Promoter, gene editing method and application thereof
By editing the rice Ehd1 promoter with CRISPR/Cas9 and inserting an expression cassette to regulate gene expression, the problem of delayed flowering in rice was solved, and the flowering period was advanced.
Patent Information
- Application Number
- CN202410796360.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-06-20
- Publication Date
- 2025-12-26
- Estimated Expiration
- 2044-06-20
AI Technical Summary
Current technology cannot advance the flowering/heading stage of rice by editing the Ehd1 gene or promoter.
CRISPR/Cas9 gene editing technology was used to target and modify the Ehd1 promoter region in the rice genome, inserting specific expression cassettes to regulate gene expression and advance the flowering period of rice.
The earlier flowering period of rice was successfully achieved, specifically 3.4 days earlier under long-day conditions and more than 5.1 days earlier under short-day conditions.
Smart Images

Figure CN118792300B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The application belongs to the field of genetic engineering, and particularly relates to a promoter, a gene editing method and application thereof. BACKGROUND
[0002] Gene editing is an effective tool for improving the traits of species. In addition to being able to edit genes, promoters can also be edited to change the expression of genes by changing the characteristics of promoters, thereby achieving the effect of improving traits. For example, modifying the promoter of the rice OsSWEET gene can improve the resistance of rice to bacterial blight (Oliva, R., Ji, C., Atienza-Grande, G. et al. Broad-spectrum resistance to bacterial blight in rice using genome editing [J]. Nat Biotechnol., 2019, 37, 1344-1350); editing the SlCLV3 promoter in tomatoes can obtain continuously changing phenotypes, so that the phenotype can be fine-tuned (Rodríguez-Leal D, Lemmon Z H, Man J, et al. Engineering Quantitative Trait Variation for Crop Improvement by Genome Editing [J]. Cell, 2017, 171:470-480.e8.).
[0003] Ehd1 is an important flowering regulation gene in rice. Editing the Ehd1 promoter region can delay the flowering stage / heading stage of rice, for example, CN108841855A and CN117625602A. However, the art has not yet achieved early flowering stage / heading stage of rice by editing the Ehd1 gene or promoter. SUMMARY
[0004] The purpose of the present application is to provide a new type of promoter.
[0005] To achieve the above-mentioned purpose, the present application adopts the following technical solutions:
[0006] The present application provides a promoter, characterized in that the promoter sequence is shown in SEQ ID NO. 12 or SEQ ID NO. 13.
[0007] The present application also provides an expression cassette, characterized in that the expression cassette is sequentially connected by the above-mentioned promoter, a nucleic acid molecule encoding the amino acid sequence shown in SEQ ID NO. 2, and a terminator with the sequence shown in SEQ ID NO. 3.
[0008] In some embodiments, the nucleotide sequence of the above-mentioned nucleic acid molecule encoding the amino acid sequence shown in SEQ ID NO. 2 is shown in SEQ ID NO. 4 or SEQ ID NO. 5.
[0009] The present application also provides a method for early flowering of rice, characterized in that it comprises any one of the following:
[0010] (1) using genetic engineering means to target modify the sequence of the rice genomic region shown in SEQ ID NO. 1, and selecting a plant with early flowering of rice;
[0011] (2) inserting the expression cassette containing the expression cassette of claim 2 into the rice genome, and selecting a plant with early flowering of rice.
[0012] In some embodiments, the above-mentioned genetic engineering means uses CRISPR / Cas9 gene editing method.
[0013] The present application also provides a kit for early flowering of rice, characterized in that it comprises any one of the following:
[0014] (1) an RNA molecule capable of simultaneously recognizing the target sequences shown in SEQ ID NO. 6 and SEQ ID NO. 7, or an RNA molecule capable of simultaneously recognizing the target sequences shown in SEQ ID NO. 6 and SEQ ID NO. 8;
[0015] (2) a DNA molecule encoding the RNA of (1);
[0016] (3) a vector expressing the RNA of (1).
