Drug delivery system for treating malignant solid tumors based on attenuated Salmonella, preparation method and application thereof

Abstract

The purpose of the present invention is to provide a drug delivery system for treating malignant solid tumors based on attenuated Salmonella, as well as its preparation method and application, for ablating malignant solid tumors. The drug delivery system uses attenuated Salmonella to carry small nucleic acid drugs such as PD-L1 or HSP90, and loads a photosensitizer onto the attenuated Salmonella. It is mainly used to regulate the expression of genes such as PD-L1 or HSP90 on the cell surface, so that the effector plasmid is mainly concentrated in specific tissue sites to replace antibody drugs, while improving the stability of the material and reducing toxicity, so as to improve the photothermal targeting and prolong the duration of action, thereby synergistically treating malignant solid tumors.

Description

Technical Field

[0001] The present invention relates to the field of biomedicine technology, and in particular to a drug delivery system for treating malignant solid tumors based on attenuated Salmonella, and a preparation method and application thereof. Background Art

[0002] Bacteria-mediated cancer therapy has attracted considerable attention due to its unique advantages. Bacteria that preferentially accumulate in the microenvironment of malignant solid tumors can serve as natural delivery vehicles for targeting malignant solid tumors, actively penetrating tissues for easy detection, and inducing controllable cytotoxicity. The ability of novel attenuated recombinant engineered bacteria to selectively target malignant solid tumor tissues also makes them ideal delivery vehicles for targeted therapy of malignant solid tumors. Salmonella, an intracellular parasite, replicates efficiently within malignant solid tumor tissues and effectively inhibits their growth. Genetically engineered facultative anaerobic Salmonella has been shown to enhance its ability to target malignant solid tumors while reducing its toxicity. This makes it suitable for use as a delivery vehicle for gene therapy of malignant solid tumors in vitro and in vivo for malignant melanoma, breast cancer, liver cancer, gastric cancer, and colorectal cancer. Compared to other bacteria, attenuated recombinant Salmonella possesses advantages such as high specificity for malignant solid tumors, deep tissue penetration, inherent bacterial toxicity, ease of genetic modification, and a good safety profile.

[0003] Currently, novel treatment strategies for malignant solid tumors primarily focus on targeted therapies and immune checkpoint inhibitors. However, immune checkpoint inhibitors can trigger immune-related adverse events, and long-term use of anti-PD-L1 drugs can lead to drug resistance and multiple complications. Furthermore, production costs are high, necessitating the urgent need for equally effective but less toxic treatments.

[0004] To overcome the limitations of traditional cancer treatments, new treatments are being developed, particularly photodynamic therapy (PDT) and photothermal therapy (PTT), which have achieved excellent results in cancer treatment. Among these, photosensitizers, such as IR780, are molecules with strong optical absorption and emission in the near-infrared (NIR) region and are attracting increasing attention from researchers in the fields of cancer treatment and imaging. Under NIR light irradiation, IR780 can generate a large number of reactive oxygen species (ROS) and rapidly increase the local temperature of malignant solid tumors, thus showing broad prospects for application in cancer photodynamic and photothermal therapy. However, disadvantages of photosensitizers, such as poor water solubility, rapid clearance, acute toxicity, and low uptake by malignant solid tumors, limit their use. Summary of the Invention

[0005] The purpose of the present invention is to provide a drug delivery system for treating malignant solid tumors, which is used to ablate malignant solid tumors. The drug delivery system uses attenuated Salmonella to carry small nucleic acid drugs such as PD-L1 or HSP90, and loads a photosensitizer onto the attenuated Salmonella. It is mainly used to regulate the expression of genes such as PD-L1 or HSP90 on the cell surface, so that the effector plasmid is mainly concentrated in specific tissue sites to replace antibody drugs, while improving the stability of the material and reducing toxicity, so as to improve the photothermal targeting and prolong the duration of action, thereby synergistically treating malignant solid tumors.

[0006] The above purpose is achieved through the following technical solutions:

[0007] A drug delivery system for treating malignant solid tumors. The drug delivery system uses attenuated Salmonella as a carrier to carry a small nucleic acid drug. The small nucleic acid drug is a small interfering RNA plasmid that inhibits the expression of genes such as PD-L1 or HSP90. The attenuated Salmonella is loaded with a photosensitizer, which is IR780.

