Application of PTMA protein coding sequence in the preparation of drugs for the treatment of myocardial infarction
By applying the PTMA protein coding sequence in myocardial infarction treatment drugs and using adenovirus or adeno-associated virus vectors to overexpress PTMA protein, the problem of myocardial cell regeneration is solved, myocardial tissue regeneration and cardiac function recovery are achieved, and heart failure is prevented.
Patent Information
- Application Number
- CN202310389255.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-04-12
- Publication Date
- 2025-09-05
- Estimated Expiration
- 2043-04-12
AI Technical Summary
Existing technologies are unable to effectively promote the proliferation and regeneration of myocardial cells, resulting in difficulties in recovering cardiac function after myocardial infarction and a lack of effective drug treatments.
The PTMA protein coding sequence is used to overexpress the PTMA protein through adenovirus or adeno-associated virus vector, thereby promoting the proliferation of damaged myocardial cells and the regeneration of myocardial tissue, and restoring the heart's pumping function.
By overexpressing the PTMA protein coding sequence, it can significantly promote cardiomyocyte proliferation, reduce myocardial infarction area, improve cardiac function, prevent heart failure, and has a long-term therapeutic effect on cardiac function.
Smart Images

Figure CN118791588B_ABST
Abstract
Description
Technical Field
[0001] The invention belongs to the field of medicine and relates to the application of a PTMA protein coding sequence in treating post-myocardial infarction and repairing cardiac function. Background Art
[0002] After a myocardial infarction, a large number of myocardial cells in the infarcted area will die. Clinically, the drug treatments for cardiovascular diseases such as acute myocardial infarction mainly include thrombolysis, inhibition of myocardial remodeling, coronary intervention, and bypass graft surgery and other revascularization procedures. These programs can only improve myocardial blood supply, but cannot fundamentally save the loss of myocardial cells and restore lost heart function. Promoting the proliferation and regeneration of myocardial cells after myocardial infarction is of greater significance for the reconstruction of heart morphology and the recovery of heart function. However, there is a lack of effective drugs in the clinic to promote the proliferation and regeneration of in situ myocardial cells and thus restore heart function. Therefore, the development of a drug that can promote myocardial regeneration and repair of heart function has become an urgent problem to be solved. Summary of the Invention
[0003] In order to solve the above problems, the purpose of the present invention is to provide the use of a PTMA protein coding sequence in the preparation of a drug for treating myocardial infarction. The PTMA protein coding sequence can promote the proliferation of damaged myocardium, achieve regeneration and repair of myocardial tissue, thereby reconstructing the heart morphology after myocardial infarction and restoring the heart's pumping function.
[0004] In order to achieve the above objectives, the present invention provides the use of a PTMA protein coding sequence in the preparation of a drug for treating myocardial infarction.
[0005] As described above, the PTMA protein coding sequence is a mouse-derived PTMA protein coding sequence, a rat-derived PTMA protein coding sequence, or a human-derived PTMA protein coding sequence.
[0006] Preferably, the sequence of the mouse-derived PTMA protein coding sequence is shown in Seq ID No. 1; the sequence of the rat-derived PTMA protein coding sequence is shown in Seq ID No. 2; and the sequence of the human-derived PTMA protein coding sequence is shown in Seq ID No. 3.
[0007] Preferably, the myocardial infarction treatment is to promote the proliferation of damaged myocardial cells, regenerate and repair myocardial tissue, reconstruct the heart morphology after myocardial infarction, restore the heart's pumping function, and prevent heart failure.
[0008] The present invention also provides an expression vector comprising a PTMA protein coding sequence, wherein the PTMA protein coding sequence is a mouse-derived PTMA protein coding sequence, a rat-derived PTMA protein coding sequence, or a human-derived PTMA protein coding sequence.
[0009] Preferably, the mouse-derived PTMA protein coding sequence is as shown in Seq ID No. 1, and the expression vector is an adenovirus expression vector or an adeno-associated virus expression vector.
[0010] Preferably, the rat-derived PTMA protein coding sequence is shown in Seq ID No. 2, and the expression vector is an adenovirus expression vector or an adeno-associated virus expression vector.
[0011] Preferably, the human PTMA protein coding sequence is as shown in Seq ID No. 3, and the expression vector is an adenovirus expression vector or an adeno-associated virus expression vector.
[0012] The beneficial effects of the present invention are:
[0013] The present invention provides the use of a PTMA protein coding sequence in the preparation of a drug for treating myocardial infarction. By overexpressing the PTMA protein coding sequence, the proliferation of damaged myocardial cells, the regeneration and repair of myocardial tissue, the reconstruction of the heart morphology after myocardial infarction, the restoration of cardiac pumping function, the alleviation of the development of cardiac pathological remodeling, the prevention of the occurrence of heart failure, and the long-term therapeutic effect on cardiac function after myocardial infarction can be achieved. BRIEF DESCRIPTION OF THE DRAWINGS
[0014] Figure 1 This is a flow chart for detecting the regenerative and repair capacity of the myocardium in neonatal mice.
[0015] Figure 2 To detect the changes in PTMA protein expression levels in myocardial cells after myocardial injection of AAV-Ptma or an equal amount of AAV-Luc during myocardial infarction surgery in mice using PTMA antibody immunofluorescence staining.
[0016] Figure 3 Cardiac ultrasound statistical graphs were performed for mice in the Ptma overexpression group and the control group 2 weeks, 4 weeks, and 8 weeks after myocardial infarction.