[0017] In some embodiments, the above-mentioned kit further comprises a Cas9 protein or a nucleic acid molecule encoding a Cas9 protein or a vector expressing a Cas9 protein.
[0018] In some embodiments, the above-mentioned RNA molecule is a combination of the sequences shown in SEQ ID NO. 9 and SEQ ID NO. 10, or a combination of the sequences shown in SEQ ID NO. 9 and SEQ ID NO. 11.
[0019] The present application also provides the use of the above-mentioned promoter in enhancing gene expression.
[0020] The present application also provides the use of the above-mentioned expression cassette, method, and kit in early flowering of rice.
[0021] The innovation and beneficial effects of the present application are as follows: in the background of the complexity and unpredictability of promoter structure, the present application obtains a new type of promoter. The promoter can have the technical effect of early flowering of rice. Attached Figure Description
[0022] Figure 1 The location of cis-elements in the Ehd1 promoter region and gene editing target sites.
[0023] Figure 2 Schematic diagram of the T-DNA region structure of a gene editing vector.
[0024] Figure 3 Flowering / heading stage performance of various edited strains under long-day conditions in Wuhan and short-day conditions in Hainan.
[0025] Figure 4 Target sequence editing status of PT1 and PT2 edited lines. Detailed Implementation
[0026] The following definitions and methods are provided to better define this application and to guide those skilled in the art in its practice. Unless otherwise stated, the terms are to be understood in accordance with their conventional usage by those skilled in the art. All patent literature, academic papers, industry standards, and other publicly available publications cited herein are incorporated herein by reference in their entirety.
[0027] As used herein, "rice" is any rice plant and includes all plant varieties that can be bred with rice, including whole plants, plant cells, plant organs, plant protoplasts, plant cell tissue cultures from which plants can be regenerated, plant calli, plant clumps, and plant cells that are intact in plants or parts of plants such as embryos, pollen, ovules, seeds, leaves, flowers, branches, fruit, roots, root tips, anthers, and the like. Nucleic acids are written left to right in 5' to 3' orientation, unless otherwise indicated; amino acid sequences are written left to right in amino to carboxyl orientation, unless otherwise indicated. The amino acids can be represented by either their commonly known three letter symbols or by the one-letter symbols recommended by the IUPAC-IUB Biochemical Nomenclature Commission. Nucleotides, unless otherwise identified, are referred to by their single-letter codes. Numeric ranges are inclusive of the numbers defining the range. As used herein, "nucleic acid" includes polynucleotides of either deoxyribonucleotides or ribonucleotides, in either single- or double-stranded form, and unless otherwise limited, encompasses known analogues of natural nucleotides that have similar binding properties (e.g., peptide nucleic acids) that bind with similar specificity as the natural nucleotides to the same target nucleic acid. As used herein, the term "encoding" or "encoded" with reference to a specified nucleic acid indicates that the nucleic acid includes a nucleotide sequence, which, when incorporated in a protein, results in a protein having the properties specified. The information is transmitted by the sequence of codons in the nucleic acid. As used herein, "full-length sequence" with reference to a particular polynucleotide or its encoded protein refers to the entire nucleic acid sequence or the entire amino acid sequence having the native (non-synthetic) endogenous sequence. The full-length polynucleotide encodes the full-length, catalytically active form of the particular protein. The terms "polypeptide" and "protein" are used interchangeably herein to refer to a polymeric form of amino acids. The term is used to include amino acid polymers in which one or more amino acid residues are artificial chemical mimics of a corresponding naturally occurring amino acid, as well as to include naturally occurring amino acid polymers. The terms "residue" or "amino acid residue" or "amino acid" are used interchangeably herein to refer to an amino acid incorporated into a protein, polypeptide, or peptide (collectively "protein"). The amino acid can be a naturally occurring amino acid and, unless otherwise limited, can include known analogs of naturally occurring amino acids that can function in a similar manner.
