Application of SEC14L3 in the treatment and prognosis assessment of liver cancer

Abstract

The present invention relates to the application of SEC14L3 in the treatment and prognosis evaluation of liver cancer. The present invention has found through a large number of studies that SEC14L3 can be used as a tumor suppressor factor in the occurrence and development of hepatocellular carcinoma. At the same time, the present invention has deeply discovered for the first time the regulatory relationship between GADD45A and SEC14L3, that is, GADD45A can be used as an upstream transcriptional regulatory factor of SEC14L3, and promote SEC14L3 expression by reducing the methylation level of the SEC14L3 gene promoter, thereby inhibiting the growth of hepatocellular carcinoma. The present invention clarifies that SEC14L3 and GADD45A are key targets for the prognosis and treatment of HCC, and can be used for the treatment, auxiliary diagnosis and prognosis evaluation of HCC. At the same time, it raises the understanding of the pathogenesis of HCC to a new level, greatly enriches the content of the pathogenesis of HCC, and provides sufficient scientific basis and theoretical basis for exploring new molecular targets for diagnosis, prognosis and treatment of hepatocellular carcinoma and developing new targeted drugs, which has important social value and scientific significance.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine and relates to the application of SEC14L3 in liver cancer treatment and prognosis evaluation. Background Art

[0002] Primary liver cancer includes hepatocellular carcinoma (HCC) (accounting for 75%-85%), intrahepatic cholangiocarcinoma (ICC) (accounting for 10%-15%) and other rare types. Hepatocellular carcinoma is the main pathological type of primary liver cancer. Due to differences in diet, economic and technological levels, the incidence of HCC in different regions also varies greatly, and its 5-year survival rate is only 18%. The main high-risk factors for HCC include chronic viral hepatitis, aflatoxin exposure, heavy drinking and non-alcoholic fatty liver disease (NAFLD). In most high-risk areas, especially developing countries, chronic hepatitis B virus (HBV) infection and aflatoxin exposure are the main causes.

[0003] The occurrence and development of HCC is a process of accumulating a large number of genomic changes and there are differences between different populations. In Western HCC populations, telomerase reverse transcriptase (TERT), tumor protein p53 (TP53), catenin beta-1 (CTNNB1), AT-rich interaction domain 1A (ARID1A) and RB transcriptional corepressor 1 (RB1) are common mutated genes; while Asian HCC populations have a higher frequency of gene mutations related to TP53, RB1 and VEGF (Vascular endothelial growth factor, VEGF) pathways.

[0004] Although surgical, molecular targeted and interventional diagnostic and treatment technologies have made significant progress in recent years, and a variety of HCC high-risk factors and target genes have been identified, the overall survival rate of HCC patients is still not ideal. The main reason is that the changes in the HCC transcriptome are significantly different from those of other cancers. Common driver mutations may have unique effects in HCC, making the pathogenesis of liver cancer elusive; and it exhibits rapid progression, early recurrence and late diagnosis in clinical practice, which often leads to poor prognosis of HCC patients, resulting in great challenges in the treatment of HCC. Therefore, it is necessary to further clarify the biological mechanism of the malignant phenotype of HCC in order to identify new diagnostic biomarkers and drug targets and develop more effective prevention and treatment strategies. Summary of the invention

[0005] The purpose of the present invention is to address the problems of HCC in the prior art, such as the complex pathogenesis, difficulty in clarifying, and poor treatment prognosis, so as to conduct in-depth research on the mechanism of HCC, clarify that SEC14L3 can be used as a tumor suppressor factor in the occurrence and development of hepatocellular carcinoma, and that overexpression of SEC14L3 or improvement of its biological activity can significantly inhibit the proliferation and metastasis of liver cancer, prolong the patient's survival rate, and improve the prognosis; and clarify that GADD45A can be used as an upstream transcriptional regulatory factor of SEC14L3, which can promote SEC14L3 expression by reducing the methylation level of the SEC14L3 gene promoter, thereby inhibiting the growth of hepatocellular carcinoma. It provides a new strategy for the treatment, diagnosis, and prognosis evaluation of liver cancer.

[0006] In order to solve the above technical problems, the present invention is implemented through the following technical solutions.

[0007] The first aspect of the present invention provides the use of SEC14L3 in the preparation of a drug for preventing and / or treating liver cancer.

[0008] The second aspect of the present invention provides the use of SEC14L3 in the preparation of a product for auxiliary diagnosis and / or prognosis evaluation of liver cancer.

[0009] Preferably, the prognostic assessment indicator is selected from one or more of overall survival, disease-specific survival, progression-free survival, and risk of liver cancer cell metastasis.

[0010] The third aspect of the present invention provides the use of a reagent for detecting the expression level of SEC14L3 in the preparation of a composition for auxiliary diagnosis and / or prognosis evaluation of liver cancer.

[0011] Preferably, the reagent for detecting the expression level of SEC14L3 includes primers for detecting the expression level of SEC14L3 gene and / or a reagent for detecting the expression level of SEC14L3 protein.

