Images