Application of PEX16 gene in regulating plant resistance to viruses and transgenic plant breeding methods

Abstract

The present invention discloses an application of a PEX16 gene in regulating plant resistance to viruses and a transgenic plant cultivation method, wherein the virus is cucumber green mottle mosaic virus, the transcript sequence of the PEX16 gene is shown in SEQ ID NO: 1, and the plant is Nicotiana benthamiana. The Nicotiana benthamiana pex16 gene mutant plant obtained by mutating the PEX16 gene by using CRISPR / Cas9 technology can significantly inhibit the infection of cucumber green mottle mosaic virus.

Description

Technical Field

[0001] The present invention relates to the technical field of genetic engineering, and in particular to the application of PEX16 gene in regulating plant resistance to viruses and a method for cultivating transgenic plants. Background Art

[0002] Cucumber green mottle mosaic virus (CGMMV) belongs to the genus Tobamovirus of the family Virgaviridae. It can infect Cucurbitaceae crops such as cucumber, gourd, melon, and watermelon, causing plant growth retardation, leaf chlorosis and mottled, fruit discoloration and fibrosis, leading to serious losses. It is an important plant quarantine pest in my country.

[0003] At present, the prevention and control of CGMMV is a global problem in Cucurbitaceae crops, and there is no effective chemical agent to prevent and control CGMMV. The harm of CGMMV can be alleviated to a certain extent through traditional methods, such as seed disinfection, cultivating strong plants through improved cultivation techniques, timely eradication of diseased plants in the field, using disease-resistant varieties, and using pesticides to cut off the virus transmission vector. However, at this stage, no agents with control effects on CGMMV have been developed, and studies have shown that seed treatment measures are inefficient and unstable, affecting seed germination rate. In addition, grafting technology has always been a commonly used agricultural operation technology in the production of Cucurbitaceae crops, and it is also one of the powerful measures to prevent and control diseases and pests. However, some studies have shown that CGMMV can be transported from watermelon rootstocks to their scions, making CGMMV potentially the source of primary infection in the field through grafting. Although the resistance signals of different hosts and the pathogen infection mechanisms are diverse and complex, the cultivation of resistant plants mediated by transgenics based on endogenous genes and exogenous genes is still one of the most effective ways.

[0004] Since no pesticides that effectively inhibit plant virus infection have been developed at this stage, achieving crop resistance to viruses through the expression of resistance-related genes or the knockout of susceptible genes has important application prospects. Given that plant viruses rely on a large number of host factors for reproduction, using the key susceptible factors required by plant viruses in the host to resist viruses is one of the best prevention and control methods. Peroxisomes can communicate and maintain functions through direct interactions with other organelles or cell contents such as mitochondria, endoplasmic reticulum, lysosomes and lipid droplets. Peroxisomes can provide different physiological and biochemical reactions for different cells in the catabolic and anabolic pathways, and can respond to external stimuli by regulating the morphology of peroxisomes themselves and changes in their related metabolism. Plant peroxisomes play an important role in the replication and reproduction of plant viruses, and different plant viruses regulate the metabolism and morphology of peroxisomes for infection.

[0005] The present study found that the peroxisome-related gene PEX16 is involved in the replication and pathogenicity of CGMMV, but PEX16 is not a necessary gene for plants, indicating that PEX16 is an important plant susceptibility gene that can be manipulated. Therefore, based on this mechanism, it is of great value to knock out PEX16 in plants through gene editing to achieve effective resistance to CGMMV. Summary of the invention

[0006] The first object of the present invention is to provide an application of a PEX16 gene in regulating plant antiviral activity.

[0007] The second object of the present invention is to provide a method for cultivating a transgenic plant with a PEX16 gene knockout.

[0008] The present invention utilizes the principle of disease resistance in plant immune response and finds that the ALKBH9B gene in Nicotiana benthamiana is a disease-susceptible gene. Through the method of Agrobacterium transformation, the CRISPR vector carrying the ALKBH9B target is introduced into the target plant, and the obtained Nicotiana benthamiana ALKBH9B gene knockout plant can significantly reduce the infection of TuMV and effectively control the harm of the virus.