[0028] As used herein, the terms "isolated" and "purified" are used interchangeably to refer to a nucleic acid or polypeptide, or biologically active portion thereof, that is substantially or essentially free from components, which naturally accompany or potentially accompany the nucleic acid or polypeptide as found in its natural environment. Thus, an isolated or purified nucleic acid or polypeptide produced by recombinant techniques is substantially free of other cellular material or culture medium when produced by recombinant techniques, or is substantially free of chemical precursors or other chemicals when chemically synthesized. An "isolated" nucleic acid is generally free from sequences (such as protein encoding sequences) that naturally flank the nucleic acid in the genomic DNA of the organism from which the nucleic acid is derived. For example, in various embodiments, the isolated nucleic acid can comprise less than about 0.5 kb of nucleotide sequences that naturally flank the nucleic acid in the genomic DNA of the cell from which the nucleic acid is derived.
[0029] In this application, the words "comprise," "comprises," or "comprising" are to be interpreted as including the elements, numbers or steps described and any additional elements, numbers or steps. A "subject plant" or "subject plant cell" refers to a plant or plant cell in which a genetic modification has taken effect, or a progeny cell of such a modified plant or cell that comprises the modification. A "control" or "control plant" or "control plant cell" provides a reference point for measuring a phenotypic change in a subject plant or plant cell. A control plant or plant cell can include, for example: (a) a wild-type plant or cell, i.e., a plant or cell of the same genotype as the starting material for a genetic modification that produced the subject plant or cell; (b) a plant or plant cell of the same genotype as the starting material but that has been transformed with an empty construct, i.e., a construct that has no known effect on the trait of interest, such as a construct comprising a marker gene; (c) a plant or plant cell that is a non-transformed segregant of the subject plant or plant cell; (d) a plant or plant cell that is genetically identical to the subject plant or plant cell but that has not been exposed to a condition or stimulus that induces expression of the gene of interest; or (e) the subject plant or plant cell itself, under conditions in which the gene of interest is not expressed.
[0030] Those skilled in the art will readily recognize, for example, that advances in the field of molecular biology, such as site-specific mutagenesis and random mutagenesis, polymerase chain reaction methods, and protein engineering techniques, provide a wide range of appropriate tools and procedural steps for modifying or engineering the amino acid sequence and potentially the genetic sequence of a protein of interest in agriculture.
[0031] In some embodiments, alterations can be made to the nucleotide sequences of the application to make conservative amino acid substitutions. Principles and examples of conservative amino acid substitutions are further described below. In certain embodiments, alterations can be made to the nucleotide sequences of the application that do not change the amino acid sequence, e.g., the codons encoding the same amino acid sequence can be replaced with monocot plant preferred codons, without changing the amino acid sequence encoded by the nucleotide sequence. In some embodiments, portions of the nucleotide sequences in the application are replaced with different codons that encode the same amino acid sequence, thereby changing the nucleotide sequence while not changing the amino acid sequence it encodes. Conservative variants include those sequences that encode the same amino acid sequence of a protein of the embodiments due to the degeneracy of the genetic code. In some embodiments, portions of the nucleotide sequences in the application are replaced according to monocot plant preferred codons. Those of skill in the art will recognize that amino acid additions and / or substitutions generally are based on the relative similarity of the amino acid side chains, for example, as is shown by the hydrophobic, charged, size, and other properties of the amino acids. Exemplary amino acid substitution groups that take various of the foregoing properties into consideration are well-known in the art and include: arginine and lysine; glutamate and aspartate; serine and threonine; glutamine and asparagine; and valine, leucine, and isoleucine. Guidance in appropriate amino acid substitutions that do not affect the biological activity of the protein of interest can be found in the model of Dayhoff et al. (1978) Atlas of Protein Sequence and Structure (Natl. Biomed. Res. Found., Washington, D.C), incorporated herein by reference. Conservative substitutions can be made, such as replacing one amino acid with another having similar properties. Identification of sequence identity includes hybridization techniques. For example, all or a portion of a known nucleotide sequence is used as a probe to selectively hybridize to other corresponding nucleotide sequences present in a population of cloned genomic DNA fragments or cDNA fragments from a selected organism (i.e., a genomic or cDNA library).