[0017] Figure 4 The images are stained with picrosirius red and fast green in mice 8 weeks after myocardial infarction.
[0018] Figure 5 for Figure 4 Statistical analysis chart.
[0019] Figure 6 These are photos of wheat germ agglutinin (WGA) and nuclear marker DAPI immunostaining of heart tissue in mice 8 weeks after myocardial infarction.
[0020] Figure 7 for Figure 6 Statistical analysis chart.
[0021] Figure 8The figure shows the immunostaining of EdU, a proliferation marker, and cTNT, a cardiomyocyte marker.
[0022] Figure 9A 、 Figure 9B for Figure 8 Statistical chart of .
[0023] Figure 10 pH3 is a proliferation marker + Photographs of immunostaining with the cardiomyocyte marker cTNT.
[0024] Figure 11 for Figure 10 Statistical chart of .
[0025] Figure 12 The figure shows the immunostaining of Aurora B, a proliferation marker, and cTNT, a cardiomyocyte marker.
[0026] Figure 13 for Figure 12 Statistical chart of .
[0027] Figure 14 Flowchart for preparing a surgical model of myocardial infarction in adult mice and performing treatment.
[0028] Figure 15 To detect the expression level of PTMA protein in cardiomyocytes of adult mice after myocardial injection of AAV-Ptma or an equal amount of AAV-Luc during myocardial infarction surgery using immunofluorescence staining.
[0029] Figure 16 Survival curves of Ptma-treated group and Luc-negative control group mice after myocardial infarction in adult mice.
[0030] Figure 17 The results of cardiac ejection fraction detected by small animal ultrasound at different time points after adult mice were treated with PTMA protein coding sequence after myocardial infarction.
[0031] Figure 18 The graph shows the results of the cardiac ejection fraction measured by small animal ultrasound at different time points after adult mice were treated with PTMA protein coding sequence after myocardial infarction, minus the ejection fraction 3 days after myocardial infarction.
[0032] Figure 19 The graph shows the result of subtracting the ejection fraction of adult mice 8 weeks after myocardial infarction from the ejection fraction 3 days after myocardial infarction.
[0033] Figure 20 The graph shows the result of subtracting the ventricular wall thickness of adult mice 3 days after myocardial infarction from the ventricular wall thickness 8 weeks after myocardial infarction (LVPW; s).
[0034] Figure 21The graph shows the result of subtracting the cardiac chamber size of adult mice 3 days after myocardial infarction from the cardiac chamber size 8 weeks after myocardial infarction (LVID; s).
[0035] Figure 22 These are images of picrosirius red and fast green staining in adult mice after myocardial infarction.
[0036] Figure 23 for Figure 22 Statistical analysis chart.
[0037] Figure 24 This is the experimental flow chart for the cardiac proliferation assay using rat-derived Ptma adenovirus overexpressed in rat primary cardiomyocytes.
[0038] Figure 25 To detect the expression level of rat-derived PTMA protein after Ad-Ptma was expressed in primary cardiomyocytes of neonatal rats using Western blotting technology.
[0039] Figure 26 Photographs of neonatal rat primary cardiomyocytes treated with Ad-Luc or Ad-Ptma and immunostained with the proliferation marker EdU and cTNT.
[0040] Figure 27 for Figure 26 Statistical chart of .
[0041] Figure 28 Photographs of neonatal rat primary cardiomyocytes treated with Ad-Luc or Ad-Ptma and immunostained with the proliferation marker pH3 and cTNT.
[0042] Figure 29 for Figure 28 Statistical chart of .
[0043] Figure 30 Photographs of neonatal rat primary cardiomyocytes treated with Ad-Luc or Ad-Ptma and immunostained with the proliferation marker Aurora B and cTNT.
[0044] Figure 31 for Figure 30 Statistical chart of .
[0045] Figure 32 Flowchart for the experimental study of cardiac proliferation using human Ptma adenovirus overexpression in human iPSC-derived cardiomyocytes.
[0046] Figure 33 To detect the expression level of human PTMA protein after Ad-hPtma was expressed in hiPSC-CMs using Western blotting technology.
[0047] Figure 34Photographs of hiPSC-CMs treated with Ad-Luc or Ad-hPtma and immunostained with the proliferation marker EdU and cTNT.
[0048] Figure 35 for Figure 34 Statistical chart of .
[0049] Figure 36 Photographs of hiPSC-CMs treated with Ad-Luc or Ad-hPtma and immunostained with the proliferation marker pH3 and cTNT.
[0050] Figure 37 for Figure 36 Statistical chart of .
[0051] Figure 38 Photographs of hiPSC-CMs treated with Ad-Luc or Ad-hPtma and immunostained with the proliferation marker Aurora B and cTNT.
[0052] Figure 39 for Figure 38 Statistical chart of . DETAILED DESCRIPTION
[0053] The embodiments of the present invention will be described in detail and comprehensively below so that the advantages and features of the present invention can be more easily understood by those skilled in the art, thereby making a clearer and more precise definition of the protection scope of the present invention.