[0012] Preferably, the primers for detecting the expression level of the SEC14L3 gene are selected from the following primer pair: the upstream primer sequence of the primer pair is shown in SEQ ID NO: 1 (5'-GAGCACTCGGTGCAGATC-3'), and the downstream primer sequence is shown in SEQ ID NO: 2 (5'-GCTGGCTGGGTAGAACAT-3').

[0013] Preferably, the reagent for detecting the expression level of SEC14L3 protein is selected from anti-SEC14L3 antibody, for example, Rabbit Anti-Sec14L3 antibody (bs-4448R, Biosen).

[0014] Preferably, the prognostic assessment indicator is selected from one or more of overall survival, disease-specific survival, progression-free survival, and risk of liver cancer cell metastasis.

[0015] The fourth aspect of the present invention provides a pharmaceutical composition for preventing and / or treating liver cancer, comprising a SEC14L3 active agent, a GADD45A active agent, and a pharmaceutically acceptable excipient; the SEC14L3 active agent comprises one or more of a SEC14L3 nucleotide, a SEC14L3 protein, and an agent that promotes SEC14L3 expression; the GADD45A active agent comprises one or more of a GADD45A nucleotide, a GADD45A protein, and an agent that promotes GADD45A expression.

[0016] Preferably, the pharmaceutically acceptable excipient is selected from one or more of a filler, a disintegrant, a binder, a lubricant, a flavoring agent, a preservative, an antioxidant, and a colorant.

[0017] The fifth aspect of the present invention provides a kit for auxiliary diagnosis and / or prognosis evaluation of liver cancer, comprising a reagent for detecting the expression level of SEC14L3; and one or more of PCR enzyme, PCR buffer, dNTPs, and fluorescent substrate.

[0018] Preferably, the reagent for detecting the expression level of SEC14L3 includes primers for detecting the expression level of SEC14L3 gene and / or a reagent for detecting the expression level of SEC14L3 protein.

[0019] Preferably, the primers for detecting the expression level of the SEC14L3 gene are selected from the following primer pair: the upstream primer sequence of the primer pair is shown in SEQ ID NO: 1, and the downstream primer sequence is shown in SEQ ID NO: 2.

[0020] Preferably, the reagent for detecting the expression level of SEC14L3 protein is selected from SEC14L3 monoclonal antibody and / or SEC14L3 polyclonal antibody.

[0021] Preferably, the reagent for detecting the expression level of SEC14L3 protein is selected from anti-SEC14L3 antibody, for example, Rabbit Anti-Sec14L3 antibody (bs-4448R, Biosen).

[0022] Preferably, the fluorescent substrate is selected from Syber Green or a fluorescently labeled probe.

[0023] Preferably, the prognostic assessment indicator is selected from one or more of liver cancer cell metastasis risk and survival rate.

[0024] The sixth aspect of the present invention provides the use of SEC14L3 and GADD45A in the preparation of a drug for preventing and / or treating liver cancer.

[0025] It should be understood that, in the context of the present invention, unless otherwise specified, the SEC14L3 includes components such as SEC14L3 nucleotides and SEC14L3 proteins encoded by SEC14L3 nucleotides. The SEC14L3 inhibitor refers to a substance that can specifically downregulate the expression level of SEC14L3 and / or the transcription level of its mature mRNA and / or the expression level or activity of SEC14L3 protein, for example, using antisense oligonucleotides, siRNA, shRNA, sgRNA, antagomiRs, miRNA sponges, miRNA Erasers, Target Masking and / or multi-target methods to downregulate the expression level and / or activity of SEC14L3, as long as the level and / or activity of SEC14L3 can be reduced. The primers and / or primer pairs refer to PCR primers used to synthesize the cDNA chain of the SEC14L3 gene in PCR, so as to detect the expression level of the mRNA of the SEC14L3 gene. In addition to the primers and / or primer pairs listed in the present invention, those skilled in the art are fully capable of designing corresponding primers and / or primer pairs according to the gene sequence of SEC14L3 using conventional methods and means in the field including but not limited to molecular biology, and screening the designed primers and / or primer pairs by conventional experimental means, as long as the specific detection of SEC14L3 expression level can be achieved; the conventional reagents and methods in the field can also be used to detect the expression level of SEC14L3 protein; the same applies to GADD45A, etc.

[0026] SEC14L3 is an atypical class III phosphatidylinositol transfer protein (PITPs). The gene is located on chromosome 22q12. The protein encoded by SEC14L3 contains three domains, namely the N-terminal CRAL-TRIO domain that binds lipophilic small molecules, the SEC14 domain of the hydrophobic ligand binding pocket, and the C-terminal GOLD domain that promotes protein-protein interactions. Under physiological conditions, SEC14L3 can act as a transporter to promote the exchange of phosphatidylinositol and phosphatidylcholine between membranes to maintain the balance of membrane lipid levels. Recent studies have found that abnormal expression of SEC14L3 may be associated with the occurrence of human diseases (such as asthma), but the role and mechanism of SEC14L3 in the occurrence of HCC has not been reported.

