A method for cultivating blood clam seedlings with vibrio resistance

Abstract

The present invention provides a method for cultivating blood clam seedlings with vibrio resistance. By analyzing the differences in the disease-resistant traits of blood clam populations against vibrio, molecular markers linked to the disease-resistant traits are screened, and the screened molecular markers are used to screen parents for the genetic breeding of blood clams. The SNP molecular marker is located at the 71st position of the nucleic acid fragment with the sequence of SEQ ID NO:1 and is an A / C substitution. The present invention analyzes the correlation between the disease-resistant traits and genotypes of blood clams, and finds that the disease-resistant performance of individuals with the genotype AA is significantly higher than that of individuals with the genotypes CC and AC. Through the specific genotype at this locus, blood clam individuals with better disease-resistant ability can be screened and used as parents for breeding to obtain filial individuals with vibrio resistance.

Description

Technical Field

[0001] The present invention belongs to the technical field of breeding of fry of farmed animals, and particularly relates to a method for cultivating Tegillarca granosa fry with vibrio resistance. Background Art

[0002] Vibrio is one of the common bacterial populations in the marine environment, widely distributed in the sea water of estuaries, bays, coastal waters and in marine animals. There are many species of Vibrio, and the main pathogenic vibrios include Vibrio harveyi, Vibrio anguillarum, Vibrio alginolyticus, Vibrio cholerae, Vibrio parahaemolyticus, etc. Vibrio vulnificus is an important conditional pathogen in mariculture. Existing studies have shown that Vibrio harveyi can infect important aquaculture animals such as Paralichthys olivaceus, Lates calcarifer, Acanthurus chirurgus, Takifugu rubripes, Penaeus monodon, Litopenaeus vannamei and Meretrix meretrix, and cause their death, bringing serious economic losses to the aquaculture industry.

[0003] Tegillarca granosa belongs to Mollusca and Tegillarca, and is a typical eurythermal and euryhaline intertidal shellfish, widely distributed in the Indian Ocean and the western Pacific Ocean region. In China, it is mainly distributed in the coastal areas south of the Shandong Peninsula. It is one of the four major economically cultured shellfishes in China and plays a crucial ecological role in the coastal ecosystem. In recent years, epidemic diseases and large-scale deaths of cultured Tegillarca granosa have occurred from time to time. Among them, vibrio diseases are the most common and cause the most serious deaths, which has become one of the bottleneck problems restricting the healthy development of the Tegillarca granosa aquaculture industry. Therefore, as soon as possible to cultivate good varieties of Tegillarca granosa resistant to vibrio and quickly promote them to aquaculture production will become the top priority to break through the bottleneck and drive the rapid development of the industry.

[0004] Selective breeding is one of the traditional classic breeding techniques. At present, relevant research institutions in China have carried out research on selective breeding of Tegillarca granosa. However, the traditional breeding method has a long cycle and low efficiency. By using molecular marker technology to study its genetic background and screening molecular markers closely related to important economic traits, early selection can be realized, the accuracy of selection can be improved, and the generation interval can be shortened, thus greatly accelerating the breeding process of new varieties.

[0005] There have been some reports at home and abroad on screening molecular markers for growth, disease resistance, stress resistance, etc. of aquatic animals by using molecular marker technology, such as Paralichthys olivaceus, Patinopecten yessoensis, Penaeus chinensis, etc. The present invention screened Tegillarca granosa individuals resistant to vibrio, and used molecular marker technology to conduct research, and obtained SNP loci associated with vibrio resistance of Tegillarca granosa, providing useful molecular markers for the breeding of disease-resistant good varieties of Tegillarca granosa. Summary of the Invention

[0006] The object of the present invention is to provide a method for cultivating blood clam seedlings with vibrio resistance. By analyzing the differences in the disease-resistant traits of blood clam populations against vibrio, molecular markers linked to the disease-resistant traits are screened, and the screened molecular markers are used to screen parents for the genetic breeding of blood clams.

[0007] The present invention first provides an SNP locus related to the disease-resistant trait of blood clams. The SNP molecular marker is located at the 71st position of the nucleic acid fragment with the sequence of SEQ ID NO:1, and is an A / C substitution.

[0008] The SNP locus provided by the present invention is used to screen blood clam individuals with disease-resistant potential.

