A preparation method and application of recombinant full-length type III humanized collagen

Abstract

The present invention provides a preparation method and application of recombinant full-length type III humanized collagen, and relates to the technical field of genetic engineering and protein engineering. The present invention optimizes the codon sequence of human type III collagen α1 chain mature peptide amino acid full-length sequence through genetic engineering and synthesizes the expression vector, and then transfers it into HEK293F host cells for recombinant expression to obtain a secretory high-expression strain or cell line, and the product is purified to obtain recombinant full-length type III humanized collagen. The present invention successfully achieves the efficient preparation of recombinant full-length type III humanized collagen through synthetic biology engineering strategies, and significantly improves the expression level of collagen in HEK293F cells through codon optimization and recombinant vector design; the obtained recombinant collagen has wide application potential in repair and regenerative medicine, medical cosmetic filling materials, and functional cosmetic materials.

Description

Technical Field

[0001] The present invention relates to the technical field of gene engineering and protein engineering, and in particular to a preparation method and application of recombinant full-length type III humanized collagen. Background Art

[0002] Collagen is the most abundant functional protein in the human body. With its unique triple helix structure, it is woven into a solid fiber or mesh structure, and plays a pivotal role in physiological functions. Collagen is widely distributed in various tissues such as skin, bones and ligaments, and is essential for ensuring the stability of various tissues and organs and the normal functioning of their structures. With the advancement of synthetic biology technology, recombinant humanized collagen has been widely integrated into the research and development and application of medical materials, medical cosmetic surgery and cosmetic formulations, greatly broadening its scope of use in the fields of medicine, health and beauty.

[0003] At present, there are two main sources of collagen: one is derived from animal tissues, such as cattle, pigs, chickens and fish, and is obtained through a specific extraction process; the other is recombinant collagen prepared by bioengineering techniques, such as genetic engineering, biological fermentation, and protein purification technology. The practice of extracting collagen from animal tissues is inevitably accompanied by potential immune risks, such as the possibility of carrying animal-derived infectious diseases such as mad cow disease, which poses a threat to human health. There are certain differences in the amino acid sequence between animal-derived collagen and human collagen, resulting in unsatisfactory biological activity, stability and safety, and functional performance cannot meet actual needs. Recombinant humanized collagen can ensure the amino acid sequence of fully humanized collagen, but due to its technical limitations, the actual production process has low yields and high production costs, which affects its wide application. Therefore, the development of high-expression, low-cost recombinant humanized collagen has become a technology that needs to be urgently solved. Summary of the invention

[0004] In view of this, the purpose of the present invention is to provide a method for preparing a recombinant full-length type III humanized collagen and its application, and to achieve efficient preparation of the recombinant full-length type III humanized collagen by codon optimization of the amino acid sequence of the mature peptide of the α1 chain of human type III collagen and recombinant vector design.

[0005] In order to solve the above technical problems, the present invention provides the following technical solutions:

[0006] The present invention provides a method for preparing recombinant full-length type III humanized collagen, the preparation method comprising the following steps:

[0007] S1. Select the amino acid sequence of the mature peptide of human type III collagen α1 chain, design and synthesize an optimized genetic engineering codon sequence;

[0008] S2, connecting the optimized gene sequence with the vector fragment containing the human albumin secretion signal peptide to construct the recombinant vector pHumanIIIC;

[0009] S3. Linearize the recombinant vector pHumanIIIC, transfect into HEK293F cells, screen, culture, induce expression, and purify to obtain recombinant full-length humanized type III collagen.

[0010] Preferably, the amino acid sequence of the human type III collagen α1 chain mature peptide is shown as SEQ ID NO.1, and the gene sequence is shown as SEQ ID NO.2.

[0011] Preferably, the amino acid sequence of the human albumin secretion signal peptide is shown as SEQ ID NO.3, and the nucleotide sequence is shown as SEQ ID NO.4.