[0027] The growth arrest and DNA damage-inducible45 (GADD45) gene family includes GADD45A, GADD45B and GADD45G. The human GADD45A gene is located on chromosome 1q31.3. The small molecule protein it encodes contains 165 amino acids and is mainly located in the cell nucleus. GADD45A is a DNA damage-induced protein. Under the action of various damaging factors such as ionizing radiation, ultraviolet rays, various chemotherapeutic drugs, starvation, and cell density, it can be induced and activated through both p53-dependent and p53-independent pathways to increase its expression. A large number of studies have shown that GADD45A inhibits tumorigenesis by blocking the cell cycle, promoting cell apoptosis, and repairing DNA damage. It is an important tumor suppressor gene, and its expression inhibition is related to the occurrence and development of various human tumors. On the other hand, GADD45A plays an important role in gene demethylation activation. Studies have shown that in colon cancer cells, long non-coding RNA SATB2-AS1 recruits GADD45A to the SATB2 gene promoter, causing DNA demethylation of the SATB2 gene, thereby activating its expression and regulating the malignant phenotype of colon cancer cells. Long non-coding RNA TARID (trascriptor facter 21antisense RNA inducingdemethylation) can promote the interaction between GADD45A and TET1 (ten-eleven translocation 1), and bind to the R loop at the promoter site of the TCF21 (trascriptor facter21) gene, causing DNA demethylation of the TCF21 gene and activating its expression. The above shows that GADD45A can act as both a tumor suppressor gene and a transcriptional regulatory factor, mediating promoter gene demethylation to affect epigenetics.

[0028] Through a large number of studies, the present invention found that the expression of SEC14L3 in liver cancer cells is significantly lower than that in normal liver cells; similarly, in tissue samples of hepatocellular carcinoma, the expression of SEC14L3 is also significantly lower than that in adjacent non-cancerous liver tissues. In addition, clinical data also show that low SEC14L3 expression levels are associated with poor overall survival, disease-specific survival, and progression-free survival in HCC patients. These findings suggest that SEC14L3 may play an important role in the occurrence of HCC as a tumor suppressor gene. Subsequent in vitro cell culture and in vivo animal model studies further verified the above conclusions. In vitro experiments observed that overexpressed SEC14L3 can reduce the cloning, proliferation, migration and invasion capabilities of HCC cells, while knocking down SEEC14L3 enhances the cloning, proliferation, migration and invasion capabilities of HCC cells; in vivo nude mouse subcutaneous tumor formation experiments found that overexpression of SEC14L3 can slow down the growth rate of nude mouse tumors and reduce tumor volume. These experimental results collectively confirm the view that SEC14L3 has antitumor activity in HCC and provide preliminary scientific basis for using SEC14L3 as a prognostic indicator and therapeutic target for hepatocellular carcinoma.

[0029] The present invention also found that the expression level of GADD45A mRNA in HCC was significantly downregulated and positively correlated with SEC14L3 expression. Transfection of GADD45A can lead to a significant increase in the mRNA and protein expression levels of the SEC14L3 gene; in HCC cells overexpressing GADD45A, the methylation level of the SEC14L3 promoter region was significantly reduced, and the expression level of SEC14L3 was negatively correlated with the methylation level of its region; in HCC with overexpressed GADD45A, overexpressed GADD45A can inhibit the cloning, proliferation, migration and invasion ability of HCC cells, and combined with overexpressed SEC14L3, it can produce more significant HCC cell cloning, proliferation, migration and invasion ability inhibition activity. These results show that GADD45A can stimulate the expression of SEC14L3 at the transcriptional level by reducing the methylation of the SEC14L3 promoter, thereby inhibiting the cloning, proliferation, migration and invasion ability of HCC cells.

[0030] In general, the present invention has discovered and clarified for the first time through a large number of studies that SEC14L3 can be used as a tumor suppressor factor in the development of hepatocellular carcinoma. By overexpressing SEC14L3 or increasing its biological activity, it can significantly inhibit the proliferation and metastasis of liver cancer, prolong the patient's survival rate, and improve the prognosis. At the same time, the present invention has deeply discovered for the first time the regulatory relationship between GADD45A and SEC14L3, that is, GADD45A can be used as an upstream transcriptional regulatory factor of SEC14L3, and promote SEC14L3 expression by reducing the methylation level of the SEC14L3 gene promoter, thereby inhibiting the growth of hepatocellular carcinoma. The present invention clarifies that SEC14L3 and GADD45A are key targets for the prognosis and treatment of HCC, and can be used for the treatment, auxiliary diagnosis and prognosis evaluation of HCC. At the same time, it raises the understanding of the pathogenesis of HCC to a new level, greatly enriches the content of the pathogenesis of HCC, and provides sufficient scientific basis and theoretical basis for exploring new molecular targets for the diagnosis, prognosis and treatment of hepatocellular carcinoma and the development of new targeted drugs, which has important social value and scientific significance. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] Figure 1 Schematic diagram of the analysis results of SEC14L3 expression levels in HCC tissues in TCGA and GEO databases.

[0032] Figure 2 Schematic diagram of the analysis results of the clinical pathological relationship between SEC14LE and HCC.

[0033] Figure 3 Schematic diagram of the effect of SEC14LE on the survival rate of HCC patients.

[0034] Figure 4 Schematic diagram of the difference in SEC14L3 expression levels in normal hepatocytes and hepatoma cells.