[0008] Furthermore, the nucleotide sequence from 5' to 3' of shPD-L1 in the above drug delivery system is CGAAATGATACACAATTCGA.

[0009] Furthermore, the nucleotide sequence of shHSP90 in the drug delivery system is UUUAGUACCAGACUUGGCAAUGGUU from 5' to 3'.

[0010] Furthermore, the shPD-L1 plasmid in the above drug delivery system contains a pLKO.1 backbone.

[0011] Furthermore, the shHSP90 plasmid in the above drug delivery system contains a pLKO.1 backbone.

[0012] Furthermore, the attenuated Salmonella in the above-mentioned drug delivery system is a phoP / phoQ mutant strain.

[0013] Furthermore, the malignant solid tumor is melanoma or breast cancer.

[0014] Another object of the present invention is to provide a drug for treating malignant solid tumors, wherein the active ingredient of the drug comprises the above-mentioned drug delivery system.

[0015] Another object of the present invention is to provide a method for preparing a drug delivery system for treating malignant solid tumors based on attenuated Salmonella, characterized in that: IR780 is dissolved in DMSO and diluted to a concentration of 25-200 μg / mL; the attenuated Salmonella phoP / phoQ mutant is cultured in LB medium containing ampicillin resistance and shaken on a shaker overnight. After it is expanded to the logarithmic growth phase, the bacterial solution is centrifuged and dispersed in sterile PBS; IR780 and LH430 are then combined using a vortex oscillator, washed twice, resuspended in sterile PBS, and stored in the dark at 4°C to obtain LHPS; and the shPD-L1 plasmid is then transfected into the LHPS to obtain the resulting bacteria, which is named shPD-L1@LHPS.

[0016] Beneficial effects:

[0017] The present invention uses attenuated Salmonella as a carrier to carry small interfering RNA to regulate PD-L1 and HSP90. Based on the shPD-L1@LHPS or shHSP90@LHPS platform for treating malignant solid tumors that combines bacterial therapy, photothermal therapy and immunotherapy, the ΔphoPΔphoQ knockout strain of attenuated Salmonella carries shPD-L1 or shHSP90 and is prepared in combination with the photosensitizer IR780. It can simultaneously exert anti-cancer functions by inhibiting the proliferation of malignant solid tumors and enhancing the body's own anti-malignant solid tumor immune function, and has important clinical significance for the treatment of malignant solid tumors. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 It is the freeze-dried powder form of shPD-L1@LHPS.

[0019] Figure 2 is the PD-L1 protein expression level in cells after plasmid transfection.

[0020] Figure 3 is the PD-L1 protein expression level in cells after plasmid transfection.

[0021] Figure 4 The bacterial morphology of shPD-L1@LHPS bound to different concentrations of IR780 under transmission electron microscopy (Scale bar = 1 μm).

[0022] Figure 5 The colony numbers of LH430 and shPD-L1@LHPS before and after irradiation.

[0023] Figure 6 Bacterial growth curves of LH430 and shPD-L1@LHPS after near-infrared light irradiation.

[0024] Figure 7shPD-L1@LHPS with different concentrations of IR780 ranging from 0 to 200 μg / mL (from left to right).

[0025] Figure 8 The color changes of the solutions of IR780 and shPD-L1@LHPS on day 0 and after standing at 4°C for 14 days.

[0026] Figure 9 UV absorption spectra of LH430, IR780 and shPD-L1@LHPS.

[0027] Figure 10 UV absorption spectra of shPD-L1@LHPS bound to 100, 200, and 400 μg / mL IR780.

[0028] Figure 11 Temperature changes (ΔT) of PBS and shPD-L1@LHPS (IR780 concentration was 25-200 μg / mL) after near-infrared laser irradiation for 300 seconds.

[0029] Figure 12 For shPD-L1@LHPS at 1.1W / cm 2 , photothermal stability under three cycles of 808nm laser irradiation.

[0030] Figure 13 is the photothermal conversion efficiency and linear relationship.

[0031] Figure 14 Photothermal images of shPD-L1@LHPS with IR780 concentrations of 50, 100, and 200 μg / mL under near-infrared laser irradiation for 5 minutes.