[0012] Amino acid sequence of human albumin secretion signal peptide (SEQ ID NO.3):

[0013] MKWVTFISLLFLFSSAYS

[0014] Nucleotide sequence of human albumin secretion signal peptide (SEQ ID NO.4):

[0015] atgaagtgggtgaccttcatcagcctgctgttcctgttcagcagcgcctactct

[0016] Preferably, the recombinant vector pHumanIIIC comprises a puromycin resistance element, a DHFR element, a CMV promoter and an enhancer.

[0017] Preferably, the nucleotide sequence of the puromycin resistance element is shown in SEQ ID NO.6, the nucleotide sequence of the DHFR element is shown in SEQ ID NO.7, the nucleotide sequence of the CMV promoter is shown in SEQ ID NO.8, and the nucleotide sequence of the enhancer is shown in SEQ ID NO.9.

[0018] Preferably, the nucleotide sequence of the recombinant vector pHumanIIIC is shown as SEQ ID NO.5.

[0019] The present invention also provides application of the above preparation method in engineering preparation of recombinant full-length type III humanized collagen.

[0020] Beneficial effects of the present invention:

[0021] The present invention successfully achieves the efficient preparation of recombinant full-length type III humanized collagen through synthetic biology engineering strategy. Compared with the prior art, the present invention significantly improves the expression level of type III collagen in HEK293F cells by codon-optimizing the amino acid sequence of the α1 chain mature peptide of human type III collagen and designing a recombinant vector, providing a new strategy for the large-scale production of recombinant collagen; and the obtained recombinant collagen has broad application prospects in repair and regenerative medicine, medical cosmetic filling materials, and functional cosmetic materials. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 This is a graph showing the results of analyzing the optimized sequence in Example 1 using the codon usage frequency (CAI) software.

[0023] Figure 2 This is the plasmid map of the recombinant vector pHumanIIIC in Example 2.

[0024] Figure 3 This is a gel image of the SDS-PAGE analysis results of the expression product in Example 4.

[0025] Figure 4 This is a gel image of the SDS-PAGE analysis results of the recombinant collagen peptide after shake flask fermentation of the expression product in Example 4.

[0026] Figure 5 This is a diagram of the sequencing results after the expression product was purified in Example 4. DETAILED DESCRIPTION

[0027] The technical solution of the present invention is further described below by specific implementation methods. It should be understood by those skilled in the art that the embodiments are only used to help understand the present invention and should not be regarded as specific limitations of the present invention.

[0028] The following are the materials and reagents used in the examples:

[0029] HEK293F cells were purchased from Thermo Fisher Scientific.

[0030] HEK293F cell culture medium was purchased from Yishengke Company.

[0031] 1M DTT: Weigh 1.543 g DTT, dissolve it in 6 ml ddH2O, dilute to 10 mL, and store at -20°C. DTT was purchased from BBI.

[0032] 5×SDS-PAGE loading buffer: Measure 12.5mL of 1M Tris-HCl buffer (pH6.8), 25mL of glycerol, weigh 5g SDS, 0.25g bromophenol blue, dissolve with ddH2O, dilute to 80mL, and store in a refrigerator at 4℃. Each time you use it, take 2mL of the above solution and 0.5mL of 1M DTT in a ratio of 4:1, mix thoroughly before use, and store in a refrigerator at 4℃.

[0033] 5×Tris-Gly SDS PAGE electrophoresis buffer: weigh 15.1 g Tris base, 94 g glycine, and 5 g SDS, stir and dissolve with about 800 mL ddH20, then dilute to 1 L and store at room temperature.

[0034] SDS-PAGE staining solution: prepare the solution in the ratio of anhydrous ethanol: ddH2O: glacial acetic acid = 4.5:4.5:1, add 1g Coomassie Brilliant Blue R250, dissolve it fully, then make up to 1L and store it at room temperature.

[0035] SDS-PAGE destaining solution: prepare the solution in the ratio of anhydrous ethanol: ddH2O: glacial acetic acid = 25:65:8 and store at room temperature.

[0036] If no specific techniques or conditions are specified in the examples, the techniques or conditions described in the literature in the field or the product instructions are used. If no manufacturer is specified for the reagents or instruments used, they are all conventional products that can be purchased through regular channels.