[0035] Figure 5 Schematic diagram of the difference in SEC14L3 expression levels between liver cancer tissues and adjacent tissues.

[0036] Figure 6 This is a schematic diagram of the effect of SEC14L3 expression level on liver cancer cell proliferation.

[0037] Figure 7 Schematic diagram of the effect of SEC14L3 expression level on the migration and invasion of liver cancer cells.

[0038] Figure 8 Schematic diagram of the effect of SEC14L3 expression level on liver cancer cell clone formation.

[0039] Fig. 9Schematic diagram of the difference in GADD45A expression levels between normal hepatocytes and hepatoma cells.

[0040] Fig.10 Schematic diagram of the difference in GADD45A expression levels between liver cancer tissues and adjacent tissues.

[0041] Fig.11 Schematic diagram of the effect of GADD45A overexpression on GADD45A and SEC14L3 mRNA expression levels in liver cancer cells.

[0042] Fig.12 Schematic diagram of the effect of GADD45A overexpression on GADD45A and SEC14L3 protein levels in liver cancer cells.

[0043] Fig.13 Schematic diagram of the results of detecting changes in methylation levels of the SEC14L3 gene promoter using bisulfite sequencing technology.

[0044] Fig.14 Schematic diagram of the effects of GADD45A and SEC14L3 expression levels on liver cancer cell proliferation.

[0045] Fig.15 Schematic diagram of the effects of GADD45A and SEC14L3 expression levels on liver cancer cell migration and invasion.

[0046] Fig.16 Schematic diagram of the effects of GADD45A and SEC14L3 expression levels on liver cancer cell clone formation.

[0047] Fig.17 Schematic diagram of the effects of GADD45A and SEC14L3 expression levels on liver cancer growth in vivo.

[0048] Fig.18 Schematic diagram of the effects of GADD45A and SEC14L3 expression levels on liver cancer tumor volume and growth curve in vivo. DETAILED DESCRIPTION

[0049] In order to make the purpose, technical scheme and effect of the present invention clearer and more specific, the present invention is further described in detail with reference to the following embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not used to limit the present invention.

[0050] Unless otherwise specified, the cell lines listed in the context of the present invention, including MIHA, HepG2, Huh7 and SK-HEP-1, were purchased from the American Type Culture Collection (Manassas, USA), cultured according to the prior art, and all cell lines were identified by short tandem repeat analysis of the China Type Culture Collection (Wuhan), and the presence of mycoplasma contamination was verified using a PCR detection kit (Shanghai Biothrive Sci), and frozen in liquid nitrogen for subsequent experiments. The reagents used in the present invention were all commercially available. The upstream primer sequence for detecting the expression level of SEC14L3 mRNA is shown in SEQ ID NO: 1, which is 5'-GAGCACTCGGTGCAGATC-3', and the downstream primer sequence is shown in SEQ ID NO: 2, which is 5'-GCTGGCTGGGTAGAACAT-3'; the upstream primer sequence for detecting the expression level of GADD45A mRNA is shown in SEQ ID NO: 3, which is 5'-GTTACTCCCTACACTGAT-3', and the downstream primer sequence is shown in SEQ ID NO: 4, which is 5'-CTGCAAAGTCATCTATCT-3'; the siRNA sequences designed for SEC14L3 to reduce the expression level of SEC14L3 in cells are shown in SEQ ID NO: 5 (Sense (5'-3'): CCCTGAAGTTCATGCTCATCGTGAATT) and SEQ ID NO: 6 (Antisense (5'-3'): TTCACGATGAGCATGAACTTCAGGGTT).

[0051] The clinical samples used in the present invention were all from the First Affiliated Hospital of Jinan University, and the patients signed informed consent forms; the pathology and tissue morphology of all tissue samples were confirmed by the Department of Pathology of the First Affiliated Hospital of Jinan University. The procedures and methods of the present invention were approved by the Institutional Ethics Committee of the First Affiliated Hospital of Jinan University, in line with the requirements of medical ethics and the quality management standards for drug clinical trials, and the experimental processes all complied with the Declaration of Helsinki. The experimental methods used in the present invention, such as bioinformatics analysis, molecular biology experiments, cell biology experiments, immunohistochemistry, etc., are conventional methods and techniques in the field. Representative results selected from the biological experiment repetitions are presented in the context figures, and the data are displayed as mean ± SD and mean ± SEM as specified in the figure. All in vitro experiments were repeated at least three times, and animal experiments were repeated twice. The data were analyzed using GraphPad Prism 8.0 software. Conventional medical statistical methods such as t-test, chi-square test, and analysis of variance were used to compare the mean differences between two or more groups. *p < 0.05 is considered a significant difference.