[0009] To achieve the above purpose, the technical solution adopted by the present invention is as follows:

[0010] The invention discloses an application of the PEX16 gene in regulating plant resistance to viruses, wherein the virus is cucumber green mottle mosaic virus and the plant is Nicotiana benthamiana; the transcript sequence of the PEX16 gene is shown in SEQ ID NO: 1, and the PEX16 gene is mutated to resist infection by the cucumber green mottle mosaic virus.

[0011] A method for cultivating a PEX16 transgenic plant resistant to cucumber green mottle mosaic virus, and a Nicotiana benthamiana PEX16 knockout transgenic plant obtained by CRISPR / Cas9 technology.

[0012] The specific steps include:

[0013] (1) The potential CRISPR / Cas9 editing sites in PEX16 were analyzed by using the CRISPR / Cas9 editing site prediction website https: / / crispr.cos.uni-heidelberg.de / , and the target site sequences T24 and T29 were selected. The sequences are shown in SEQ ID NOs: 8-9, and the primers CAS-PEX16-T24-F, CAS-PEX16-T24-R, CAS-PEX16-T29-F, and CAS-PEX16-T29-R for constructing the vector; the primer sequences are shown in SEQ ID NOs: 2-5;

[0014] CAS-PEX16-T24-F: TGATTGTCGGAATTCATGTCCAAATG

[0015] CAS-PEX16-T24-R:AAACATTTGGACATGAATTCCGACA

[0016] CAS-PEX16-T29-F:TGATTGATCAGCAGTTGAAGACAAGT

[0017] CAS-PEX16-T29-R:AAACACTTGTCTTCAACTGCTGATCA;

[0018] (2) synthesizing the double-stranded CAS-PEX16-T24 / T29 and then constructing it into a CRISPR vector containing a 35S promoter expressing Cas9 through restriction digestion and ligation to obtain the CAS-PEX16 vector;

[0019] (3) The CAS-PEX16 vector was transferred into Agrobacterium and then infected into tobacco for genetic transformation of tobacco to obtain the T0 generation of PEX16 gene mutant plants, and the DNA of the mutant plant leaves was extracted by CTAB method;

[0020] (4) Performing PCR amplification and sequencing with the extracted DNA template to determine the mutation status of the mutant; the detection primer sequences used are shown in SEQ ID NO.6-7;

[0021] pex16-detect-F:ATGCATAGGAGCCAACTATTGATTCTT

[0022] pex16-detect-R:GGAAGAAGAGTCTAAGTCTTGCTGCTG;

[0023] (5) The identified homozygous mutants were kept as seeds and sown together with wild-type Nicotiana benthamiana. Twenty days after sowing, CGMMV was inoculated to observe viral symptoms and analyze the amount of viral accumulation.

[0024] Compared with the prior art, the outstanding effects of the present invention are:

[0025] The present invention discovered that the plant host factor PEX16 mutant can significantly inhibit the infection of cucumber green mottle mosaic virus CGMMV, which is of great significance for the prevention and control of CGMMV and also provides a reference for the cause of virus prevention and control.

[0026] The present invention successfully knocked out PEX16 in Nicotiana benthamiana, and found that after knocking out this gene, the plant gained the function of resisting cucumber green mottle mosaic virus. Through CRISPR / Cas9 technology, the obtained Nicotiana benthamiana PEX16 knocked out transgenic plants were identified to hinder the infection of cucumber green mottle mosaic virus, which has important production significance.

[0027] The application of the PEX16 gene in regulating plant antiviral properties and the method for cultivating transgenic plants according to the present invention will be further described below in conjunction with the accompanying drawings and specific examples. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 is the CRISPR / Cas9 editing site sequence of PEX16, and T24 and T29 are two different selected PEX16 edited sequences.