[0054] After a myocardial infarction (MI), the heart undergoes pathological remodeling, manifested by cardiomyocyte hypertrophy, necrosis, and apoptosis, extracellular matrix collagen deposition and fibrosis, and increased myocardial stiffness. Apoptosis does not cause cell membrane rupture or inflammatory responses; it is an active, orderly, and precisely regulated, energy-demanding process. However, cardiomyocytes are terminally differentiated cells and cannot proliferate or regenerate, making the myocardial damage caused by apoptosis irreversible. Cardiomyocyte apoptosis typically occurs within the first three days after an MI. It is primarily regulated by the Bcl-2 family, the Fas / Fas-L system, the caspase family, and the tumor suppressor gene p53. Apoptosis is virtually undetectable beyond seven days after an MI. This is because the body initiates an immune response three days after an MI, with immune cells such as macrophages clearing apoptotic or necrotic cardiomyocytes. This clearance process is complete by seven days after the MI, and the cell proliferation phase begins. Pathological remodeling begins 14 days after an MI and is complete by 28 days. This pathological remodeling cannot sustain normal cardiac function over the long term and ultimately leads to heart failure.
[0055] The mouse PTMA protein coding sequence is located on chromosome 1 and is highly conserved in humans and multiple species. The mouse PTMA protein coding sequence is listed in PubMed as gene ID NM_008972.4. The mouse PTMA protein coding sequence provided in the present invention is shown in Seq ID No. 1:
[0056] ATGTCAGACGCGGCAGTGGATACCAGCTCCGAGATCACCACCAAGGACTTGAAGGAGAAGAAGGAAGTTGTGGAGGAGGCAGAGAATGGAAGAGATGCACCTGCCAATGGGAACGCTCAAAATGAGGAAAATGGGGAGCAGGAGGCTGACAATGAGGTAGATGAAGAA GAGGAAGAAGGTGGGGAGGAAGAGGAGGAGGAGGAAGAAGGTGACGGTGAGGAGGAGGATGGAGATGAAGATGAGGAAGCTGAGGCTCCTACGGGCAAGCGGGTAGCTGAGGATGATGAGGATGACGATGTGGACACCAAGAAGCAGAAGACCGAGGAGGATGACTAG.
[0057] The rat protein coding sequence is located on chromosome 9 and has a PubMed ID of NM_021740.2. The human PTMA protein coding sequence provided in the present invention is shown in Seq ID No. 2:
[0058] ATGTCAGACGCGGCAGTGGACACCAGCTCCGAGATCACCACCAAGGACTTGAAGGAGAAGAAGGAAGTTGTGGAGGAGGCAGAGAATGGAAGAGACGCACCTGCCAATGGGAACGCTCAAAATGAGGAAAATGGGGAGCAGGAGGCTGACAATGAGGTAGATGAAGAAGA GGAAGAAGGTGGGGAGGAAGAGGAGGAGGAGGAAGAAGGTGATGGTGAGGAAGAAGATGGATGAAGATGAGGAAGCTGAGGCTCCTACGGGCAAGCGGGTAGCTGAGGATGATGAGGATGATGATGTTGAGACCAAGAAGCAGAAGAAGACTGATGAGGATGACTAG.
[0059] The human PTMA protein coding sequence is located on chromosome 2 and has a PubMed ID of NM_002823. The human PTMA protein coding sequence provided in the present invention is shown in Seq ID No. 3:
[0060] ATGTCAGACGCAGCCGTAGACACCAGCTCCGAAATCACCACCAAGGACTTAAAGGAGAAGAAGGAAGTTGTGGAAGAGGCAGAAAATGGAAGAGACGCCCCTGCTAACGGGAATGCTAATGAGGAAAATGGGGAGCAGGAGGCTGACAATGAGGTAGACGAAGAAGA GGAAGAAGGTGGGGAGGAAGAGGAGGAGGAAGAAGAAGGTGATGGTGAGGAAGAGGATGGATGAAGATGAGGAAGCTGAGTCAGCTACGGGCAAGCGGGCAGCTGAAGATGATGAGGATGACGATGTCGATACCAAGAAGCAGAAGACCGACGAGGATGACTAG.
[0061] The present invention provides a PTMA protein coding sequence as a drug for treating myocardial infarction. The PTMA protein coding sequence is the above-mentioned mouse-derived, rat-derived or human-derived PTMA protein coding sequence.
[0062] Material:
[0063] 1. C57BL / 6J adult mice were purchased from Beijing Weitonglihua Laboratory Animal Technology Co., Ltd., and C57BL / 6J neonatal mice were purchased from Beijing Sibeifu Biotechnology Co., Ltd.
[0064] 2. Human induced pluripotent stem cells (hiPSCs), Human Cardiomyocyte Differentiation Kit (Product No.: CA2004500), Human cardiomyocyte purification medium (Product No.: CA2005100), Human cardiomyocyte maintenance medium (product number: CA2015002) was purchased from Beijing Saibei Biotechnology Co., Ltd.
[0065] 3. Western blot primary antibody diluent was purchased from Shanghai Beyotime Biotechnology Co., Ltd., product number P0256.
[0066] 4. The primary antibody diluent for immunofluorescence staining was purchased from Zhongshan Jinqiao Biotechnology Co., Ltd., product number ZLI-9030.
[0067] 5. Goat serum was purchased from Zhongshan Jinqiao Biotechnology Co., Ltd., product number ZLI-9056.
[0068] 6. Alexa Fluor 488 donkey anti-rabbit immunofluorescent antibody and Alexa Fluor 594 donkey anti-mouse immunofluorescent antibody were purchased from Invitrogen, with product numbers A-32731 and A-32742, respectively.
[0069] 7.RIPA lysis buffer was purchased from Shanghai Beyotime Biotechnology Co., Ltd., product number ST506.
[0070] 8. cTNT antibody was purchased from DSHB, USA, product number: ea5 / 26 / 61, Aurora B antibody was purchased from Sigma, USA, product number: A5102; phospho-histone H3 (pH3) antibody was purchased from Millipore, USA, product number: 06-570.