[0052] Example 1

[0053] First, the RNA sequencing data was cleaned and normalized to transcripts per million (TPM) using the SEC14L3 RNA sequencing results and clinical data of HCC patients in the TCGA and GEO databases for bioinformatics analysis. In the TCGA database, it was found that the mRNA expression level of SEC14L3 in HCC tissues was significantly reduced compared with that in adjacent non-tumor tissues (ANT) (p < 0.0001); in the GEO database, it was found that the expression level of SEC14L3 in HCC tissues was also significantly reduced compared with that in matched adjacent non-tumor tissues (MANT) (p < 0.0001) (see Figure 1 ). Compared with stage I and II HCC tissues, SEC14L3 in stage III (advanced liver cancer) and stage IV (advanced liver cancer) HCC tissues was significantly decreased (p = 0.0210); in addition, compared with moderately differentiated (G2) and well differentiated (G1) HCC tissues, SEC14L3 in poorly differentiated (G3) and undifferentiated (G4) HCC tissues was significantly decreased (p < 0.0001) (see Figure 2 Subsequently, by analyzing the effect of SEC14L3 on the overall survival (OS), disease specific survival (DSS) and progression free survival (PFS) of HCC patients, it was found that low expression of SEC14L3 was associated with worse OS (Hazard rating (HR) = 0.59, p = 0.0030), DSS (HR = 0.62, p = 0.0320) and PFS (HR = 0.60, p = 0.0010) in HCC patients (see Figure 3 ) related.

[0054] In order to verify the above bioinformatics analysis results, fluorescence quantitative RT-PCR and western blot were used to detect the mRNA and protein expression levels of SEC14L3 gene in liver cancer cells (HepG2, Huh7 and SK-HEP-1) and normal liver cells (MIHA), respectively. Figure 4 The results showed that compared with normal hepatocytes (MIHA), the mRNA and protein expression levels of SEC14L3 in hepatoma cells (HepG2, Huh7 and SK-HEP-1) were significantly reduced, which was consistent with the above bioinformatics analysis results.

[0055] To further verify the relationship between SEC14L3 and HCC, tumor tissues and matched adjacent non-tumor tissues (MANT) of 46 liver cancer patients from the First Affiliated Hospital of Jinan University were collected for IHC analysis. The results showed that the expression level of SEC14L3 protein in HCC tissues was also significantly lower than that in MANT, which was consistent with the above cell results (p < 0.0001) (see Figure 5 The above results indicate that SEC14L3 is lowly expressed in HCC tissues, and HCC with low SEC14L3 expression is more malignant. SEC14L3 may affect the occurrence and development of HCC and can serve as a potential biomarker and therapeutic target for HCC.

[0056] Example 2

[0057] In the above examples, the effects of SEC14L3 expression level on the occurrence, development and treatment prognosis of liver cancer were clarified in clinical samples. In order to further study the effect of SEC14L3 on liver cancer, a series of in vitro experiments were conducted to further study it.

[0058] First, a cell proliferation experiment was performed. The specific steps are as follows:

[0059] (1) HepG2 and SK-HEP-1 cells in the logarithmic growth phase were transfected (Lipofectamine 2000, Invitrogen) with SEC14L3 gene overexpression plasmid (SEC14L3-OE) and blank control plasmid (SEC14L3-CON), transfected with RNA interference knockdown SEC14L3 gene expression sequence plasmid (siSEC14L3, sequence as shown in SEQ ID NO: 5 (Sense (5'-3'): CCCTGAAGTTCATGCTCATCGTGAATT) and SEQ ID NO: 6 (Antis ense (5'-3'): TTCACGATGAGCATGAACTTCAGGGTT)) and negative control plasmid (siSEC14L3-CON), trypsinized and counted, and the appropriate cell density was selected according to the doubling time of various cells, and the cells were seeded into 96-well plates (3 replicates).

[0060] (2) The cells were cultured in a 37°C incubator and collected at 0 h, 24 h, 48 h, and 72 h. 10 μL of CCK-8 was added to each well. The culture plate was incubated in the incubator for 1-4 h, and the absorbance at 450 nm was measured to evaluate the cell proliferation.

[0061] The experimental results are as follows Figure 6The results showed that compared with the blank control group (SEC14L3-CON) or the negative control group (siSEC14L3-CON), overexpression of SEC14L3 could significantly inhibit the proliferation of liver cancer cells, while inhibition of SEC14L3 expression by SEC14L3 inhibitor could effectively promote the proliferation of liver cancer cells.

[0062] Subsequently, HepG2 and SK-HEP-1 cells in the logarithmic growth phase that were transfected with SEC14L3 gene overexpression plasmid (SEC14L3-OE) and blank control plasmid (SEC14L3-CON), transfected with RNA interference knockdown SEC14L3 gene expression sequence plasmid (siSEC14L3) and negative control plasmid (siSEC14L3-CON) were used for cell migration and invasion experiments. The specific steps are as follows:

[0063] Transwell cell invasion assay

[0064] (1) One day before the experiment, place a tube of Matrigel from -20°C into a 4°C refrigerator overnight to allow it to melt from a solid state to a liquid state.

[0065] (2) Prepare 10% Matrigel on ice, take 50 μL of it to coat the upper chamber surface of the bottom membrane of the transwell chamber, and place it at 37°C for 30 minutes to allow the Matrigel to solidify.

[0066] (3) After trypsin digestion of cells in the logarithmic growth phase, resuspend them in basal medium to form a cell suspension, count them, and adjust the cell density to 5×10 5 Pieces / mL.