[0032] Figure 15 In vitro photoacoustic images of shPD-L1@LHPS at different concentrations.

[0033] Figure 16 The photoacoustic signal is proportional to the IR780 concentration.

[0034] Figure 17 Calcein-AM / PI-stained live cells (green) and dead cells (red) were observed under a fluorescence microscope after 4 hours of incubation. (Scale bar = 200 μm)

[0035] Figure 18 Figure 5 Relative survival rates of B16F10 cells treated with LH430, IR780, LHPS, and shPD-L1@LHPS (irradiated with or without near-infrared laser) after coculture with activated T cells at a T cell to malignant tumor cell ratio of 10:1 and 20:1, respectively.

[0036] Figure 19 To collect the supernatants of B16F10 cells after culturing with LH430, IR780, LHPS, and shPD-L1@LHPS for 4 h, the expression level of TNF-α was detected by ELISA kit after the cells were incubated with the supernatants for 24 h.

[0037] Figure 20 To collect the supernatants of B16F10 cells after culturing with LH430, IR780, LHPS, and shPD-L1@LHPS for 4 h, the expression level of IFN-γ was detected by ELISA kit after the cells were incubated with the supernatants for 24 h.

[0038] Figure 21 The volume changes of in situ malignant melanoma during shPD-L1@LHPS treatment.

[0039] Figure 22 The volume changes of metastatic malignant melanoma during shPD-L1@LHPS treatment.

[0040] Figure 23 The volume changes of in situ breast cancer treated with shHSP90@LHPS.

[0041] Figure 24 The volume changes of metastatic breast cancer during shHSP90@LHPS treatment.

[0042] Figure 25 Photoacoustic images of malignant solid tumors at different times after tail vein injection of shPD-L1@LHPS.

[0043] Figure 26 is the body weight change of mice during the treatment period.

[0044] Figure 27 The hemolysis conditions and quantification graphs of different concentrations of IR780 (top) and shPD-L1@LHPS (bottom).

[0045] Figure 28 CD4 infiltrating malignant solid tumors in mice after treatment + T cells, proportional quantification graph.

[0046] Figure 29 CD8 infiltrating malignant solid tumors after treatment of orthotopic malignant solid tumor model mice + Quantification of T cell proportions.

[0047] Figure 30 This is a quantitative graph showing the proportion of malignant solid tumor-infiltrating NK cells after treatment of mice with orthotopic malignant solid tumor models.

[0048] Figure 31malignant solid tumor infiltrating dendritic cells (CD11c + CD80 + ) proportional quantification diagram.

[0049] Figure 32 malignant solid tumor model mice treated with malignant solid tumor infiltrating dendritic cells (CD11c + CD86 + ) proportional quantification diagram.

[0050] Figure 33 is the secretion level of TNF-α in mouse serum.

[0051] Figure 34 is the secretion level of IFN-γ in mouse serum.

[0052] Figure 35 This is the growth curve of mice in the shPD-L1@LHPS+Laser treatment group.

[0053] Figure 36 Figure 2 is the growth curve of mice in each shHSP90@LHPS+Laser treatment group. DETAILED DESCRIPTION

[0054] The present invention will be further described in detail below by specific examples. However, it will be understood by those skilled in the art that the following examples are merely illustrative of the present invention and should not be construed as limiting the scope of the present invention. In addition, where specific technical operating steps or conditions are not specified in the examples, they are all performed according to the general techniques or conditions described in the literature in this area or according to the product specifications. Reagents or instruments used that do not specify the manufacturer are all conventional products that can be obtained commercially.