[0071] The animal experiments described in the examples were all approved by the Laboratory Animal Ethics Committee of the Fuwai Hospital, Chinese Academy of Medical Sciences, and were conducted in accordance with the Guide for the Care and Use of Laboratory Animals of the National Institutes of Health (NIH). The experimental animals were maintained at the Animal Experimental Center of the State Key Laboratory of Cardiovascular Diseases, Fuwai Hospital, Chinese Academy of Medical Sciences.
[0072] Example 1 Construction of Ptma-related viruses
[0073] Shandong Weizhen Biotechnology Co., Ltd. (abbreviated as Weizhen Biotechnology) was commissioned to construct expression vectors encoding overexpression of mouse-derived, rat-derived or human-derived PTMA proteins.
[0074] The mouse PTMA protein coding sequence, as shown in Seq ID No. 1, was constructed into an adeno-associated virus (AAV) serotype AAV9 vector with a cTNT promoter. After sequencing, the vector was packaged into mouse AAV-PTMA, and the viral titer was determined to be 7.5E+13 PFU / mL. Weizhen Bio also provided an empty vector AAV-Luc as a negative control, which was also packaged and had a titer of 3.0E+13 PFU / mL.
[0075] The rat PTMA protein coding sequence shown in Seq ID No. 2 was constructed into an adenovirus (Ad) vector with a CMV promoter. After sequencing, it was packaged into a rat adenovirus Ad-Ptma, and the viral titer was determined to be 3.5E+10 PFU / mL. The human PTMA protein coding sequence shown in Seq ID No. 3 was constructed into an adenovirus (Ad) vector with a cTNT promoter. After sequencing, it was packaged into a human adenovirus Ad-hPtma, and the viral titer was determined to be 4.5E+10 PFU / mL. Weizhen Bio also provided an empty vector Ad-Luc as a negative control for rat and human sources. The virus was also packaged, and the titer was determined to be 6.3E+10 PFU / mL, and named Ad-Luc.
[0076] Example 2 Protective Effect of Overexpression of PTMA Protein Coding Sequence on Myocardial Infarction in C57BL / 6J Mice Preparation of a Mouse Model Overexpressing PTMA Protein Coding Sequence
[0077] like Figure 1 The following is the procedure for surgical modeling of myocardial infarction in neonatal mice and testing of myocardial regeneration and repair capacity:
[0078] Neonatal C57BL / 6J mice were injected with AAV-Ptma or negative control AAV-Luc within 24 hours of birth. Eight days after birth, myocardial cells exited the cell cycle and lost their ability to proliferate, leading to a myocardial infarction surgery model. Real-time dynamic cardiac function testing was performed using echocardiography. Three days after myocardial regeneration initiated, myocardial cell proliferation was assessed using immunofluorescence staining. Eight weeks after myocardial infarction, heart tissue sections were obtained and stained with Sirius red and Fast green to quantify infarct size and myocardial regeneration capacity.
[0079] The specific procedure was as follows: C57BL / 6J pregnant mice were purchased and within 24 hours of birth, AAV-Ptma was injected subcutaneously into the neck of the experimental group, and AAV-Luc was injected subcutaneously into the neck of the control group. Each mouse was injected with 5.0E+11 PFU of virus. Myocardial infarction surgery was performed on the experimental and control mice on day 8 after birth. The specific steps of the myocardial infarction surgery are as follows:
[0080] 1. Bury an 8-day-old mouse in crushed ice for 2-3 minutes to induce hypothermia (hypothermia can induce decreased heart rate and respiration in mice).
[0081] 2. Remove the mouse and secure it in a right supine position on a pre-cooled micro-metal operating table with medical tape. Disinfect the mouse's chest skin from the inside out with a 5% iodine cotton ball, then disinfect it with a 75% alcohol cotton ball.
[0082] 3. Under a stereoscope, cut the skin at the fourth intercostal space on the left side of the mouse with microscissors. Use microscissors to bluntly separate the subcutaneous tissue and muscles into the chest. Use ophthalmic forceps to open the chest cavity and gently tear the pericardium to expose the heart.
[0083] 4. Ligation of the Left Anterior Descending Coronary Artery: Under a stereoscopic microscope, a bright red vessel 2 mm below the inferior edge of the left atrial appendage (LAA) can be seen shaped like an inverted Y, running toward the apex. This is the left anterior descending coronary artery of the mouse. Use 8 / 0 polyester suture to precisely ligate the left anterior descending coronary artery. Immediately, pallor of the ventricular myocardium below the ligature is visible, indicating successful modeling.
[0084] 5. After wiping off the blood stains with a sterilized cotton swab, use 8 / 0 polyester thread to suture the ribs and skin in an eight-shaped pattern, and wipe with a 75% alcohol cotton ball to prevent infection.
[0085] 6. Place the post-operative mouse on a 37°C rewarming table for about 10 minutes. Once the mouse has recovered its independent activity and its skin is rosy, with no obvious bleeding at the suture site, place it back in its mother's cage and feed it. Samples can be collected for observation at an appropriate time.
[0086] 7. A sham operation group model (Sham) was set up to complete the above steps without ligating the coronary artery.