[0067] (4) The basal culture medium in the chamber and the 24-well plate was aspirated and discarded, 200 μL of cell suspension was added to the upper chamber of the transwell chamber, and 600 μL of complete culture medium (basal culture medium + 10% fetal bovine serum) was added to the lower chamber of the 24-well culture plate.

[0068] (5) Place the culture plate in a CO2 incubator at 37°C and continue culturing for 16 hours.

[0069] (6) The chamber was removed, rinsed twice with PBS, fixed in a 24-well plate with 4% paraformaldehyde for 20 min, and stained with crystal violet solution for 15 min.

[0070] (7) Use a cotton swab to carefully wipe off the cells and matrix gel on the upper layer of the microporous membrane of the chamber and take pictures under an inverted microscope.

[0071] Transwell cell migration assay

[0072] Corning Transwell Migration chambers with 8 μm pores and 24-well plates were used.

[0073] (1) Place the chamber in a 24-well plate and add 1 mL of basal culture medium to each well to moisten it.

[0074] (2) After trypsin digestion of cells in the logarithmic growth phase, resuspend them in basal medium to form a cell suspension, count them, and adjust the cell density to 5×10 5 Pieces / mL.

[0075] (3) The basal culture medium in the chamber and the 24-well plate was aspirated and discarded, 200 μL of cell suspension was added to the upper chamber of the transwell chamber, and 600 μL of complete culture medium (basal culture medium + 10% fetal bovine serum) was added to the lower chamber of the 24-well culture plate.

[0076] (4) Place the culture plate in a CO2 incubator at 37°C and continue culturing for 14 hours.

[0077] (5) The chamber was removed, rinsed twice with PBS, fixed with 4% paraformaldehyde in a 24-well plate for 20 min, and stained with crystal violet solution for 15 min.

[0078] (6) Carefully wipe off the cells on the upper layer of the microporous membrane of the chamber with a cotton swab and take photos under an inverted microscope.

[0079] The results are as follows Figure 7 The results showed that compared with the blank control group (SEC14L3-CON) or the negative control group (siSEC14L3-CON), overexpression of SEC14L3 could significantly inhibit the migration and invasion of liver cancer cells, while inhibition of SEC14L3 expression by SEC14L3 inhibitor could effectively promote the migration and invasion of liver cancer cells.

[0080] Furthermore, HepG2 and SK-HEP-1 cells in the logarithmic growth phase that were transfected with SEC14L3 gene overexpression plasmid (SEC14L3-OE) and blank control plasmid (SEC14L3-CON), transfected with RNA interference knockdown SEC14L3 gene expression sequence plasmid (siSEC14L3) and negative control plasmid (siSEC14L3-CON) were used for cloning experiments. The specific steps are as follows:

[0081] (1) Cells in the logarithmic growth phase were taken, digested with 0.25% trypsin and blown into single cells, and the cells were suspended in DMEM culture medium containing 10% fetal bovine serum for later use.

[0082] (2) Dilute the cell suspension and inoculate at a density of 1000 / well in a dish containing 10 mL of 37°C pre-warmed culture medium. Gently rotate the dish to evenly disperse the cells and culture them in a cell culture incubator at 37°C, 5% CO2 and saturated humidity.

[0083] (3) After 48 h of incubation, when clones visible to the naked eye appear in the culture dish, the culture is terminated, the supernatant is discarded, and the wells are carefully rinsed twice with PBS. 1 mL of methanol containing 0.5% crystal violet is added to each well and stained for 30 min. The methanol is discarded and the residual methanol is washed with water. Cell clones can be observed. Under a microscope, a valid clone is counted when the number of cells is greater than 50.

[0084] The results are as follows Figure 8 The results showed that compared with the blank control group (SEC14L3-CON) or the negative control group (siSEC14L3-CON), overexpression of SEC14L3 could significantly inhibit the cloning of liver cancer cells, while inhibition of SEC14L3 expression by SEC14L3 inhibitor could effectively promote the cloning of liver cancer cells.

[0085] Example 3

[0086] During the analysis of liver cancer cells, it was found that the mRNA and protein expression levels of GADD45A in liver cancer cells were significantly lower than those in normal liver cells (see Fig. 9 ). Using IHC to verify 46 pairs of HCC tissue samples and MANT samples, it was found that the expression level of GADD45A protein in HCC tissues was also significantly reduced compared with MANT (p < 0.0001) (see Fig.10 The above results indicate that GADD45A is lowly expressed in liver cancer tissues and may have a certain impact on the occurrence and development of liver cancer, which is similar to SCE14L3.

[0087] In order to explore the relationship between SEC14L3 and GADD45A, the co-expression network analysis of the SEC14L3 gene was performed using the cBioPortal database (https: / / www.cbioportal.org / ). The results showed that the mRNA expression levels of GADD45A and SEC14L3 were positively correlated (r=0.5, p=7.70e-25), suggesting that GADD45A and SEC14L3 have a certain positive regulatory relationship.