[0055] Example 1. Preparation and characterization of shPD-L1@LHPS and shHSP90@LHPS

[0056] In this example, the shPD-L1 and shHSP90 plasmids containing the pLKO.1 backbone were purchased from Saixin Bio. The plasmid contains an ampicillin (Amp) resistance gene to eliminate interference from foreign bacteria. The attenuated Salmonella phoP / phoQ mutant strain was preserved by the Laboratory of Pathology of Jilin University. The nucleotide sequence of shRNA-PD-L1 is: 5'-CCGAAATGATACACAATTCGA-3'; the nucleotide sequence of shRNA-HSP90 is: 5'-UUUAGUACCAGACUUGGCAAUGGUU-3'. Weigh 1 mg of IR780 into an EP tube and dissolve it with 10 μl of DMSO. Then adjust the system to 1 mg / mL with PBS buffer, and then dilute to the corresponding concentration as needed. The attenuated Salmonella phoP / phoQ mutant strain (LH430) was cultured in LB medium containing ampicillin resistance and shaken at 200 rpm on a shaker overnight. After it expanded to the logarithmic growth phase, 1 ml of the bacterial solution was centrifuged at 5000 rpm for 5 minutes and dispersed in 1 ml of sterile PBS. IR780 and LH430 were then mixed in different proportions, combined using a vortex oscillator, washed twice, and resuspended in sterile PBS. It was stored in the dark at 4°C to obtain LH430 combined with IR780, named LHPS (LH represents strain LH430, PS represents photosensitizer). The shPD-L1 plasmid was then transfected into LHPS, and the resulting bacteria were named shPD-L1@LHPS. By knocking down PD-L1, which is expressed in large quantities as the recombinant strain proliferates in the host, the corresponding immune protection effect was induced, and malignant solid tumor tissues were accurately targeted for photothermal therapy of malignant solid tumors. Figure 1 As shown, after freeze-drying, it can be stored long-term as a live bacterial carrier vaccine, exerting anti-cancer effects by simultaneously inhibiting the proliferation of malignant solid tumors and enhancing the body's own anti-malignant solid tumor immunity. The preparation and characterization methods of shHSP90@LHPS are the same as those of shPD-L1@LHPS.

[0057] Example 2: Western blot detection of protein expression levels:

[0058] The shPD-L1 plasmid was transiently transfected into melanoma cells, and the HSP90 plasmid was transiently transfected into breast cancer cells using a transfection reagent to verify whether the constructed plasmids can exert biological effects. Cells were collected 48 hours after transfection, and the cellular protein expression was detected by Western Blot experiment.

[0059] (1) Protein extraction: First, collect the cells after drug treatment and transfer them to EP tubes. Centrifuge (1050 rpm, 5 min) and discard the supernatant. Add RIPA (containing 1% protease inhibitor PMSF) cell lysis buffer to each group of cell pellets for ultrasonic disruption. Continue to lyse on ice for 10 min. Centrifuge again (12000 rpm, 15 min, 4°C). Collect the supernatant and transfer it to a new EP tube. Use the BCA protein quantification kit to determine the protein concentration. After sample preparation, heat in boiling water for 10 min to denature the protein. After cooling, store at -20°C.

[0060] (2) Protein electrophoresis, transfer and development: Cell proteins were separated by polyacrylamide gel electrophoresis (SDS-PAGE), with the upper gel at 75V for 30min and the lower gel at 100V for 50min. After activating the PVDF membrane, place it in order, transfer it at 100V for 60min, then remove the PVDF membrane and incubate it in 10% skim milk on a shaker at room temperature for 1h. Cut the target protein according to its molecular weight, incubate with the primary antibody at 4℃ overnight, and incubate with the secondary antibody for 1h the next day. Wash the membrane three times with TBST and then expose and develop it with ECL developer (A solution: B solution = 1:1). Use Image J software to measure the grayscale value of the bands and use Graphpad Prism software for statistical analysis. See Figure 2 and 3 It can be seen that compared with the control group, the expression of PD-L1 in B16 cells in the transfection group decreased by more than 70%, indicating that the plasmid can successfully exert its biological effect.

[0061] Example 3, bacterial activity analysis:

[0062] Transmission electron microscopy images are shown in Figure 4 The LH430 bacteria themselves are rod-shaped, and their basic morphology does not change after being combined with different concentrations of IR780, indicating that the modification does not affect the overall morphology of the attenuated Salmonella. The effects of LH430 and shPD-L1@LHPS bacterial suspension materials before and after synthesis, and with and without near-infrared laser irradiation treatment on bacterial viability were tested. They were inoculated into solid LB medium and cultured overnight in a 37°C incubator for 12-14 hours. The colonies grown on the plates were counted the next day. Figure 5 , there was no difference in bacterial concentration. Bacteria were cultured in liquid culture medium and placed in a shaker at 37°C at a constant 200 rpm. The OD value was measured every hour until the bacterial growth reached the plateau phase after about 14 hours. The growth curve was drawn. Figure 6 The bacterial concentration remained basically consistent at each hour, indicating that the combination of IR780 and shPD-L1 plasmid had lower toxicity to the attenuated Salmonella strain, and light would not affect the morphology and vitality of the bacteria.