[0029] Figure 2 Identification of CAS-PEX16 knockout transgenic plants. (A) Comparison of T0 generation sequencing results, where base 104 of T24 is missing and bases 140, 146, and 147 of T29 are replaced. (B) Phenotypic comparison of T1 generation CAS-PEX16 transgenic plants and wild-type Nicotiana benthamiana, wt is wild-type Nicotiana benthamiana, and there is no difference in phenotype between transgenic plants and wild-type Nicotiana benthamiana. (C) PCR detection of Cas9 and PEX16 in DNA of transgenic CAS-PEX16-T24 / T29 plants and wild-type Nicotiana benthamiana.

[0030] Figure 3This is an analysis of the resistance of CAS-PEX16-T24 / T29 transgenic plants to cucumber green mottle mosaic virus (CGMMV). (A) Symptoms of wild-type Nicotiana benthamiana and CAS-PEX16 transgenic Nicotiana benthamiana strains CAS-PEX16-T24 / T29 14 days after inoculation with Agrobacterium tumefaciens. The virus symptoms of wild-type Nicotiana benthamiana are more severe; (B) RT-qPCR analysis of the RNA accumulation of CGMMV in plants in (A) at 14 days, the results show that CAS-PEX16 transgenic plants can significantly reduce the RNA accumulation of CGMMV. DETAILED DESCRIPTION

[0031] A method for cultivating a CAS-PEX16 transgenic knockout plant resistant to cucumber green mottle mosaic virus, specifically comprising the following steps:

[0032] (1) The potential CRISPR / Cas9 editing sites in PEX16 were analyzed using the CRISPR / Cas9 editing site prediction website (https: / / crispr.cos.uni-heidelberg.de / ), and the target site sequences T24 and T29 were selected. The sequences are shown in SEQ ID NOs: 8-9, and the primer sequences for constructing the vector are shown in SEQ ID NOs: 2-5;

[0033] CAS-PEX16-T24-F: TGATTG TCGGAATTCATGTCCAAATG

[0034] CAS-PEX16-T24-R:AAAC CATTTGGACATGAATTCCGA CA

[0035] CAS-PEX16-T24-F: TGATTG ATCAGCAGTTGAAGACAAGT

[0036] CAS-PEX16-T24-R:AAACACTTGTCTTCAACTGCTGATCA

[0037] (2) Anneal the CAS-PEX16-T24 / T29 primers at high temperature to form a double strand to obtain an insert sequence. The insert sequence and the CRISPR vector containing the 35S promoter expressing Cas9 were digested with Eco31I, and the recovered product was ligated with T4 ligase. The 10 μL system was ligated with Thermo T4 ligase at 22°C for 15-30 minutes. After the reaction was completed, Escherichia coli was transformed. The vector was Kan-resistant. On the second day, a single colony was picked and shaken for sequencing. The sequencing result contained the target sequence and was positive, that is, the CAS-PEX16 vector was obtained.

[0038] (3) After the CAS-PEX16 vector is transferred into Agrobacterium, the Agrobacterium carrying the recombinant plasmid is used to infect tobacco leaves, callus tissue is obtained through differentiation culture, and then seedlings are obtained through rooting culture, which are then transferred for further culture;

[0039] (4) After the T0 generation seedlings continue to grow stably, leaf samples are taken, DNA is extracted from the plant leaves using the CTAB method, and PCR amplification is performed using the extracted DNA as a template to determine whether CAS-PEX16 has been successfully transformed; the sequencing results are as follows Figure 2 As shown in A, the amplification results are Figure 2 C. The primer sequences used are shown in SEQ ID NO: 6-7.