[0009] The present invention also provides a primer pair for detecting the SNP molecular marker. The specific primer sequence information is as follows:

[0010] F: 5’-GGCGGGCCTTTATGTAGAGG-3’ (SEQ ID NO:2),

[0011] R: 5’-CCCCCATCATCACTGGCATA-3’ (SEQ ID NO:3);

[0012] The present invention also provides a method for screening blood clams with disease-resistant potential, which is to screen individuals with a specific genotype of the SNP locus;

[0013] The individuals with the specific genotype are AA-type individuals;

[0014] The present invention analyzed the correlation between the disease-resistant trait of blood clams and the genotype, and found that the disease-resistant performance of individuals with the genotype of AA is significantly higher than that of individuals with the genotypes of CC and AC. Through the specific genotype of this locus, blood clam individuals with better disease-resistant ability can be screened and used as parents for breeding to obtain filial individuals with vibrio resistance. Description of the Drawings

[0015] Figure 1 : SNP polypeptide locus map screened and related to the disease-resistant trait of blood clams;

[0016] Figure 2 : Genotype detection map of the A71C marker locus by SNaPshot, a. AC genotype; b. AA genotype; c. CC genotype;

[0017] Figure 3 : Mortality data map of blood clams in the marker group and the common group; Detailed Embodiments

[0018] The present invention will be described in detail below in conjunction with the embodiments and the drawings.

[0019] Example 1: Screening of SNP loci related to resistance to Vibrio harveyi in blood cockles

[0020] 1. Screening of candidate SNP loci

[0021] Four hundred healthy blood cockles with intact shells, uniform body sizes were selected and immersed in seawater containing Vibrio harveyi at a concentration of 5×10 6 CFU / mL for infection. During the infection period, the seawater temperature was maintained at 28°C, continuous aeration was carried out, the water was changed once a day, and the bacterial solution was added after water change. Diatoms were fed once in the morning and once in the evening. After 5 days of infection, the death situation of the blood cockles was observed. Fifty blood cockles that died early and fifty that survived until the end were selected and marked as the susceptible group and the disease-resistant group. Their muscle tissues were dissected for DNA extraction.

[0022] Thirty-six SNP loci were detected by amplifying and sequencing the CDS region of the whole gene sequence of blood cockles, and primers were designed and synthesized by Shanghai Sangon Biological Engineering Co., Ltd.

[0023] The total volume of the PCR reaction system was 25 μL, including 2.5 μL of 10×PCR buffer, 2.5 μL of 25 mmol / L MgCl 2 2, 2 μL of 2.5 mmol / L dNTPs, 1.0 μL of each upstream and downstream primer (10 μmol / L), 0.13 μL of 5 U / μL rTaq DNA polymerase (TaKaRa), 1.0 μL of DNA template, and added with sterile ddH 2 O to 25 μL.

[0024] The amplification reaction was completed on an AG22331 type PCR instrument (Eppendorf). The PCR amplification program was as follows: pre-denaturation at 94°C for 5 min, followed by 30 PCR cycles [94°C for 30 s, annealing temperature for 30 s, extension at 72°C for 30 s], and finally extension at 72°C for 7 min. The PCR product was fully mixed with the SNaPshot Mix reagent for PCR extension reaction, and finally the target fragment was sequenced on an ABI 3730 sequencer.

[0025] 2. Polymorphism analysis of SNP loci

[0026] The SNP locus (A71C) was genotyped and associated with the disease resistance of mud clam. The results showed that there were three genotypes at the SNP locus, among which the homozygous AA was the dominant genotype, with 4 individuals in the susceptible group and 26 individuals in the disease-resistant group, and the genotype frequencies in the two groups were 8% and 52%, respectively; the heterozygous genotype had 38 individuals in the susceptible group and 22 individuals in the disease-resistant group, and the genotype frequencies in the two groups were 76% and 44%, respectively; the homozygous CC had 8 individuals in the susceptible group and 2 individuals in the disease-resistant group, and the genotype frequencies in the two groups were 16% and 4%, respectively. The association analysis of the disease resistance traits of the SNP loci screened in the two populations of mud clam genes showed that the SNP locus A71C showed a significant correlation with the disease resistance trait (P<0.05).