[0063] Example 4. Absorbance Characterization of shPD-L1@LHPS:

[0064] IR780 is a molecule with strong light absorption and emission in the near-infrared region. Adjusting the concentration of IR780 binding results in different shades of green for sh PD-L1@LHPS. Figure 7 The concentrations of IR780 are 0, 25, 50, 100, and 200 μg / mL, respectively, according to the color from light to dark. The material was placed in a dark place at 4°C. After 14 days, the color of IR780 became lighter. Figure 8 , indicating that IR780 has been degraded and inactivated, while shPD-L1@LHPS still maintains a color similar to that of the initial synthesis, indicating that the binding has improved the stability of IR780 and slowed down its clearance rate. The absorbance of different solutions of shPD-L1@LHPS at wavelengths of 550-950nm was measured using a UV spectrophotometer. Figure 9 It was found that compared with the IR780 group, the UV absorption peak of shPD-L1@LHPS showed a red shift, and as the concentration of attenuated Salmonella combined with IR780 increased, the UV absorption peak of shPD-L1@LHPS gradually increased. Figure 10 , indicating that the attenuated Salmonella was successfully coupled with IR780.

[0065] Example 5: Analysis of the photothermal performance of shPD-L1@LHPS in vitro:

[0066] By changing the concentration of IR780, 0, 25, 50, 100, and 200 μg / mL were combined with attenuated Salmonella, and characterized by NIR laser irradiation for 300 seconds. The temperature rise was recorded every 30 seconds using an infrared thermal imager, and the temperature change was reflected by selecting a photothermal image every 1 minute. The photothermal stability of shPD-L1@LHPS was verified by repeated heating and cooling cycles, and the photothermal conversion efficiency was calculated based on the temperature change over time. 2 Subsequent studies using near-infrared laser irradiation at 808 nm and high power density demonstrated that the photothermal effect could be achieved without damaging normal tissues. As the concentration of IR780 increased from 25 μg / mL to 200 μg / mL, the temperature of shPD-L1@LHPS increased rapidly, and the ΔT increased in a concentration-dependent manner. Figure 11 When the concentration of IR780 was 200 μg / mL, the temperature variation range could rise by 37.8°C and leveled off after about 300 s. Under laser irradiation, shPD-L1@LHPS showed negligible degradation after three heating and cooling cycles, showing good thermal and photostability. Figure 12According to the temperature change, it can be calculated that its light-to-heat conversion efficiency is as high as 71.4%, see Figure 13 The infrared thermal imager clearly and intuitively shows that as the concentration of IR780 increases, the temperature of the solution increases significantly and gradually increases in a time-dependent manner. Figure 14 To evaluate the performance of photoacoustic imaging, the Vevo LAZR system (Vevo 2100, FUJIFILM VisualSonics, Canada) was used to test the photoacoustic signal and its linear relationship for different concentrations of shPD-L1@LHPS. Figure 15 , near-infrared light irradiation of shPD-L1@LHPS produced a photoacoustic signal. In the shPD-L1@LHPS concentration range of 0-200μg / mL, the PA intensity increased with the increase of concentration in a linear relationship. The results are shown in Figure 16 Therefore, sh PD-L1@LHPS can be used as a PA imaging agent to guide the irradiation location and time, thereby greatly improving the accuracy of PTT and clinical diagnosis.

[0067] Example 6: Live / dead staining kit for detecting cell death:

[0068] B16F10 cells were cultured in 12-well plates and treated with LH430, IR780, LHPS, and shPD-L1@LHPS for 4 hours using a live / dead staining kit. They were then irradiated with or without NIR laser for 5 minutes. Calcein-AM (green) represents live cells, and PI (red) represents dead cells. Cell death was observed using the [NIR laser irradiation kit]. Figure 17 , IR780+Laser and LHPS+Laser treatment groups had a killing effect on cells. On this basis, the killing effect of the shPD-L1@LHPS+Laser treatment group on B16 was significantly enhanced, proving that shPD-L1@LHPS combined with photothermal effect synergistically promoted the anti-cancer effect.