[0037] Example 1: Codon optimization of the mature peptide sequence of recombinant human type III collagen

[0038] The mature peptide sequence of human type III collagen α1 chain P02461.4 from the NCBI database was selected, and its amino acid sequence is shown in SEQ ID NO.1. The codon optimization software of Hongxun Biotechnology was used. Codon optimization was performed, and the optimized sequence is shown in SEQ ID NO.2.

[0039] Amino acid sequence of human type III collagen α1 chain mature peptide (SEQ ID NO.1):

[0040]

[0041]

[0042] The optimized sequences were analyzed using Hongxun's own codon usage frequency (CAI) software. Figure 1 As shown, the CAI is 0.8, which is conducive to the efficient expression of the sequence in the host cell HEK293F.

[0043] The results of analyzing the optimized sequence using Hongxun's own sequence complexity analysis software are shown in Table 1, indicating that the difficulty of synthesizing the optimized sequence is reduced, which is conducive to the synthesis of nucleic acid sequences and stable replication and expression in host cells.

[0044] Table 1

[0045] Sequence complexity Extreme Sequence length 3207 GC content 61.5|Normal GC50nt volatility 10|Normal GC50nt content 64-54|Normal Base repetition A5C4G4T3|Normal Long repeat count 20 nt 0|Normal Short repeat density 9nt 91.3% | Extreme Palindrome sequence length 12|Normal Inverted repeat length 15|Normal

[0046] Example 2: Recombinant vector construction

[0047] The sequence elements for plasmid replication and screening in Escherichia coli, the human albumin secretion signal peptide sequence (SEQ ID NO.4), the screening sequence elements puromycin resistance element (SEQ ID NO.6) and DHFR element (SEQ ID NO.7) in the expression host cell HEK293F, and the CMV promoter (SEQ ID NO.8) and enhancer element (SEQ ID NO.9) for initiating the transcription of the mature peptide sequence of type III human collagen were selected. The plasmid map of the recombinant vector pHumanIIIC is shown in the figure below. Figure 2 As shown, the nucleotide sequence is shown in SEQ ID NO.5.

[0048] The nucleotide sequence of the recombinant vector pHumanIIIC (SEQ ID NO.5):

[0049]

[0050] Puromycin resistance element sequence (SEQ ID NO.6):

[0051] atgaccgagtacaagcccacggtgcgcctcgccacccgcgacgacgcccccagggccgtacgcaccctcgccgccgcgttcgccgactaccccgccacgcgccacaccgtcgatccggaccgccacatcgagcgggtcaccgagctgcaagaactcttcctcacgcgcgtcgggctcgacatcggcaaggtgtgggtcgcggacgacggcgccgcggtggcggtctggaccacgccggagagcgtcgaagcgggggcggtgttcgccgagatcggcccgcgcatggccgagttgagcggttcccggctggccgcgcagcaacagatggaaggcctcctggcgccgcaccggcccaaggagcccgcgtggttcctggccaccgtcggcgtctcgcccgaccaccagggcaagggtctgggcagcgccgtcgtgctccccggagtggaggcggccgagcgcgccggggtgcccgccttcctggagacctccgcgccccgcaacctccccttctacgagcggctcggcttcaccgtcaccgccgacgtcgaggtgcccgaaggaccgcgcacctggtgcatgacccgcaagcccggtgcctga

[0052] DHFR sequence (SEQ ID NO.7):

[0053] atggttcgaccattgaactgcatcgtcgccgtgtcccaaaatatggggattggcaagaacggagacctaccctggcctccgctcaggaacgagttcaagtacttccaaagaatgaccacaacctcttcagtggaaggtaaacagaatctggtgattatgggtaggaaaacctggttctccattcctgagaagaatcgacctttaaaggacagaattaatatagttctcagtagagaactcaaagaaccaccacgaggagctcattttcttgccaaaagtttggatgatgccttaagacttattgaacaaccggaattggcaagtaaagtagacatggtttggatagtcggaggcagttctgtttaccaggaagccatgaatcaaccaggccacctcagactctttgtgacaaggatcatgcaggaatttgaaagtgacacgtttttcccagaaattgatttggggaaatataaacttctcccagaatacccaggcgtcctctctgaggtccaggaggaaaaaggcatcaagtataagtttgaagtctacgagaagaaagactaa