[0032] In some embodiments, fragments of the nucleotide sequences and the amino acid sequences they encode are also included. As used herein, the term "fragment" refers to a portion of the nucleotide sequence of a polynucleotide or a portion of the amino acid sequence of a polypeptide of the embodiments. Fragments of the nucleotide sequence can encode protein fragments that retain the biological activity of the native or corresponding full-length protein and thus have the protein activity. Mutant proteins include biologically active fragments of the native protein that comprise contiguous amino acid residues that retain the biological activity of the native protein. Some embodiments also include transformed plant cells or transgenic plants comprising at least one nucleotide sequence of the embodiments. In some embodiments, plants are transformed using an expression vector comprising at least one nucleotide sequence of the embodiments operably linked to a promoter that drives expression in plant cells. Transformed plant cells and transgenic plants represent plant cells or plants that comprise a heterologous polynucleotide within their genome. Generally, the heterologous polynucleotide is stably integrated within the genome of the transformed plant cell or transgenic plant such that the polynucleotide is passed to the progeny. The heterologous polynucleotide can be integrated into the genome either alone or as part of an expression vector. In some embodiments, plants contemplated by the present application include plant cells, plant protoplasts, plant cell tissue cultures from which plants can be regenerated, plant calli, plant clumps, and plant cells that are intact plants or parts of plants, such as embryos, pollen, ovules, seeds, leaves, flowers, fruits, ears, kernels, husks, cobs, roots, root tips, anthers, or the like. The present application also includes plant cells, protoplasts, tissues, calli, embryos, and flowers, tassels, ears, grain, and other plant reproductive materials that are produced by, or are derived from, a plant of the present application or its progeny.
[0033] The following examples are intended to illustrate the present application and are not intended to limit the scope of the present application. Modifications or substitutions of the methods, steps or conditions of the present application are considered to be within the scope of the present application without departing from the spirit and scope of the present application. Unless otherwise specified, the examples were performed according to conventional experimental conditions, such as those described in Sambrook et al. (Molecular Cloning: A Laboratory Manual, 2001) or according to the conditions suggested by the manufacturer. Unless otherwise specified, the chemical reagents used in the examples were conventional commercially available reagents and the technical means used in the examples were conventional means known to those skilled in the art.
[0034] Example
[0035] Example 1 Ehd1 promoter element analysis and target design
[0036] Ehd1 is a positive regulator of flowering time in rice. Increasing the expression of Ehd1 can promote early flowering in rice, thereby shortening the growth period of rice and reducing planting costs. However, rice materials overexpressing Ehd1 have lower market value, and knocking out Ehd1 using gene editing technology cannot achieve the technical effect of early flowering in rice. Editing the promoter can regulate the expression of genes, but so far, the editing of the Ehd1 promoter by the person skilled in the art has shown the technical effect of delaying flowering time.
[0037] The inventors aim to achieve the technical effect of early flowering in rice by editing the Ehd1 promoter, so first of all, the cis-elements on the promoter were analyzed. Combined with the analysis results of SNPs and InDels in the 4726 genetic population of rice, the target sites of the Ehd1 promoter region were designed by the online CRISPR-P2.0 tool (http: / / crispr.hzau.edu.cn / CRISPR2 / ). Considering the small effect of a single cis-element and the specificity of the promoter region target, finally 6 target sites far apart and high specificity were selected, T1, T2, T3, T4, T5, T6 (shown in the sequence) respectively: T1: TAGCCAAAGGAGTCAGTTAT; T2: CGTCATGATCATATCAACGG; T3: CTGTCGTATATAGTATTTAC; T4: AATTAGGTGAAATTGACCGG; T5: TCCTCCACAACCGCAATGCG; T6: TATGGGTTAGGATATGGGAA. Figure 1
[0038] Example 2 Genetic editing of the Ehd1 promoter
[0039] Select gRNA encoding 2 target sites respectively to construct a gene editing vector to obtain PD1 (T1+T2), PD2 (T1+T3), PD3 (T3+T4), PD4 (T2+T4), PD5 (T4+T5), PD6 (T4+T6), PD7 (T3+T5) 7 double target editing vectors (vector map see Figure 2 ), each vector is transformed into rice callus to obtain transformed plants.