[0069] Example 7: Co-culture simulates in vivo tumor suppression and immune effect activation:

[0070] Splenocytes were isolated from mouse spleens, and CD3+ T cells were sorted by magnetic bead adsorption using the MojoSort™ Mouse CD3 T Cell Isolation Kit (Cat No. 480023, Biolegend, USA). The isolated T cells were plated in 12-well plates and activated with antibodies against CD3 (Cat No. 100340, Biolegend, USA) and CD28 (Cat No. 102116, Biolegend, USA). The cells were then expanded for 72 hours in RPMI medium supplemented with 10% FBS and 100 IU / mL IL-2 (Cat No. HZ-1015, Proteintech, USA). T cells were co-cultured with malignant melanoma cells and treated with LH430, IR780, LHPS, and shPD-L1@LHPS for 4 hours, followed by 5 minutes of NIR laser irradiation with or without NIR laser. After washing with sterile PBS, add CCK-8 solution and culture in a 37°C incubator for 1-2 hours. Measure the absorbance at 450 nm to detect the inhibitory effect on cell viability. Figure 18 The cell viability in the treatment group was significantly inhibited. The IR780+Laser group was not affected by the number of co-cultured T cells. However, the LHPS+Laser and shPD-L1@LHPS+Laser groups showed an increased ratio of T cells to melanoma cells. Compared with the LHPS+Laser group, the shPD-L1@LHPS+Laser group showed a more pronounced killing effect. The expression levels of TNF-α and IFN-γ in the cell supernatant were determined using enzyme-linked immunosorbent assay kits. Figure 19 and 20 Compared with the LH430 group, shPD-L1@LHPS+Laser can significantly promote the increase in the levels of melanoma necrosis factor TNF-α and interferon IFN-γ after laser irradiation, indicating that under NIR radiation, PTT and PDT-mediated shPD-L1@LHPS can effectively kill melanoma cells in a short time and may even enhance the body's immune response to melanoma.

[0071] Example 8: In vivo induction of bilateral malignant melanoma and breast cancer in mice for cancer treatment:

[0072] Malignant melanoma B16F10 and breast cancer 4T1 cell models were established. Mouse cells suspended in PBS were inoculated into the right flank of C57BL / 6 mice, with 5×10 5 To establish an orthotopic malignant melanoma / breast cancer model, 2×10 cells were inoculated on the left side of each mouse. 5Seven days later, the mice were injected with 100 μl of sterile PBS containing LH430 via the tail vein. The bacterial concentration was 10 6 CFU / mL. On the third day of treatment, NIR laser irradiation was performed for 5 min or not, and a second treatment was given on the fourth day. The weight change, melanoma volume and survival time of mice were monitored daily. Figure 21 and 22 The LH430, IR780+Laser, LHPS+Laser, and shPD-L1@LHPS groups all exhibited a certain degree of inhibitory effect on melanoma tissue. The inhibitory effects of the shPD-L1@LHPS and LH430 groups were similar, while the shPD-L1@LHPS group was equivalent to no effect of IR780. In contrast, the shPD-L1@LHPS+Laser group showed the most significant suppression of melanoma volume, demonstrating that the addition of IR780 promoted the inhibitory effect of the combined shPD-L1 and LH430 groups, and that shPD-L1@LHPS had a more pronounced killing effect on melanoma tissue after laser irradiation. In addition, compared with the control group, although the metastatic melanoma was not irradiated by laser, its volume was also partially suppressed. Compared with the IR780 group, the attenuated Salmonella groups (LH430, LHPS+Laser group, shPD-L1@LHPS treatment group) had a slightly better tumor suppression effect, and the shPD-L1@LHPS+Laser group had a more significant inhibitory effect, proving that the photothermal effect of attenuated Salmonella carrying shPD-L1 plasmid can play a good therapeutic role. The shRNA-HSP90 carried by attenuated Salmonella was constructed and its effect on inhibiting breast cancer was verified. The results are shown in the figure. Figure 23 and 24 , the breast cancer volume of the shHSP90@LHPS+Laser group was also suppressed, and the killing effect on breast cancer tissue was also enhanced after laser irradiation. The shHSP90@LHPS group had a weaker inhibitory effect on breast cancer than the LH430 group, that is, the combination of shHSP90 and LH430 did not increase the inhibitory effect together, but shHSP90 reduced the inhibitory effect of LH430. In contrast, the melanoma volume of the shHSP90@LHPS+Laser group was most significantly suppressed, proving that the addition of IR780 promoted the inhibitory effect after the combination of shHSP90 and LH430. Tumor-bearing mice were intravenously injected with shPD-L1@LHPS solution, and then the PA signal of the melanoma was observed under a multispectral tomography instrument. Figure 25The injection time was recorded at 30 minutes, 1 hour, 2 hours, 4 hours, 8 hours, and 10 hours. The photoacoustic signal appeared 30 minutes after administration, reached its peak at 8 hours, and maintained a good aggregation effect for 10 hours, indicating that the attenuated Salmonella can target and accumulate at the site of malignant tumors and exert a good inhibitory effect on malignant tumors.