[0087] like Figure 2 The figure shows the changes in PTMA protein expression in myocardial cells detected by immunofluorescence staining using PTMA antibodies after myocardial injection of AAV-Ptma or an equal amount of AAV-Luc (negative control) in mice undergoing myocardial infarction surgery. Figure 2 It can be seen that after overexpressing the full-length PTMA protein coding sequence, PTMA is mainly located in the cell nucleus, and the PTMA expression efficiency is significantly increased compared with the negative control group, and it still maintains a high expression 8 weeks after myocardial infarction, further suggesting the timeliness of AAV9-mediated PTMA gene therapy.
[0088] In addition, the changes in cardiac function were detected by small animal ultrasound at 2 weeks, 4 weeks, and 8 weeks after surgery to examine the effect of Ptma overexpression on the repair of cardiac function after myocardial infarction. The statistical results are as follows: Figure 3 As shown. Figure 3 It can be seen that high expression of Ptma in cardiac cardiomyocytes significantly promotes the repair of cardiac function after myocardial infarction and increases the heart's pumping capacity (EF).
[0089] Eight weeks after surgery, heart tissue was collected and made into paraffin sections. Sirius red (sirius red to stain collagen fibers) and Fast green (fast green to stain myocardial tissue) were used to detect the degree of cardiac fibrosis and to determine the size of myocardial infarction. This was done to determine the effect of overexpression of Ptma on myocardial infarction size and cardiac fibrosis after myocardial infarction. Figure 4 and Figure 5 As shown. Figure 4 and Figure 5 It can be seen that high expression of Ptma in cardiac myocardial cells significantly alleviated the occurrence of cardiac fibrosis and reduced the myocardial infarction area (Scar size).
[0090] Example 3: Effect of Overexpression of Ptma in C57BL / 6J Mice on Proliferation of Myocardial Proliferation After Myocardial Infarction
[0091] Heart tissues of mice 8 weeks after myocardial infarction were taken and made into paraffin sections. Immunostaining with wheat germ agglutinin (WGA) and nuclear marker DAPI was used to observe the effect of high expression of Ptma on cardiomyocyte size after myocardial infarction in mice. AAV-Luc was used as a negative control. Figure 6 As shown. Figure 6 Statistical analysis was performed, and the results were as follows Figure 7 As shown. Figure 6 and Figure 7 As can be seen, compared to the Luc-negative control group, the high-expression Ptma group showed a significant decrease in cardiomyocyte area, suggesting an increase in cardiomyocyte number. For hearts of the same size, larger cardiomyocytes indicate a smaller number, while smaller cardiomyocytes further indicate an increase in number and a reduction in pathological remodeling of cardiac cells to compensate for their function.
[0092] To verify whether Ptma promotes the increase in the number of cardiomyocytes, a myocardial infarction model was re-established in a group of 8-day-old mice. Heart tissues were taken from the mice 3 days after surgery and made into paraffin sections. The proliferation markers EdU, pH3 and Aurora B were used for immunostaining with cTNT to evaluate the effect of Ptma on cardiomyocyte proliferation after myocardial infarction. The results are as follows: Figures 8 to 13 As shown, AAV-Luc was used as a negative control. Figure 8 This is the result of immunostaining of the proliferation marker EdU and the cardiomyocyte marker cTNT. Figure 9A and Figure 9B for Figure 8 Statistical charts, such as Figure 9A EdU + Indicates proliferating cardiomyocytes. Since cardiomyocytes may become multinucleated cells without undergoing mitosis after DNA replication, +The adjacent cells of the cardiomyocytes are undergoing DNA replication, and such cells are more likely to enter mitosis and cytokinesis, such as Figure 9B Directions to EdU + Myocardial cells. Figure 8 、 Figure 9A and Figure 9B It can be seen that compared with the Luc negative control group, the Ptma high expression group has EdU positive (EdU + ) cardiomyocytes, especially the adjacent EdU-positive cardiomyocytes, increased more significantly, indicating that Ptma can stimulate cardiomyocyte proliferation.
[0093] Figure 10 This is the result of immunostaining of the proliferation marker pH3 and the cardiomyocyte marker cTNT. Figure 11 for Figure 10 Statistical chart from Figure 11 It can be seen that compared with the Luc negative control group, the pH3-positive cardiomyocytes in the Ptma high expression group increased significantly, indicating that Ptma high expression can stimulate cardiomyocyte proliferation.
[0094] Figure 12 The results are shown in Figure 3. Co-immunostained results of proliferation marker Aurora B and cardiomyocyte marker cTNT. Figure 13 for Figure 12 Statistical chart from Figure 12 and Figure 13 It can be seen that compared with the Luc negative control group, the number of Aurora B-positive cardiomyocytes in the Ptma high expression group was significantly increased, further indicating that Ptma can stimulate cardiomyocyte proliferation.
[0095] from Figures 8 to 13 It can be seen that EdU + , pH3 + and Aurora B + With cTNT + The cell ratio increased significantly, and the expression level was about 3 times that of the Luc negative control group. The present invention clearly shows that Ptma can promote cardiomyocyte proliferation after myocardial infarction from three aspects: DNA replication (EdU positive), mitosis (pH3 positive) and cytoplasmic division (AuroraB positive) of cardiomyocytes.
[0096] Example 4 Therapeutic Effect of Ptma on Myocardial Infarction in Adult Mice
[0097] MI surgery was performed on adult 8-week-old C57BL / 6J mice (P56), and AAV9 virus was injected into the myocardium for post-MI cardiac therapy (AAV-Ptma injection). The specific steps of the MI surgery are as follows:
[0098] 1. Intraperitoneally inject adult mice with anesthetic tribromoethanol solution (200ul / 20g).