[0040] Gene editing vectors are obtained using conventional construction methods (such as the method disclosed in CN110093349A patent), and the constructed editing vector is transferred to Agrobacterium strain EHA105 for storage and standby.
[0041] The transformed plants were obtained using the procedure of seed induction of callus and Agrobacterium-mediated transformation, and the specific process refers to the conventional operation method in the art (for example: Chen Qihong, Chen Taiyu, Lin Yongjun, Chen Hao. (2018). Agrobacterium-mediated genetic transformation of japonica rice. Bio-101e1010174.).
[0042] Example 3 Identification of genotype and phenotype of edited plants
[0043] The obtained transformed plants were subjected to genotype identification, and plants with successful editing of target sites were selected. Seven vectors (PD1-PD7) successfully obtained plants with fragment deletion editing. The specific deletion conditions are shown in Table 1.
[0044] Table 1 Deletion of target sites of gene-edited rice of 7 vectors
[0045]
[0046] Then, 61 strains of homozygous deletion and heterozygous deletion in Table 1 were investigated for flowering / heading period traits in the long-day environment of Wuhan, Hubei in summer and the short-day environment of Lingshui, Hainan in winter. The results showed that strains PT1 edited by PD1 vector and PT2 edited by PD2 vector exhibited obvious early flowering / heading (P<0.01), which could be 3.4 days or 8.2 days earlier than the wild type control in long-day environment, and 5.1 days or 6.3 days earlier in short-day environment (Table 2). Figure 3
[0047] Table 2 Heading period performance of edited rice
[0048]
[0049] Statistical results of each 20 T2 generation strains, “**” indicates extremely significant difference.
[0050] The data analysis results of the genotype of PT1 and PT2 after editing showed that PT1 (SEQ ID NO. 12) deleted 374 bp between T1 and T2 target sites, and PT2 (SEQ ID NO. 13) deleted 526 bp between T1 and T3 target sites. Figure 4 These two edited promoters have the effect of increasing the expression amount of Ehd1 and accelerating the flowering of rice.
[0051] Although the present application has been described in detail in the foregoing embodiment and specific implementation, some modifications or improvements can be made on the basis of the present application, which is obvious to those skilled in the art. Therefore, these modifications or improvements made on the basis of not deviating from the spirit of the present application, all belong to the scope of protection claimed by the present application.
Claims
1. A promoter, characterized in that: The promoter sequence is shown as SEQ ID NO. 12 or SEQ ID NO.
13.
2. An expression cassette characterized in that: The promoter of claim 1, the nucleic acid molecule encoding the amino acid sequence shown as SEQ ID NO. 2, and the terminator sequence shown as SEQ ID NO. 3 are sequentially connected.
3. The expression cassette of claim 2, wherein: The nucleotide sequence of the nucleic acid molecule encoding the amino acid sequence shown as SEQ ID NO. 2 is shown as SEQ ID NO. 4 or SEQ ID NO.
5.
4. A method for early flowering in rice, characterized by: Inserting the expression cassette of any one of claims 2-3 into the genome of rice, and selecting the plants with early flowering period.
5. Use of the expression cassette of any one of claims 2-3 or the method of claim 4 in early flowering period of rice.
Citation Information
Patent Citations
Method for breeding long-growth period japonica rice varieties by editing rice Ehd1 gene
CN108841855A
SigRNAs specifically shearing rice xal3 gene promoter using CRISPR / Cas9 system and its application
CN110093349A
Method for delaying heading period of rice and improving yield based on editing rice Ehd1 gene promoter region
CN117625602A
Rice dominant precocious gene segment as well as preparation and application thereof
CN118165985A