[0073] Example 9, Biosafety Evaluation:

[0074] The body weight of mice was recorded during the administration period, and there was no significant difference between the groups. Figure 26 . The hemolysis experiment found that when H2O was used as a positive control and PBS as a negative control, the supernatant of IR780 in the low-dose range (including the dose used in the experimental group) was colorless and clear, and no hemolysis occurred. However, hemolysis occurred when the IR780 concentration reached 400μg / mL. However, when a high dose (400μg / mL) of IR780 was combined with attenuated Salmonella, hemolysis did not occur, and only slight hemolysis occurred at 800μg / mL. The above results show that shPD-L1@LHPS can significantly reduce toxicity and ensure its safety and effectiveness within the dosage. The results are shown in Figure 27 .

[0075] Example 10: In vivo immune response in an orthotopic malignant melanoma / breast cancer model

[0076] Malignant melanoma / breast cancer cells were isolated from mice and ground through a filter to obtain a single-cell suspension. Red blood cells were removed and the cells were first labeled with CD16 / CD32 antibodies to reduce nonspecific staining during fluorescent antibody staining. Subsequently, to detect anti-tumor immune responses in mouse malignant melanoma / breast cancer cells and spleens, the cells were stained with fluorescently labeled antibodies labeled with CD3-APC, CD4-PE, CD8-FITC, and NK1.1-PE. To examine dendritic cell maturation, the right axillary lymph nodes of treated mice were collected and stained with fluorescent antibodies labeled with CD11c-PE, CD80-FITC, and CD86-APC. The results were analyzed by flow cytometry. Figure 28 and 29 Compared with the control group, the LH430 group, LHPS+Laser group, shPD-L1@LHPS group, and shPD-L1@LHPS+Laser group promoted the increase of CD4 and CD8 T lymphocyte populations and NK cell infiltration levels in melanoma tissues. LH430 carrying small nucleic acid drugs could not promote the increase of CD4 and CD8 T lymphocyte populations and NK cell infiltration levels in melanoma tissues, and even reduced them. However, the addition of PS+Laser improved the therapeutic effect of LH43 carrying small nucleic acid drugs to the best. CD80 and CD86 expression also increased. Figure 31 and32 , indicating that attenuated Salmonella can target melanoma tissue and transform it from a "cold" melanoma to a "hot" state, and induce T lymphocyte activation and dendritic cell maturation in the body, thereby gathering at the melanoma site.

[0077] On the tenth day, the serum of mice after different treatments was sampled and diluted five times. The expression levels of TNF-α and IFN-γ in the serum were determined by enzyme-linked immunosorbent assay. The levels of cytokines in the serum of mice were detected by ELISA. The results are shown in Figure 33 and 34 In the attenuated Salmonella treatment group, the levels of melanoma necrosis factor TNF-α and interferon IFN-γ were higher than those in the control group, and further increased with NIR laser treatment, indicating that the immune function was significantly enhanced after combined treatment.