[0088] In order to verify the positive regulation of GADD45A on SEC14L3, the negative control plasmid (GADD45A-CON) and GADD45A gene expression plasmid (GADD45A-OE) were transfected into liver cancer cells (HepG2 and SK-HEP-1), and the changes in SEC14L3 mRNA and protein expression levels were detected by fluorescence quantitative RT-PCR and Western blot, respectively. The results showed that compared with the negative control group (GADD45A-CON), the GADD45A gene expression plasmid (GADD45A-OE) group had significantly increased GADD45A and SEC14L3 mRNA and protein expression levels (see Figure 11-12 ), indicating that GADD45A can positively regulate the expression of SEC14L3.

[0089] In order to explore the possible mechanism of low expression of SEC14L3, the methylation status of the SEC14L3 gene promoter was analyzed using HCC tissue specimens in the TCGA database. The results showed that there were multiple methylation sites (-55 / -221 fragments) upstream of the SEC14L3 gene promoter, and its methylation level was negatively correlated with SEC14L3 mRNA expression, suggesting that low expression of SEC14L3 was associated with high methylation of its promoter (p < 0.001). In order to explore the relationship between GADD45A and SEC14L3 promoter methylation, the negative control plasmid (GADD45A-CON) and GADD45A gene expression plasmid (GADD45A-OE) were transfected into liver cancer cells (HepG2 and SK-HEP-1), and the bisulfite sequencing (BSP) technology was used to detect the changes in the methylation level of the SEC14L3 gene promoter (the SEC14L3 BSP upstream primer sequence used is shown in SEQ ID NO: 7, which is 5'-AGGGTAGTGGTTATTGGAGGTTT-3', and the downstream primer sequence is shown in SEQ ID NO: 8, which is 5'-AATCCTTTTACCCCCACTCCT-3'). Compared with the negative control group (GADD45A-CON), transiently overexpressed GADD45A significantly reduced the methylation level of the SEC14L3 gene promoter in liver cancer cells (see Fig.13 The above results indicate that GADD45A positively regulates the expression of SEC14L3 by negatively regulating the methylation level of the SEC14L3 gene promoter.

[0090] In order to explore the effect of GADD45A / SEC14L3 signal axis on the clone formation, proliferation, migration and invasion ability of liver cancer cells, GADD45A gene expression plasmid (GADD45A-OE) and negative control plasmid (GADD45A-CON), SEC14L3 gene + GADD45A gene co-expression plasmid (SEC14L3-OE + GADD45A-OE) were transiently transfected into liver cancer cells (HepG2 and SK-HEP-1), and cell proliferation experiment, cell migration and invasion experiment, and cell clone formation experiment were performed according to the method in Example 2. The results showed that compared with the negative control, transient overexpression of GADD45A can significantly inhibit the proliferation, migration and invasion of liver cancer cells and the clone formation ability, and the inhibitory effect of combined overexpression of GADD45A and SEC14L3 is more significant, which is significantly better than inhibiting SEC14L3 or GADD45A alone (see Figure 14-16 ).

[0091] In order to verify the role of the GADD45A / SEC14L3 signaling axis in liver cancer in vivo, an in vivo experiment was conducted using nude mice. The specific steps are as follows:

[0092] (1) One day before the experiment, place the already packaged Matrigel from -20°C into a 4°C refrigerator overnight to melt it from a solid state to a liquid state.

[0093] (2) Twenty 4-week-old Balb / c-nu mice were randomly divided into 4 groups, designated as Group 1 to Group 4, with 5 mice in each group. Tumor cells were injected subcutaneously on the back of the mice; Group 1 mice were injected subcutaneously with a liver cancer cell line stably expressing SEC14L3 (HepG2-SEC14L3), Group 2 mice were injected subcutaneously with a liver cancer cell line stably expressing GADD45A (HepG2-GADD45A), Group 3 mice were injected subcutaneously with a liver cancer cell line stably co-expressing GADD45A and SEC14L3 (HepG2-GADD45A+SEC14L3), and Group 4 mice were injected subcutaneously with an untreated cell line (HepG2-CON) as a negative control.

[0094] (3) The growth and mental state of the mice were observed daily. After the tumor was formed, the tumor size of each group of mice was measured regularly and the tumor volume was calculated. The tumor volume was calculated using the following formula: Volume (mm 3 )=Length(mm)×Width 2 (mm 2 ) / 2.

[0095] (4) On the 28th day of the experiment, the mice were killed, and the tumors of each group of mice were removed and photographed.

[0096] The experimental results are as follows Figure 17-18The results showed that compared with the negative control group (HepG2-CON, group 4), the tumor growth rate in nude mice with overexpression of SEC14L3 or GADD45A (groups 1 and 2) was significantly slower and the tumor volume was significantly smaller; in the group with combined overexpression of SEC14L3 and GADD45A (group 3), both the tumor growth rate and the tumor size were significantly more effectively controlled, indicating that SEC14L3 and GADD45A can inhibit the development of liver cancer, and the two can produce significant synergistic inhibitory activity.