[0040] pex16-detect-F:ATGCATAGGAGCCAACTATTGATTCTT

[0041] pex16-detect-R:GGAAGAAGAGTCTAAGTCTTGCTGCTG

[0042] (5) The identified homozygous mutants were kept as seeds and sown together with wild-type Nicotiana benthamiana. The T1 generation showed no significant difference from the wild-type Nicotiana benthamiana. Figure 2 As shown in B. 20 days after sowing, CGMMV was inoculated, and 14 days after inoculation, the virus symptoms were observed and the virus accumulation was analyzed. Figure 3 As shown in A, compared with wild-type N. benthamiana, the two strains of CAS-PEX16 transgenic plants showed milder viral symptoms. qRT-PCR was used to detect the accumulation of viral RNA in the leaves. The accumulation of viral RNA in the two transgenic strains was significantly lower than that in the wild-type N. benthamiana. Figure 3 As shown in B.

[0043] The experimental results show that the Nicotiana benthamiana pex16 gene mutant plants obtained by mutating the PEX16 gene through CRISPR / Cas9 technology can significantly inhibit the infection of cucumber green mottle mosaic virus and reduce the damage caused by cucumber green mottle mosaic virus.

[0044] The embodiments described above are merely descriptions of preferred implementation modes of the present invention and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope determined by the claims of the present invention.

Claims

1. PEX16 The application of genes in regulating plant resistance to viruses is characterized by: The virus is cucumber green mottle mosaic virus, and the plant is Nicotiana benthamiana; PEX16 The transcript sequence of the gene is shown in SEQ ID NO: 1, and the regulation is performed by knocking out PEX16 Genes make Nicotiana benthamiana resistant to infection by cucumber green mottle mosaic virus.

2. according to claim 1 PEX16 The application of genes in regulating plant resistance to viruses is characterized by: The transgenic plants of Nicotiana benthamiana with PEX16 knockout obtained by CRISPR / Cas9 technology inhibit the infection of cucumber green mottle mosaic virus.

3. A method for resisting cucumber green mottle mosaic virus PEX16 A method for cultivating transgenic plants, characterized in that: Nicotiana benthamiana knockout obtained by CRISPR / Cas9 technology PEX16 Transgenic plant; PEX16 The transcript sequence of the gene is shown in SEQ ID NO: 1; The following steps are involved: (1) Analysis through CRISPR / Cas9 editing site prediction website https: / / crispr.cos.uni-heidelberg.de / PEX16 The potential CRISPR / Cas9 editing sites in the vector were selected, and the target site sequences T24 and T29 were selected, and the sequences were shown in SEQ ID NOs: 8-9. The primers CAS-PEX16-T24-F, CAS-PEX16-T24-R, CAS-PEX16-T29-F, and CAS-PEX16-T29-R for constructing the vector were shown in SEQ ID NOs: 2-5. CAS-PEX16-T24-F:TGATTGTCGGAATTCATGTCCAAATG CAS-PEX16-T24-R:AAACATTTGGACATGAATTCCGACA CAS- PEX16-T29-F: TGATTGATCAGCAGTTGAAGACAAGT CAS-PEX16-T29-R:AAACACTTGTCTTCAACTGCTGATCA; (2) The CAS-PEX16-T24 / T29 was synthesized into a double-stranded construct and then linked to a CRISPR vector containing a 35S promoter expressing Cas9 to obtain a CAS-PEX16 vector; (3) The CAS-PEX16 vector was transferred into Agrobacterium and then infected into tobacco for genetic transformation. The T0 generation of PEX16 gene mutant plants was obtained and the DNA of the mutant plant leaves was extracted using the CTAB method. (4) Perform PCR amplification and sequencing using the extracted DNA template to determine the mutation status of the mutant; (5) The identified homozygous mutants were kept as seeds and sown together with wild-type Nicotiana benthamiana. Twenty days after sowing, CGMMV was inoculated to observe viral symptoms and analyze the amount of viral accumulation.

4. according to claim 3 PEX16 A method for cultivating transgenic plants, characterized in that: In the step (4), the detection primer sequences used are shown in SEQ ID NO.6-7; pex16 -detect-F:ATGCATAGGAGCCAACTATTGATTCTT pex16 -detect-R:GGAAGAAGAGTCTAAGTCTTGCTGCTG。

Images