[0078] After the subcutaneous model was established in mice, the mice were treated and the survival rate was recorded and the survival curve was drawn. Figure 35 All mice in the control group died on the 17th day. In contrast, the median survival of mice in the shPD-L1@LHPS+Laser treatment group was significantly prolonged to the 32nd day. In addition, compared with the control group, the median survival of mice in the shHSP90@LHPS+Laser treatment group was prolonged to the 29th day. Figure 36 .

[0079] In summary, using attenuated Salmonella as a vector to carry small interfering RNA to regulate PD-L1 and HSP90 not only leverages the bacteria's inherent immunogenicity to mobilize the body's immune system and promote immune responses, but also leverages the bacteria's hypoxia-targeting properties to increase tumor penetration and the response rate of immune checkpoint blockade, inhibiting PD-L1 and HSP90 on the surface of malignant tumor cells and thereby limiting immune escape caused by malignant tumor cells. Compared to expensive antibody-based drugs, Salmonella is easy to reproduce, which reduces costs and significantly alleviates the financial burden on patients.

[0080] Attenuated Salmonella was combined with the photosensitizer IR780 for synergistic treatment with PTT and immunotherapy. Through covalent bonding, the attenuated Salmonella carried IR780 to target malignant solid tumors, transforming the local malignant solid tumor microenvironment into a "hot" state. Near-infrared lasers were then used to activate shPD-L1@LHPS and shHSP90@LHPS+Las, promoting effective and long-lasting anti-malignant solid tumor immune responses against local and distant malignant solid tumors. This significantly improved the solubility of IR780 and prolonged its retention time at the malignant solid tumor site, suppressing its acute toxicity. The photothermal damage induced by PTT and the oxidative stress damage caused by PDT resulted in a rapid ablation of malignant solid tumor cells in the animals. Subsequently, the immune system was affected by the bacterial innate immunity, triggering subsequent NIR laser-induced exposure to malignant solid tumor antigens to transform the immunosuppressive malignant solid tumor environment. The use of shPD-L1@LHPS and shHSP90@LHPS+Las for the treatment of malignant solid tumors is a platform that combines bacterial therapy, photothermal therapy and immunotherapy. It is prepared by attenuating the Salmonella ΔphoPΔphoQ mutant strain carrying small interfering RNA shPD-L1 and shHSP90, combined with the photosensitizer IR780. It can simultaneously exert anti-cancer functions by inhibiting the proliferation of malignant solid tumors and enhancing the body's own anti-malignant solid tumor immune function, and has important clinical significance for the treatment of malignant solid tumors.

Claims

1. A drug delivery system for treating malignant solid tumors based on attenuated Salmonella, characterized by: The drug delivery system uses attenuated Salmonella as a carrier to carry small nucleic acid drugs, and the attenuated Salmonella is loaded with a photosensitizer; The small nucleic acid drug is a small interfering RNA plasmid that inhibits the expression of PD-L1 or HSP90 genes; The malignant solid tumor is melanoma or breast cancer; The photosensitizer is IR780; The preparation method of the drug delivery system is as follows: Dissolve the photosensitizer in DMSO and dilute to a concentration of 25-200 μg / mL; The attenuated Salmonella phoP / phoQ mutant was cultured in LB medium containing ampicillin resistance and shaken overnight. After it expanded to the logarithmic growth phase, the bacterial solution was centrifuged and dispersed in sterile PBS. Subsequently, the photosensitizer and the attenuated Salmonella phoP / phoQ mutant were combined using a vortex shaker, washed twice, resuspended in sterile PBS, and stored at 4°C in the dark to obtain the attenuated Salmonella phoP / phoQ mutant combined with IR780; The small nucleic acid drug was then transfected into the attenuated Salmonella phoP / phoQ mutant strain that was conjugated with IR780; The 5' to 3' end of the nucleotide sequence of the small interfering RNA that inhibits PD-L1 gene expression is CCGAAATGATACACAATTCGA; The nucleotide sequence of the small interfering RNA that inhibits HSP90 gene expression is from 5' to 3' end. UUUAGUACCAGACUUGGCAAUGGUU.

2. A drug for treating malignant solid tumors, characterized in that: The active ingredient of the medicine includes the attenuated Salmonella-based drug delivery system for treating malignant solid tumors as claimed in claim 1.

Images