[0097] In general, the present invention first analyzed the changes in SEC14L3 expression levels in TCGA database and GEO database and liver cancer cells and hepatocellular carcinoma tissues; the results of TCGA and GEO showed that the expression level of SEC14L3 in HCC tissues was significantly reduced, and the results of KM survival analysis showed that the overall survival rate OS, DSS and PFS of HCC patients with low expression of SEC14L3 were significantly worse than those with high expression of SEC14L3; the results of fluorescent quantitative RT-PCR and Western blot showed that the expression levels of SEC14L3 mRNA and protein in liver cancer cells were also significantly reduced; the results of IHC showed that the expression level of SEC14L3 in HCC tissue specimens was also significantly reduced. Then, the effect of SEC14L3 on the cloning, proliferation, migration and invasion of liver cancer cells was explored; the results showed that overexpression of SEC14L3 could inhibit the cloning, proliferation, migration and invasion of liver cancer cells, while knocking down SEC14L3 expression showed the opposite effect. Next, the changes in GADD45A expression levels in databases (TCGA and GEO) and liver cancer cells and hepatocellular carcinoma tissues were analyzed; the results of TCGA and GEO showed that the expression level of GADD45A in HCC tissues was significantly reduced, and the results of KM survival analysis showed that low expression of GADD45A was associated with poor OS and DSS in HCC patients; the results of fluorescent quantitative RT-PCR and Western blot showed that the expression levels of GADD45A mRNA and protein in liver cancer cells were significantly reduced; IHC results showed that the expression level of GADD45A in HCC tissue specimens was also significantly reduced. Further, the effects of GADD45A on the expression level of SEC14L3 in liver cancer cells and the methylation level of the SEC14L3 gene promoter were explored, as well as the effects of the GADD45A / SEC14L3 signaling axis on the cloning, proliferation, migration and invasion of liver cancer cells. The results showed that the expression levels of GADD45A mRNA and SEC14L3 mRNA were positively correlated; overexpression of GADD45A could promote the expression levels of SEC14L3 mRNA and its protein in liver cancer cells; TCGA results showed that low expression of SEC14L3 was associated with high methylation of its promoter, suggesting that the methylation level of SEC14L3 was negatively correlated with the expression of SEC14L3 mRNA; bisulfite sequencing results showed that overexpression of GADD45A significantly reduced the methylation level of the SEC14L3 gene promoter in liver cancer cells; in vitro cell experiment results showed that transient overexpression of GADD45A significantly inhibited the cloning, proliferation, migration and invasion ability of liver cancer cells, while the combined overexpression of GADD45A and SEC14L3 could produce more obvious synergistic inhibitory activity.Finally, we explored the effect of the GADD45A / SEC14L3 signaling axis on the growth of hepatocellular carcinoma in vivo. The results showed that the weight and volume of tumors in vivo with stable overexpression of SEC14L3 or GADD45A were smaller, while the combined stable overexpression of SEC14L3 and GADD45A had a more significant inhibitory activity on tumors in vivo.

[0098] It can be clearly seen from the above that SEC14L3 can be used as a tumor suppressor factor in the development of hepatocellular carcinoma. By overexpressing SEC14L3 or increasing its biological activity, it can significantly inhibit the proliferation and metastasis of liver cancer, prolong the patient's survival rate, and improve the prognosis. At the same time, the present invention deeply discovered the regulatory relationship between GADD45A and SEC14L3 for the first time, that is, GADD45A can be used as an upstream transcriptional regulatory factor of SEC14L3, and promote SEC14L3 expression by reducing the methylation level of the SEC14L3 gene promoter, thereby inhibiting the growth of hepatocellular carcinoma. The present invention clarifies that SEC14L3 and GADD45A are key targets for the prognosis and treatment of HCC, and can be used for the treatment, auxiliary diagnosis and prognosis evaluation of HCC. At the same time, it raises the understanding of the pathogenesis of HCC to a new level, greatly enriches the content of the pathogenesis of HCC, and provides sufficient scientific basis and theoretical basis for exploring new molecular targets for the diagnosis, prognosis and treatment of hepatocellular carcinoma and the development of new targeted drugs, which has important social value and scientific significance.

[0099] The above specific implementation method part specifically introduces the analytical method involved in the present invention. It should be noted that the above introduction is only to help those skilled in the art better understand the method and ideas of the present invention, rather than limiting the relevant content. Without departing from the principle of the present invention, those skilled in the art may also make appropriate adjustments or modifications to the present invention, and the above adjustments and modifications shall also fall within the scope of protection of the present invention.

Claims

1. Use of SEC14L3 in the preparation of drugs for preventing and / or treating hepatocellular carcinoma.

2. Use of a reagent for detecting the expression level of SEC14L3 in the preparation of a composition for auxiliary diagnosis and / or prognosis evaluation of hepatocellular carcinoma, characterized in that: The reagent for detecting the expression level of SEC14L3 includes primers for detecting the expression level of SEC14L3 gene and / or a reagent for detecting the expression level of SEC14L3 protein.

3. The use according to claim 2, characterized in that: The prognostic assessment indicator is selected from one or more of overall survival, disease-specific survival, progression-free survival, and risk of hepatocellular carcinoma metastasis.

4. The use according to claim 2, characterized in that: The primers for detecting the expression level of the SEC14L3 gene are selected from the following primer pair: the upstream primer sequence of the primer pair is shown as SEQ ID NO: 1, and the downstream primer sequence is shown as SEQ ID NO:

2.

5. Use of SEC14L3 and GADD45A in the preparation of drugs for preventing and / or treating hepatocellular carcinoma.

Images