[0099] 2. Remove the anesthetized mouse and fix it on the operating table in the right supine position with medical tape; first disinfect the mouse's chest skin from the inside out with 5% iodine cotton balls, and then disinfect it with 75% alcohol cotton balls.
[0100] 3. Use ophthalmic scissors to cut the skin from the fourth intercostal space on the left side of the mouse. Use microsurgical scissors to bluntly separate the subcutaneous tissue and muscles into the chest. Use ophthalmic forceps to open the chest cavity and gently tear the pericardium to expose the heart.
[0101] 4. Ligation of the Left Anterior Descending Coronary Artery: A bright red, inverted Y-shaped vessel, visible 2 mm below the inferior edge of the left atrial appendage and running toward the apex, is the left anterior descending coronary artery of the mouse. Use 7 / 0 polyester suture to precisely ligate the left anterior descending coronary artery. Immediately, pallor of the ventricular myocardium below the ligature is visible, indicating successful modeling.
[0102] 5. After wiping off the blood stains with a sterilized cotton swab, use 6 / 0 polyester thread to suture the ribs and skin in an eight-shaped pattern, and wipe with a 75% alcohol cotton ball to prevent infection.
[0103] 6. Place the mice on a 37°C warming table after surgery to rewarm them. Once the mice have recovered their activities, place them back in their cages and perform ultrasound to monitor their cardiac function at appropriate times.
[0104] 7. The sham operation group model (Sham) completed the above steps without ligating the coronary artery.
[0105] On the day of surgery, AAV-Ptma mouse adeno-associated virus (30 μl, approximately 5.0E+11 PFU / heart) was injected intramyocardially at five points from the periphery of the myocardial infarction to the apex of the heart. The control group was injected with the same amount of AAV-Luc virus. Heart samples were collected 8 weeks after surgery. The experimental process is shown in the figure below. Figure 14 As shown in Figure 2, 8-week-old adult mice were injected with either a negative control (AAV-Luc) or an AAV9 virus overexpressing Ptma (AAV-Ptma) into the myocardium after myocardial infarction. Cardiac function was assessed dynamically in real time using echocardiography. At 8 weeks after myocardial infarction, cardiac tissue sections were stained with Sirius red and Fast Green to quantify infarct size and regenerative repair capacity.
[0106] Figure 15Immunofluorescence staining was used to detect changes in Ptma expression in cardiomyocytes following myocardial infarction surgery in adult mice after myocardial injection of AAV-Ptma or an equivalent dose of AAV-Luc. It can be seen that the expression level of PTMA protein in myocardial tissue was significantly increased after injection of Ptma-containing AAV.
[0107] Figure 16 Figure 2 is the survival curve of mice in the Ptma overexpression group and the Luc negative control group after myocardial infarction. It can be seen that the PTMA protein coding sequence treatment significantly promoted the survival rate (Percent survival) of adult myocardial infarction mice.
[0108] like Figure 17 The figure shows the results of cardiac function (Ejection fraction, EF) detected by small animal ultrasound at different time points after adult mice were treated with PTMA protein coding sequence after myocardial infarction. Figure 18 The figure shows the results of cardiac ejection fraction (ΔEF) at different time points after adult mice were treated with PTMA protein coding sequence after myocardial infarction minus the result of 3 days of myocardial infarction. Figure 17 and Figure 18 It can be seen that after treatment with the PTMA protein coding sequence, the cardiac ejection fraction (EF) value began to gradually increase 3 days after myocardial infarction (MI-3d), indicating that cardiac function began to improve. At 8 weeks after myocardial infarction, the ejection fraction of the control group continued to decrease to 30%, while the ejection fraction of the PTMA protein coding sequence treatment group increased to 50%, and the cardiac pumping function was significantly higher than that of the control group. Figures 19 to 21 As can be seen, by 8 weeks after myocardial infarction, the ejection fraction of the heart in the PtMA-treated group had recovered by approximately 10%, while the ejection fraction in the Luc-negative control group had decreased by approximately 13%. In the PTMA protein-encoding sequence-treated group, ventricular wall thickness (LVPW; s) increased, while LVID (LVID; s) was significantly reduced. This suggests that treatment with the PTMA protein-encoding sequence significantly improved functional recovery in hearts after myocardial infarction.
[0109] like Figure 22 Shown is a Sirius red and Fast green staining image after myocardial infarction in an adult. (From the ligature to the apex of the infarct, Sirius red stains the fibrotic collagen, and Fast green stains the myocardial tissue) Figure 22 It can be seen that after treatment with AAV9-mediated PTMA protein coding sequence (AAV-Ptma), myocardial tissue regenerated, the occurrence of cardiac fibrosis was alleviated, and the area of myocardial infarction was significantly reduced. Figure 23 for Figure 22 Statistical analysis chart of Figure 22 and Figure 23It can be seen that after myocardial infarction surgery in adult mice, myocardial tissue regeneration and myocardial infarction area (Scar size) were reduced after 8 weeks of treatment with AAV9-mediated PTMA protein coding sequence.
[0110] Therefore, after treatment with the PTMA protein coding sequence, myocardial tissue was significantly regenerated, the area of myocardial infarction was reduced, and cardiac function was significantly improved, which shows that PTMA is an effective molecule for treating cardiac function repair and regeneration after myocardial infarction in adults.