[0054] CMV promoter sequence (SEQ ID NO.8):

[0055] gtgatgcggttttggcagtacatcaatgggcgtggatagcggtttgactcacggggatttccaagtctccaccccattgacgtcaatgggagtttgttttggcaccaaaatcaacgggactttccaaaatgtcgtaacaactccgccccattgacgcaaatgggcggtaggcgtgtacggtgggaggtctatataagcagagct

[0056] Enhancer sequence (SEQ ID NO.9):

[0057] gacattgattattgactagttattaatagtaatcaattacggggtcattagttcatagcccatatatggagttccgcgttacataacttacggtaaatggcccgcctggctgaccgcccaacgacccccgcccattgacgtcaataatgacgtatgttcccatagtaacgccaatagggactttccattg acgtcaatgggtggagtatttacggtaaactgcccacttggcagtacatcaagtgtatcatatgccaagtacgccccctattgacgtcaatgacggtaaatggcccgcctggcattatgcccagtacatgaccttatgggactttcctacttggcagtacatctacgtattagtcatcgctattaccatg

[0058] Example 3: Construction of high expression stable cell line

[0059] The pHumanIIIC expression plasmid was linearized with NotI and transfected into HEK293F cells. The method for screening stable expression cell lines was as follows:

[0060] 1. Cell preparation: One day before the transformation, subculture the transformed HEK293F cells to the logarithmic growth phase. During the transformation, pipette an appropriate amount of cell suspension into a sterile, clean 1.5 mL centrifuge tube in a biosafety cabinet, centrifuge at 2000 rpm for 3 min, discard the supernatant, and resuspend in fresh serum-free medium to a cell concentration of 1×107 cells / mL.

[0061] 2. Under sterile conditions, pipette the electroporation system into a 4 mm electroporation cup. Cover the lid tightly and place it on the electroporator. Set the electroporation conditions: voltage: 260 V; number of electric shocks: 3; pulse time: 10 ms; interval between electric shocks: 0.3 s. Immediately after the electric shock, resuspend the electroporation system in the electroporation cup with serum-free culture medium, transfer it to a 6-well plate, and culture it in a static incubator at 37°C and 5% CO2.

[0062] 3. Observation of cell morphology and activity: After 24 h of culture, trypan blue staining was used to observe cell viability, and cell morphology was observed under an optical microscope.

[0063] 4. After the cells adhere to the wall and converge normally, gradually replace them with serum-free medium in proportion. When the cells are fully adapted to the defective medium, add 15μg / mL puromycin for pressure screening, and change the medium half every day. During this period, the changes in cell density and viability should be recorded, and the target protein should be tested by SDS-PAGE. After 14 days of screening, continue to culture in serum-free medium. When the viability is greater than 90%, the cell line is a cell pool that stably expresses recombinant collagen, and the cell line is frozen for preservation.

[0064] 5. Select monoclonal cell lines by limiting dilution method. Culture cells to the logarithmic growth phase, count by trypan blue staining, dilute with serum-free medium several times until the number of cells is about 250 / mL, aspirate 4μL of cell suspension and drop it in the middle of the well of the flat-bottom 96-well plate, add two columns of wells first, observe whether they are monoclonal cells under a microscope and mark them. If the proportion of monoclonal cells in the two columns of wells is greater than 30%, continue to drop the remaining wells at this concentration; if the wells are mostly polyclonal, continue to dilute according to the polyclonal situation in the wells, drop two more columns of wells, observe the proportion of monoclonal cells, until more than 30% of the wells are monoclonal; if no cells are seen in most wells, consider over-dilution, dilute again from the previous concentration, and similarly until more than 30% of the wells are monoclonal, select monoclonal cells, and obtain high-yield monoclonal strains.