[0027] Table 1: Detailed table of genotypes and gene frequencies of some SNP loci in mud clams

[0028]

[0029] The PCR product was sent to a bioengineering company for sequencing. The SNP site was located at position 71 of SEQ ID NO:1, which was an A / C substitution ( Figure 1 ), the target sequence is as follows:

[0030] ATAGGGATCTGTTTAAGATTTCATATTCGTGTTAATTTAGCACAGCCGG

[0031] CGGGCCTTTATGTAGAGGTGAGTCAGTTGTATAATGTAATTATTACGAGGCA

[0032] TGCGTTTATTATAATTTTTTTTTTTGTTATGCCAGTGATGATGGGGGGTTTG

[0033] GG (SEQ ID NO: 1);

[0034] The primer pair sequence information used to detect the above sequence is as follows:

[0035] Upstream primer F: GGCGGGCCTTTATGTAGAGG (SEQ ID NO: 2),

[0036] Downstream primer R: CCCCCATCATCACTGGCATA (SEQ ID NO: 3),

[0037] SNaPshot was used to perform genotyping on the SNP locus, which contained three genotypes: TT, AC, and CC. Figure 2), among which the body size data of individuals with the AA genotype are significantly higher than those of the AC and CC genotypes, and it is the dominant gene.

[0038] Example 2: Screening individuals with disease-resistant traits using SNP loci

[0039] Offspring individuals of 1000 blood cockles in a blood cockle breeding farm in Zhejiang Province were detected. Genomic DNA of each blood cockle was obtained by non-invasive sampling. The A71C marker locus was amplified and detected using primers with upstream and downstream sequences of SEQ ID NO:2 and SEQ ID NO:3, and individuals with the AA genotype were screened. A total of 98 blood cockles with the A71C marker locus were screened from 1000 blood cockles in total, among which 49 individuals had the AA genotype. The screened individuals were raised with other individuals under the same conditions for 7 days of adaptive feeding, and then an infection test was carried out.

[0040] 10 blood cockles with uniform body shape, intact shell, healthy and vigorous were taken from the screened group and the common group, which were divided into the marker group and the common group respectively, and they were raised in seawater with a Vibrio harveyi concentration of 5×10 6 CFU / mL. There were three replicates in each group. During the infection period, the seawater temperature was maintained at 28°C, continuous aeration was carried out, the water was changed once a day, and the bacterial solution was added after water change, and diatoms were fed once in the morning and once in the evening. After 7 days, the death conditions of blood cockles in each group were observed and recorded.

[0041] Within 7 days, the number of diseased and dead blood cockles gradually increased. The dead blood cockles showed weak adductor muscles, white body fluid, white and stinking meat color, and mucus on the shell edge. Figure 3 It can be seen that the mortality rate of blood cockles in the common group reached more than 90% after being infected with Vibrio harveyi for 7 days, while the mortality rate of the marker group was only 50%.

[0042] The individuals with the AA genotype screened were used as parents to breed offspring. When the offspring grew to about 1 cm in shell length, 300 healthy and vigorous individuals were selected for the infection test, and the test method was the same as that of the parents. After the test, it was measured that the mortality rate of the offspring blood cockles was 49.8% after being infected with Vibrio harveyi at a concentration of 5×10 6 CFU / mL for 7 days, which was the same as that of the parents, confirming that the offspring bred from the individuals screened by this marker locus had good disease resistance.

[0043] The results show that the individuals with the AA genotype of blood cockles screened by the loci provided by the present invention have better resistance to Vibrio harveyi. Breeding with the screened individuals as parents, the offspring also have good disease resistance, indicating that the SNP loci provided by the present invention can be used for screening disease-resistant parents of blood cockles.

Claims

1. A method for screening mud clams having resistance to Vibrio harveyi, characterized in that: The method is to screen individuals with a specific genotype of a SNP site associated with the disease resistance trait of mud cockle, and the individuals with the specific genotype are AA-type individuals; The SNP site is located at the 71st position of the nucleic acid fragment with the sequence of SEQ ID NO: 1, and is an A / C substitution.

2. The method according to claim 1, characterized in that The method is to amplify the mud cockle individuals to be detected by PCR and perform genotyping on the amplified products.

3. The method according to claim 2, characterized in that The primer pair used in the PCR amplification has an upstream primer sequence of SEQ ID NO: 2 and a downstream primer sequence of SEQ ID NO: 3.

Images