[0111] Example 5 Ptma promotes proliferation of rat-derived cardiomyocytes
[0112] Primary cardiomyocytes from neonatal rats were isolated and the regenerative effect of Ptma on rat cardiomyocytes was verified in vitro. The specific steps are as follows:
[0113] One-day-old CD1 neonatal rats were briefly immersed in 1.75% alcohol (1-2 seconds) for disinfection and then placed on the primary cell operation platform.
[0114] 2. Use microsurgery to obtain the heart of a newborn rat, place it in PBS solution, trim the atria, outflow tract, and various adhesions, and only retain the ventricular muscle tissue.
[0115] 3. Use the enzyme reagent in the neonatal mouse heart isolation kit and the dosage specified in the kit instructions to infiltrate the ventricular muscle tissue into a C-type reaction tube.
[0116] 4. Place the C-type reaction tube in a gentleMACS™ Octo Dissociator (Miltenyi Bio Tech, Teterow, Germany) for dissociation. Select the neonatal mouse heart dissociation program and process for approximately 1 hour.
[0117] 5. After the program is completed, terminate the reaction with DMEM culture medium containing 10% FBS, centrifuge at 300g for 5 minutes, discard the supernatant, and gently flick the precipitate to disperse it. The standard is that there are no obvious clumps.
[0118] 6. Add 2-3 ml of red blood cell lysis buffer and lyse at room temperature for 2 minutes. Centrifuge at 300 g for 5 minutes. Discard the supernatant and flick the pellet to disperse it, ensuring no visible clumps. Wash once with PBS.
[0119] 7. Add an appropriate amount of DMEM culture medium containing 10% FBS and transfer the cells to a culture dish. Allow the cells to adhere to the culture dish for 1 hour and 20 minutes. Collect the supernatant, which contains cardiomyocytes with a purity of approximately 85%.
[0120] 8. The cell supernatant was then used to count the cells.
[0121] 9. Cardiomyocytes were cultured at a rate of 5×10 5cells / well were seeded into 12-well culture plates or 2.5×10 5 / well inoculated into confocal microplate EZ SLIDES (PEZGS0416, Millipore) were placed in a 37°C and 5% carbon dioxide incubator and cultured overnight.
[0122] 10. Wash the cells in the culture plate or confocal microtome twice with PBS, add Ad-Ptma or negative control virus Ad-Ptma in serum-free culture medium, and add to the cardiomyocytes for infection.
[0123] 11. The culture medium was replaced with 0.5% FBS containing 10 μM EdU and cultured for 24 hours to label DNA replication. After 24 hours of labeling, cTNTs were immunostained with the proliferation marker EdU and the proliferation markers pH3 and AuroraB, respectively. Colocalization analysis was performed using a laser scanning confocal microscope or its Z-axis scanning. The experimental flow chart is shown in the figure below. Figure 25 As shown, the results are Figures 26 to 32 shown.
[0124] Figure 25 Western blot was used to detect the expression level of PTMA protein after Ad-Ptma was expressed in neonatal rat primary cardiomyocytes (NRCM), and it was found that PTMA protein was significantly highly expressed.
[0125] like Figure 26 The figure shows the immunostaining of neonatal rat cardiomyocytes (NRCM) treated with Ad-Luc or Ad-Ptma using the proliferation marker EdU and cTNT. + cTNT + Cells indicate proliferating cardiomyocytes. cTNT (red) labels cardiomyocytes, EdU (green) marks proliferation, and DAPI (blue) labels cell nuclei. Figure 27 for Figure 26 The statistical graph shows that compared with the Ad-Luc control group, the addition of Ad-Ptma can significantly increase EdU + cTNT + The results showed that Ptma promoted the proliferation of cardiomyocytes in neonatal rats.
[0126] Figure 28 Neonatal rat cardiomyocytes (NRCM) were treated with Ad-Luc or Ad-Ptma and then immunostained with the proliferation marker pH3 and cTNT. + cTNT +Cells indicate proliferating cardiomyocytes. cTNT (red) labels cardiomyocytes, pH3 (green) labels proliferation markers, and DAPI (blue) labels cell nuclei. Figure 29 for Figure 28 The statistical graph shows that the addition of Ad-Ptma can significantly increase the pH3 + cTNT + The results showed that Ptma promoted the mitosis of neonatal rat cardiomyocytes.
[0127] Figure 30 Neonatal rat cardiomyocytes (NRCM) were treated with Ad-Luc or Ad-Ptma and immunostained with the proliferation marker Aurora B and cTNT. + cTNT + The cells indicate proliferating cardiomyocytes, as indicated by white arrows. cTNT (red) labels cardiomyocytes, AuroraB (green) labels proliferation indicators, and DAPI (blue) labels cell nuclei. Figure 31 for Figure 30 The statistical graph shows that the addition of Ad-Ptma can significantly increase the expression of Aurora B compared with the Ad-Luc control group. + cTNT + The ratio of cells promotes the cytokinesis of cardiomyocytes.
[0128] From the above results, it can be seen that after neonatal rat cardiomyocytes (NRCM) were treated with Ad-Ptma for 24 hours, EdU + , pH3 + and AuroraB + The number of neonatal rat cardiomyocytes (NRCM) increased significantly, indicating that the rat-derived Ptma coding sequence can promote the proliferation of neonatal rat cardiomyocytes, promote the regeneration and repair of rat myocardial tissue in vivo, and achieve a therapeutic effect in rat myocardial infarction.