[0065] Example 4: Analysis and identification of mature peptides of recombinant human type III collagen

[0066] SDS-PAGE analysis of the expression product showed that the theoretical molecular weight of the recombinant collagen peptide was about 95.28 kDa, and the SDS-PAGE apparent molecular weight was about 130 kDa, suggesting that glycosylation modification was present. Figure 3 Grayscale analysis showed that the shake flask fermentation yields of the obtained multiple stable cell lines exceeded 1 g / L.

[0067] The supernatants of shake flask fermentation of multiple cell lines were run on 6% SDS-PAGE; transfer: according to the size of the gel, 6 pieces of PVDF and filter paper were cut, the filter paper was placed in the transfer buffer for 1-2 minutes, and the PVDF membrane was soaked with methanol; the transfer sandwich was assembled: sponge, 3 layers of filter paper, gel, membrane, 3 layers of filter paper, sponge, and after each layer was placed, the bubbles were removed with a pipette; the transfer tank was placed in an ice bath, the sandwich was placed (black side against black side), the transfer buffer was added, the electrodes were plugged in, 0.2A cross flow, and the transfer time was 60 minutes; after the end, the power was cut off and the hybridization membrane was taken out; it was placed in a 20mL volume of blocking solution (5% Milk) on a horizontal shaker and incubated at room temperature for 1h; COL3A1 primary antibody was selected, diluted 1:1000, 20uL of antibody was added to 10mL of primary antibody diluent (Biyuntian), mixed well, the blocked PVDF membrane was placed in the primary antibody, and incubated overnight; color was developed tomorrow. Recover the primary antibody, wash the membrane 4 times with 1×TBS, add Mouse secondary antibody (10uL antibody + 10mL 1×TBS), incubate at room temperature for 1h; wash the membrane 4 times with 1×TBS, add C liquid on a shaker for 10min, add 500uLA solution + 2uLB solution for color development, and the membrane gradually turns blue. The results are as follows Figure 4 As shown, the target band is consistent with the SDS-PAGE result, which is about 130 kDa.

[0068] After the expression product is purified, it is sent to the Drug Station Testing Center for sequence determination. The sequencing results are shown in the figure below. Figure 5 As shown, the sequencing results showed that the designed sequence was completely consistent.

[0069] The applicant declares that the above is only a specific implementation mode of the present invention, but the protection scope of the present invention is not limited thereto. Those skilled in the art should understand that any changes or substitutions that can be easily thought of by those skilled in the art within the technical scope disclosed by the present invention shall fall within the protection scope and disclosure scope of the present invention.

Claims

1. A method for preparing recombinant full-length humanized type III collagen, characterized in that: The preparation method comprises the following steps: S1. Select the amino acid sequence of the mature peptide of type III collagen α1 chain, design and synthesize the gene sequence after codon optimization; the amino acid sequence of the mature peptide of type III collagen α1 chain is shown in SEQ ID NO.1, and the optimized gene sequence is shown in SEQ ID NO.2; S2. Connect the optimized gene sequence with the vector fragment containing the human albumin secretion signal peptide to construct a recombinant vector pHumanIIIC; the amino acid sequence of the human albumin secretion signal peptide is shown in SEQ ID NO.3, and the nucleotide sequence is shown in SEQ ID NO.4; the recombinant vector pHumanIIIC comprises a puromycin resistance element, a DHFR element, a CMV promoter and an enhancer; the nucleotide sequence of the puromycin resistance element is shown in SEQ ID NO.6, the nucleotide sequence of the DHFR element is shown in SEQ ID NO.7, the nucleotide sequence of the CMV promoter is shown in SEQ ID NO.8, and the nucleotide sequence of the enhancer is shown in SEQ ID NO.9; the nucleotide sequence of the recombinant vector pHumanIIIC is shown in SEQ ID NO.5; S3. Linearize the recombinant vector pHumanIIIC, transfect into HEK293F cells, screen, culture, express and purify to obtain recombinant full-length humanized type III collagen.

2. Application of the preparation method according to claim 1 in the engineering preparation of recombinant full-length humanized type III collagen.

Images