[0129] Example 6 Ptma promotes the proliferation of cardiomyocytes derived from human induced pluripotent stem cells
[0130] Human induced pluripotent stem cell-derived cardiomyocytes (hiPSC-CMs) were generated and the regenerative effect of Ptma on human iPSC-CMs was verified in vitro. The specific steps are as follows:
[0131] 1. Dissociate hiPSCs using PBS solution and 0.5 mM EDTA at a ratio of 10:1.
[0132] 2. Use Human cardiomyocytes were cultured in maintenance medium for 3 days.
[0133] 3. When the cells reached 80% confluence, culture them in Induction Medium II for 2 days.
[0134] 4. Then culture in Induction Medium III. Thereafter, replace Induction Medium III every other day.
[0135] 5. Start observing the spontaneous contraction of cells on the 8th day after induction. hiPSC-CMs were obtained by purifying cardiomyocytes using human cardiomyocyte purification medium.
[0136] After hiPSC-CMs were infected with Ad-Luc (control group) or Ad-hPtma (experimental group) for 24 hours, the culture medium was replaced with stem cell differentiation maintenance medium containing 10 μM EdU and cultured for 24 hours to mark DNA replication. After 24 hours of labeling, cTNTs were immunostained with the proliferation marker EdU and the proliferation markers pH3 and Aurora B, respectively. Colocalization analysis was performed using laser scanning confocal microscopy or its Z-axis scanning. The experimental flow chart is shown in the figure. Figure 32 , the results are as follows Figures 33 to 39 shown.
[0137] Figure 33 To detect the expression level of PTMA protein after Ad-hPtma was expressed in hiPSC-CMs using Western blot.
[0138] like Figure 34 The figure shows the immunostaining of the proliferation marker EdU and cTNT after hiPSC-CMs were treated with Ad-Luc or Ad-hPtma. + cTNT + The cells indicate proliferating cardiomyocytes, as indicated by white arrows. cTNT (red) labels cardiomyocytes, EdU (green) labels proliferation indicators, and DAPI (blue) labels cell nuclei. Figure 35 for Figure 34 The statistical graph shows that compared with the Ad-Luc control group, the addition of Ad-hPtma can significantly increase EdU + cTNT + The proportion of cells.
[0139] Figure 36 After hiPSC-CMs were treated with Ad-Luc or Ad-hPtma, the proliferation marker pH3 was used for immunostaining with cTNT. + cTNT +The cells indicate proliferating cardiomyocytes, as indicated by white arrows. cTNT (red) labels cardiomyocytes, pH3 (green) labels proliferation indicators, and DAPI (blue) labels cell nuclei. Figure 37 for Figure 36 The statistical graph shows that the addition of human Ad-hPtma can significantly increase the pH3 + cTNT + The proportion of cells.
[0140] Figure 38 After hiPSC-CMs were treated with Ad-Luc or Ad-hPtma, the proliferation marker Aurora B was immunostained with cTNT. + cTNT + The cells indicate proliferating cardiomyocytes, as indicated by white arrows. cTNT (red) labels cardiomyocytes, Aurora B (green) labels proliferation indicators, and DAPI (blue) labels cell nuclei. Figure 39 for Figure 38 The statistical graph shows that compared with the Ad-Luc control group, the addition of human Ad-hPtma can significantly increase the expression of AuroraB + cTNT + The proportion of cells.
[0141] From the above results, it can be seen that after human cardiomyocytes were treated with Ad-hPtma for 24 hours, EdU + , pH3 + and AuroraB + The number of hiPSC-CMs increased significantly, indicating that the human Ptma coding sequence can promote the proliferation of hiPSC-CM cardiomyocytes, promote the regeneration and repair of myocardial tissue, and achieve a therapeutic effect in human myocardial infarction.
[0142] As can be seen from the above examples, the use of the PTMA protein coding sequence provided by the present invention in the preparation of a drug for treating myocardial infarction can promote the proliferation of damaged myocardial cells, regenerate and repair myocardial tissue, reconstruct the heart morphology after myocardial infarction, restore the heart's pumping function, alleviate the progression of cardiac pathological remodeling, and prevent the occurrence of heart failure by overexpressing the PTMA protein coding sequence after myocardial infarction. Furthermore, it can be seen from the examples that the therapeutic effect is still maintained 8 weeks after myocardial infarction, indicating that the PTMA protein coding sequence provided by the present invention has a long-term therapeutic effect on cardiac function after myocardial infarction.
[0143] The above-described embodiments merely illustrate several implementations of the present invention, and while their descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the present invention. It should be noted that a person skilled in the art would be able to make numerous variations and improvements without departing from the spirit of the present invention, all of which fall within the scope of protection of the present invention. Therefore, the scope of protection of the present invention shall be determined by the appended claims.
Claims
1. Application of a PTMA protein coding sequence in the preparation of a drug for treating myocardial infarction, characterized in that: The myocardial infarction treatment is to promote the proliferation of damaged myocardial cells, regenerate and repair myocardial tissue, rebuild the heart morphology after myocardial infarction, restore the heart's pumping function, and prevent heart failure; wherein, the PTMA protein coding sequence is a mouse-derived PTMA protein coding sequence or a human-derived PTMA protein coding sequence; the mouse-derived PTMA protein coding sequence is shown in Seq ID No. 1; the human-derived PTMA protein coding sequence is shown in Seq ID No. 3.
Citation Information
Patent Citations
Covered storage funnel
CA2004500A1
Automatic animal feeder
CA2005100A1
Wettable, flexible, oxygen permeable contact lens containing block copolymer polysiloxane-polyoxyalkylene backbone units
CA2015002A1